CN108042529A - A kind of new application of indole ketone compound - Google Patents
A kind of new application of indole ketone compound Download PDFInfo
- Publication number
- CN108042529A CN108042529A CN201810100822.5A CN201810100822A CN108042529A CN 108042529 A CN108042529 A CN 108042529A CN 201810100822 A CN201810100822 A CN 201810100822A CN 108042529 A CN108042529 A CN 108042529A
- Authority
- CN
- China
- Prior art keywords
- tmepai
- ketone compound
- indole ketone
- cell
- compound
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/40—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil
- A61K31/403—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with one nitrogen as the only ring hetero atom, e.g. sulpiride, succinimide, tolmetin, buflomedil condensed with carbocyclic rings, e.g. carbazole
- A61K31/404—Indoles, e.g. pindolol
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to a kind of application of indole ketone compound, the micromolecular compound is 3 ketone of indole ketone compound 2 (2 nitrobenzal) indoles, can effectively inhibit the transcript and expression of TMEPAI.MTT experiment, plate clone experiment and EdU experiments show that the indole ketone compound can effectively inhibit tumor cell activity and cell Proliferation.DAPI Coloration experiments prove that the indole ketone compound can be with inducing cell apoptosis.These all show the indole ketone compound can using targeted inhibition TMEPAI expression and can be as a kind of brand-new antitumor drug.
Description
Technical field
The present invention relates to the new application of compound, especially a kind of application of indole ketone compound.
Background technology
Prostate transmembrane protein TMEPAI (Transmembrane prostate androgen-induced protein)
Also known as PMEPA1 (Prostate transmembrane protein androgen induced 1) or STAG1 (Solid
Tumor-associated 1protein), be made of 287 amino acid, be N- ends contain there are one transmembrane region (TMD) I types across
Memebrane protein.The C- ends of TMEPAI albumen highly conserved PY structural domains (i.e. Pro-rich sequence PPxY) containing there are two, PYI
In the central area of TMEPAI albumen, PYII is close to its c-terminus.Research report, TMEPAI albumen can pass through its this 2
PY structural domains and E3 ubiquitin ligases Nedd4 (Neuronal precursor cell-expressed developmentally
Down-regulated 4) WW structural domains interaction.
The people TMEPAI assignments of genes gene mapping are regulated and controled in chromosome 20q13, expression by androgen, and TMEPAI is in normal cell
Expression quantity is relatively low, the great expression only in prostate epithelial cell.Recent studies have shown that TMEPAI albumen is in a variety of cancer cells
It is middle to there is high expression, including prostate cancer, breast cancer, oophoroma, colon cancer, lung cancer, kidney and stomach cancer cell.In addition, research
Show that TMEPAI high expression is closely related with the poor prognosis of cancer patient in breast cancer.
The study found that TGF-β, EGF, IGF, PDGF can induce the expression of TMEPAI, result of study shows transcription factor
SP1 (Specificity protein 1) can be bonded directly to the promoter region of TMEPAI genes, and promote TMEPAI's
Expression, these experimental results all imply TMEPAI albumen expression and cancer occurrence and development it is closely related.TMEPAI exists
In lung carcinoma cell express it is higher than normal cell, can by adjust active oxygen (reactive oxygen species, ROS) and
Substrate 1 (insulin receptor substrate-1, IRS-1) promotes the conversion of lung carcinoma cell Epithelial and stromal
(epithelial-mesenchymal transition, EMT) and cell migration.The research of Vo Nguyen et al. shows
TMEPAI can block TGF-β signal pathway and promote cell growth by reducing Smad phosphorylations.Also there is result of study table
Bright, TMEPAI can be combined and be promoted the degradation of (T β RI) and then inhibit TGF-β signal and promote the cell of lung cell A549
One-tenth knurl ability in multiplication, cell migration, cell invasion and cell nude mouse.The hair of tumour can be limited by inhibiting the expression of TMEPAI
Raw and development, therefore inhibition TMEPAI can be as a potential target for the treatment of cancer.
The content of the invention
The technical problems to be solved by the invention are to provide a kind of application of indole ketone compound.
In order to solve the above technical problems, the technical scheme is that：
Application of the indole ketone compound in terms of TMEPAI expression inhibiting agent is prepared, the indole ketone compound are 2-
(2- nitros-benzal)-indoles -3- ketone
(2- (2-nitrobenzylidene) indolin-3-one) has structure shown in formula (I)：
Preferably, the application of above-mentioned indole ketone compound, the indole ketone compound are used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit the transcription of TMEPAI in HeLa cells.
Preferably, the application of above-mentioned indole ketone compound, the indole ketone compound are used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit the expression of TMEPAI in HeLa cells.
Preferably, the application of above-mentioned indole ketone compound, the indole ketone compound are used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit HeLa cell viabilities.
Preferably, the application of above-mentioned indole ketone compound, the indole ketone compound are used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit HeLa cell Proliferations.
Preferably, the application of above-mentioned indole ketone compound, the indole ketone compound are used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively induce HeLa Apoptosis.
Application of the indole ketone compound in terms of antitumor drug is prepared, the indole ketone compound are 2- (2- nitre
Base-benzal)-indoles -3- ketone.
The beneficial effects of the invention are as follows：
Indole ketone compound 2- (2- nitros-benzal)-indoles -3- ketone of the present invention be micromolecular compound, energy
Effectively inhibit the activity of TMEPAI gene promoters, and then applied in terms of antitumor drug.
Semi-quantitative PCR assay and immunoblot experiment show that the compound can effectively inhibit the transcript and expression of TMEPAI.
MTT experiment, plate clone experiment and EdU show that the compound can inhibit HeLa cell viabilities and cell Proliferation.DAPI is dyed
Experiment and flow cytometry show that the compound can promote Apoptosis.These results all illustrate that the compound can be with target
To inhibit TMEPAI expression and can be as a kind of brand-new antitumor drug.
Description of the drawings
Fig. 1 is for the present invention using TMEPAI promoter reporter gene System For Screening TMEPAI expression inhibiting agent as a result, compiling
The drug of number JHY-A007-50 is drug of the present invention.As a result illustrate, the drug of number JHY-A007-50 is this hair
The bright drug is the effective TMEPAI inhibitor obtained using TMEPAI promoter reporter gene System For Screenings；
Fig. 2 is that semiquantitive PCR of the present invention detects the result that drug of the present invention influences TMEPAI transcriptions.As a result say
Bright, the drug of number JHY-A007-50 is the transcription that drug of the present invention can effectively inhibit TMEPAI in HeLa cells.
Fig. 3 is the result that immune-blotting method of the present invention drug of the present invention influences TMEPAI expression.As a result illustrate,
The drug of number JHY-A007-50 is the expression that drug of the present invention can effectively inhibit TMEPAI in HeLa cells.
Fig. 4 is that mtt assay of the present invention detects the result that drug of the present invention influences cell viability.As a result illustrate, number
The drug of JHY-A007-50 is that drug of the present invention can effectively inhibit HeLa cell viabilities, to normal L02 cell viabilities shadow
Sound is smaller.
Fig. 5 is that plate clone method of the present invention detects the result that drug cell proliferation of the present invention influences.As a result illustrate,
The drug of number JHY-A007-50 is that drug of the present invention can effectively inhibit HeLa cell Proliferations.
Fig. 6 is that EdU decoration methods of the present invention detect the result that drug of the present invention influences Apoptosis.As a result illustrate,
The drug of number JHY-A007-50 is that drug of the present invention can effectively induce HeLa Apoptosis.
Fig. 7 is that DAPI decoration methods of the present invention detect the result that drug of the present invention influences Apoptosis.As a result illustrate,
The drug of number JHY-A007-50 is that drug of the present invention can effectively induce HeLa and MCF-7 Apoptosis.
Specific embodiment
In order to which those skilled in the art is made to be better understood from technical scheme, With reference to embodiment
Technical solution of the present invention is described in further detail.
Embodiment
(1) screening of TMEPAI expression inhibitings agent
1. cell transfecting：In 2 3cm steril cell wares, cell turns HeLa cell inoculations respectively after being spread to 60-70%
Plasmid pGL4 or pGL4-TMEPAI-Luc promoter is contaminated, is inoculated into after 6h in 96 orifice plates, per 8000, hole cell.
2. micromolecular compound handles cell：JHY-A007-50 (i.e. compound 2- (2- nitros-benzal)-indoles -3-
Ketone) (2,4,8,16 μM) processing cells of four concentration, each 3 multiple holes of concentration are cultivated for 24 hours in incubator.
3. cell cracking：Added in hole 90 μ L Extraction buffer [by final concentration of 1%TritonX-100,
15mM MgCl2,4mM EGTA, 1mM DTT, 25mMglycyglycine, deionized water supply 10mL, and 4 DEG C are kept in dark place], it mixes
It is even.30min is cracked on ice, is during which gently shaken once, makes cracking abundant.
4. 45 μ L Assay cocktail buffer is taken [to sequentially add deionized water, final concentration of 30mM in order
ATP (pH 5.0), 0.1M KH2PO4 (pH 7.8), 0.1M MgCl2, mixing are now with the current] and 105mL Luciferin
Buffer [80 μ L H2O, 20 μ L 0.1M KH2PO4 (pH7.8), 1 μ L 20mMLuciferin, mixing are now with the current] is mixed,
Micropore board detector (SynergyTM4) is added to measure uciferase activity at 255nm wavelength.
5. betagalactosidase activity measures：40 μ L lysate samples are drawn in 96 porocyte culture plates, add in 54 μ L
Buffer Z (add in 36 μ L beta -mercaptoethanols per 10mL buffer solutions) using preceding, then be rapidly added 18 μ L 6mg/mL ONPG it is molten
Liquid gently shakes mixing, and when there are one (5-10min) during the solution turned yellow in hole, the extinction under 420nm wavelength is measured with microplate reader
Angle value, OD420.
6. uciferase activity amendment：Standard value=uciferase activity value/betagalactosidase activity value.With fluorescein
Based on enzymatic activity, calculate reporter gene firefly luciferase relative activity (pGL4-TMEPAI promoters fluorescent value/
PGL4 fluorescent values), control group fluorescence ratio is set to 1.Fig. 1's the results show that compound JHY-A007-50 to TMEPAI promoters
Activity just have stronger inhibitory action, to the IC50 values of TMEPAI promoters about 3.5 μm of ol/L.
(2) influences of the compound JHY-A007-50 to TMEPAI genetic transcriptions
1. handling HeLa cells for 24 hours using the compound JHY-A007-50 of 4 μm of ol/L, control group utilizes the DMSO of equivalent
Do same time processing.
2. extracting HeLa cell total rnas, and obtained accordingly using reverse transcription reagent box (Thermo K1622) reverse transcription PCR
CDNA.
3. being operated on ice, following 7 kinds of reagents mixing (reaction system is added in PCR pipe：100μL)：
RT-PCR reaction systems
The upstream primer sequence of TMEPAI：F5 '-GGAATTCATGCACCGCTTGATGGGGGTC-3 ',
The downstream primer sequence of TMEPAI：R5′-CGGGATCCTTACTTGTCGTCATCGTCTTTG-3′.
β-actin sense primers：GGAATTCATGTCAGAACCGGCTGG,
β-actin anti-sense primers：CTCCTTAATGTCACGCACGATTTC.
4. reaction condition：
After about 1.5h, reaction terminates, and mixing wink from accurately taking on 10 μ L pcr amplification products and 26 × DNA of μ L respectively
Sample buffer solution mixes, and electrophoresis in the Ago-Gel for being 1.0% in concentration, DNA standard molecular weights Marker is as reference, generally
Electrophoretic voltage 130V, about 20-30min, gel imaging system is taken pictures and analysis result.Fig. 2 is the results show that compound JHY-
The transcription of TMEPAI is lowered after A007-50 processing HeLa cells, illustrates that compound JHY-A007-50 can inhibit in HeLa cells
The transcription of TMEPAI.
(3) influence that compound JHY-A007-50 expresses TMEPAI
1. HeLa cells are handled for 24 hours, when control group does identical with the DMSO of equivalent for (4 μM) with compound JHY-A007-50
Between handle.
2. extracting total protein of cell, using β-actin as internal reference, the expression quantity of immunoblotting analysis technology detection TMEPAI is utilized.
Fig. 3 is the results show that compound JHY-A007-50 can inhibit the expression of TMEPAI in HeLa cells.
(4) influences of the MTT experiment compound JHY-A007-50 to tumor cell activity
1. 96 orifice plate bed boards：Logarithmic phase HeLa and L02 cell is collected, adjusts the concentration of cell suspension, 100 μ L are added in per hole
Culture medium, bed board make 6000/hole of cell density to be measured.
2. utilize compound JHY-A007-50 or DMSO processing the cell 48h of various concentration (1,2,4,8 μM).
3. it adds in 20 μ L MTT (matching while using is configured to the MTT solution of 5mg/mL with PBS) per hole to continue to cultivate 4h.
4. terminating culture, the culture medium in hole is carefully sucked, is careful not to siphon away precipitation.
5. adding in 200 μ L dimethyl sulfoxide (DMSO)s (DMSO) dissolving precipitation per hole, low-speed oscillation 10min makes crystallization fully dissolve.
6. utilize the absorbance (A570nm) in each hole under enzyme-linked immunosorbent assay instrument detection 570nm wavelength.
7. cell viability=experimental group light absorption value/control group light absorption value.Fig. 4's the results show that compound JHY-A007-50
The vigor of HeLa cells can substantially be inhibited, but it is smaller on the cytoactive influence of normal cell L02, illustrate compound JHY-
A007-50 has specificity to the lethal effect of tumour cell.
(5) influences of the plate clone experiment detection compound JHY-A007-50 to tumor cell proliferation
1. 500-800 cell is inoculated in 35mm tablets.With pipettor, pressure-vaccum for several times, makes cell in tablet as far as possible repeatedly
In be evenly distributed, acellular clustering phenomena.
2. daily micro- Microscopic observation, every to change a not good liquor to cell within 3-5 days.Treat that cell grows up to monoclonal state in tablet,
Next step agent-feeding treatment is carried out, continues culture 2-3 days.It is counted under microscope, counts clone's number that cell number is more than 10.
3. 200 μ LMTT (5mg/mL) are uniformly mixed with 2mL fresh cultures, old culture medium in Tissue Culture Dish is outwelled,
And wash cell once with DPBS, then MTT and culture medium mixed liquor are added in tablet.37 DEG C are placed in, 5%CO2 cell culture
Continue to cultivate 4h in case.
4. taking out tablet, DPBS cleaning cells are simultaneously taken pictures.Fig. 5 is the results show that compound JHY-A007-50 can substantially press down
The clonality of HeLa cells processed shows that compound JHY-A007-50 can inhibit cell Proliferation.
(6) influences of the EdU incorporations experiment detection compound JHY-A007-50 to tumor cell proliferation
EdU is marked
1. 96 orifice plate bed boards：Logarithmic phase cell is collected, adjusts the concentration of cell suspension, 100 μ L culture mediums, paving are added in per hole
Plate makes 6000/hole of cell density to be measured.Because edge hole evaporation is fast, 96 orifice plate rims are filled with PBS.
2. agent-feeding treatment changes attached cell culture solution into pastille culture medium containing 3%FBS, per 100 μ L of hole, continue
In 5%CO2,37 DEG C are incubated culture 22h, while set control group.
3. adding in 1 μ L EdU in per 100 μ L culture mediums of hole its final concentration is made to be about 50 μm of ol/L, be incubated 2-4h, abandon culture
Base (note：100 can be pressed with cell culture medium：1 dilution proportion EdU solution, matching while using).
4. PBS cleaning cell 2 times, each 5min, it is therefore an objective to wash away the EdU for not penetrating into DNA, adherent cell loosely
Cleaning strength can suitably be reduced.
Cell fixation
It 1. adding in 50 μ L cells fixers (PBS i.e. containing 4% paraformaldehyde) per hole, is stored at room temperature and is incubated 30min, abandon solid
Determine liquid (can be used cold methanol is fixed or the modes such as paraformaldehyde carry out cell and fix).
2. adding in the glycine of 50 μ L 2mg/mL per hole, after decolorization swinging table is incubated 5min, glycine solution is abandoned.Purpose is
Remaining paraformaldehyde is neutralized, ensures staining reaction system.
3. adding 100 μ L PBS per hole, decolorization swinging table cleaning 5min abandons PBS.
4. according to experiment needs, permeability of cell membrane (reinforcement) can be enhanced：100 μ L bleeding agents (0.5% are added in per hole
The PBS of TritonX-100), decolorization swinging table is incubated 10min；PBS cleaning 1 time, 5min.
Apollo is dyed
1. add in 100 μ L's per holeStaining reaction liquid (is shown in Table 2-5), room temperature, be protected from light, decolorization swinging table is incubated
After educating 30min, staining reaction liquid (note is abandoned：Incubation time can be suitably adjusted to 10-30min).
2. 100 μ L bleeding agents (PBS of 0.5%Triton X-100) decolorization swinging tables are added in clean 2-3 times, each 10min,
Abandon bleeding agent.
(3. reinforcement) adds in 100 μ L methanol per hole and cleans 1-2 times every time, each 5min；PBS cleaning 1 time, a 5min
(note：Some cells are higher to the adsorptivity of dyestuff, and reinforcement mode need to be used to elute to reduce dyestuff background).
DNA is dyed
1. prepared by 1 × Hoechst33342 reaction solutions：100 are pressed with appropriate amount of deionized water：1 dilution proportion DNA combination liquid
Hoechst33342,4 DEG C are kept in dark place.
2. 1 × Hoechst, 33342 reaction solutions stated and prepared are added per hole enters 100 μ L, room temperature is protected from light, decolorization swinging table
After being incubated 30min, staining reaction liquid is abandoned.
3. add in 100 μ L PBS cleaning every time per hole 3 times.If subject to conditions, can be protected from light with 100 μ L PBS 4 DEG C it is wet
Profit preservation is to be measured, but is not to be exceeded 3 days.
Image acquisition and analysis
Fluorescence observation is carried out after the completion of dyeing immediately to take pictures.Fig. 6 is the results show that compound JHY-A007-50 can inhibit
Cell Proliferation.
(7) DAPI dyes the influence of detection compound JHY-A007-50 Apoptosis
1. being inoculated with 6000-8000 cell per hole in 96 orifice plates, 37 DEG C are placed in, overnight incubation under the conditions of 5%CO2.
After 2. cell is completely adherent, cell is handled respectively for 24 hours and 48h with various concentration compound.
3. taking out 96 orifice plates, culture medium in hole is gently removed with pipettor, is washed 1 time with PBS.
4. adding in 100 μ L, 3% paraformaldehydes per hole, room temperature fixes 20-30min.
5. pipettor removes paraformaldehyde, washed 2-3 times with PBS.
6. adding in 100 μ L 0.2%Triton X-100 per hole, 5min is placed at room temperature for.
7. removing Triton X-100, PBS is washed 2-3 times.The PBS in aperture is blotted only with pipettor.
8. DPAI dye liquors press 1 with 3%BSA：100 dilutions, being carefully added drop-wise to kind has in the hole of cell, per 50 μ L of hole, is protected from light
Dye 30min.
It 8. dyeing finishes, is washed 3 times, is blotted as far as possible only with PBS, put observation under inverted fluorescence microscope immediately and take pictures.Fig. 7 knots
Fruit shows that the drug of number JHY-A007-50 can effectively induce HeLa and MCF-7 Apoptosis.
To sum up, compound 2- (2- nitros-benzal)-indoles -3- ketone of the present invention can effectively inhibit turning for TMEPAI
Record and expression.It is thin that MTT experiment, plate clone experiment and EdU experiments show that the indole ketone compound can effectively inhibit tumour
Born of the same parents' vigor and cell Proliferation.DAPI Coloration experiments prove that the indole ketone compound can be with inducing cell apoptosis.These all show
The indole ketone compound can using targeted inhibition TMEPAI expression and can be as a kind of brand-new antitumor drug.
The above-mentioned detailed description carried out with reference to specific embodiment to a kind of new application of indole ketone compound, is to say
It is bright property rather than limited, several embodiments can be included according to limited scope, therefore it is of the invention total not departing from
Change and modification under body design, should belong within protection scope of the present invention.
Claims (7)
1. application of the indole ketone compound in terms of TMEPAI expression inhibiting agent is prepared, the indole ketone compound is 2-
(2- nitros-benzal)-indoles -3- ketone has structure shown in formula (I)：
2. application according to claim 1, it is characterised in that：The indole ketone compound is used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit the transcription of TMEPAI in HeLa cells.
3. application according to claim 1, it is characterised in that：The indole ketone compound is used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit the expression of TMEPAI in HeLa cells.
4. application according to claim 1, it is characterised in that：The indole ketone compound is used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit HeLa cell viabilities.
5. application according to claim 1, it is characterised in that：The indole ketone compound is used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively inhibit HeLa cell Proliferations.
6. application according to claim 1, it is characterised in that：The indole ketone compound is used to prepare TMEPAI expression
During inhibitor, the indole ketone compound can effectively induce HeLa Apoptosis.
7. application of the indole ketone compound in terms of antitumor drug is prepared, the indole ketone compound for 2- (2- nitros-
Benzal)-indoles -3- ketone.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810100822.5A CN108042529A (en) | 2018-02-01 | 2018-02-01 | A kind of new application of indole ketone compound |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810100822.5A CN108042529A (en) | 2018-02-01 | 2018-02-01 | A kind of new application of indole ketone compound |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108042529A true CN108042529A (en) | 2018-05-18 |
Family
ID=62125548
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810100822.5A Pending CN108042529A (en) | 2018-02-01 | 2018-02-01 | A kind of new application of indole ketone compound |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108042529A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017180644A1 (en) * | 2016-04-11 | 2017-10-19 | Middle Tennessee State University | Therapeutic aurones |
-
2018
- 2018-02-01 CN CN201810100822.5A patent/CN108042529A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017180644A1 (en) * | 2016-04-11 | 2017-10-19 | Middle Tennessee State University | Therapeutic aurones |
Non-Patent Citations (2)
| Title |
|---|
| MIRIAN R.C. DE CASTRO等: "Tandem chalcone-sulfonamide hybridization, cyclization and further Claisen–Schmidt condensation: Tuning molecular diversity through reaction time and order and catalyst", 《ARABIAN JOURNAL OF CHEMISTRY》 * |
| WEI ZHANG等: "Functionalized 3-benzylidene-indolin-2-ones: Inducers of NAD(P)H-quinone oxidoreductase 1 (NQO1) with antiproliferative activity", 《BIOORGANIC & MEDICINAL CHEMISTRY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Taylor et al. | Selective expression of an endogenous inhibitor of FAK regulates proliferation and migration of vascular smooth muscle cells | |
| Shibata et al. | GTL1 and DF1 regulate root hair growth through transcriptional repression of ROOT HAIR DEFECTIVE 6-LIKE 4 in Arabidopsis | |
| Lipsick et al. | Transformation by v-Myb | |
| Amuthan et al. | Mitochondria‐to‐nucleus stress signaling induces phenotypic changes, tumor progression and cell invasion | |
| Wehner et al. | High‐throughput protoplast transactivation (PTA) system for the analysis of Arabidopsis transcription factor function | |
| Yang et al. | Transcriptional activation of caspase-6 and-7 genes by cisplatin-induced p53 and its functional significance in cisplatin nephrotoxicity | |
| Quensel et al. | In vivo analysis of importin α proteins reveals cellular proliferation inhibition and substrate specificity | |
| Wakatake et al. | An auxin transport network underlies xylem bridge formation between the hemi-parasitic plant Phtheirospermum japonicum and host Arabidopsis | |
| Geserick et al. | Expression of mTert in primary murine cells links the growth-promoting effects of telomerase to transforming growth factor-β signaling | |
| Pim et al. | The human papillomavirus (HPV) E6* proteins from high-risk, mucosal HPVs can direct degradation of cellular proteins in the absence of full-length E6 protein | |
| Klein et al. | Cell adhesion, cellular tension, and cell cycle control | |
| Park et al. | Purpurin inhibits adipocyte-derived leucine aminopeptidase and angiogenesis in a zebrafish model | |
| Shafie et al. | Reappraisal of putative glyoxalase 1-deficient mouse and dicarbonyl stress on embryonic stem cells in vitro | |
| Wu et al. | Cardiac development in the presence of cadmium: an in vitro study using human embryonic stem cells and cardiac organoids | |
| CN107435074A (en) | Application of the CES8 genes in clear cell carcinoma of kidney diagnosis and treatment | |
| CN105582525B (en) | Application of the CIRP in terms of preparing Telomerase bonding agent or telomerase activation adjusting control agent | |
| Yakushiji-Kaminatsui et al. | RING1 proteins contribute to early proximal-distal specification of the forelimb bud by restricting Meis2 expression | |
| Alcock et al. | Expression of Sox1, Sox2 and Sox9 is maintained in adult human cerebellar cortex | |
| Gamart et al. | SMAD4 target genes are part of a transcriptional network that integrates the response to BMP and SHH signaling during early limb bud patterning | |
| Kim et al. | Analysis of mitochondrial double-stranded RNAs in human cells | |
| Kolomeichuk et al. | Induction of apoptosis by vinblastine via c-Jun autoamplification and p53-independent down-regulation of p21WAF1/CIP1 | |
| Kim et al. | MS2 labeling of endogenous beta-actin mRNA does not result in stabilization of degradation intermediates | |
| CN108042529A (en) | A kind of new application of indole ketone compound | |
| Lew et al. | GCN5 inhibits XBP-1S-mediated transcription by antagonizing PCAF action | |
| Liu et al. | Activation of small GTPases RhoA and Rac1 is required for avian reovirus p10-induced syncytium formation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180518 |
|
| RJ01 | Rejection of invention patent application after publication |