CN108029689A - A kind of insecticides and preparation method thereof - Google Patents

Abstract

The present invention relates to field of pesticides, specifically, the present invention relates to a kind of insecticides and preparation method thereof, the insecticides include SEQ ID NO:2nd, the polynucleotide sequence shown in 4,5；Or the polynucleotide sequence hybridized under strict conditions with the polynucleotide sequence of restriction；Or polynucleotide sequence of the polynucleotide sequence with more than 80% homogeneity with restriction；Or the polynucleotide sequence of at least 19 continuous nucleotides of the polynucleotide sequence limited, wherein Thysanoptera insect pest intake include the double-stranded RNA with least one chain of polynucleotide sequence complementation, suppress the growth of the Thysanoptera insect pest.

Description

A kind of insecticides and preparation method thereof

Technical field

The present invention relates to a kind of insecticides and preparation method thereof, are utilized more particularly to one kind under RNAi technologies Target sequence expresses to suppress the method for Frankliniella occidentalis insect pest in tune or obstruction Frankliniella occidentalis body.

Background technology

For the pest disaster in agricultural production, scientific research personnel successfully have developed certain methods and composition.Its In, chemical insecticide is prevention and administers one of effective means of pest and disease damage, but the use of chemical insecticide is a double-edged sword, Can be with problems with while acquisition good result：1) chemical insecticide is without target selectivity, applied chemistry insecticide Injury is will also result in for non-target organism during controlling harmful insect, wherein being no lack of beneficial organism.2) using pest control with insecticide On the soil of agent, it will usually show the barren state of corresponding time.3) chemical insecticide is persistently resided in environment, degraded speed Degree is slow so that there are the residual of chemical insecticide in crop and environment, they can be accumulated in food chain, and the mankind are as food chain Top stand in the breach, the accumulation of these chemical insecticides causes a variety of diseases to be induced to occur, such as cancer.Therefore people are strong It is strong to need the insecticide friendly to environment to be used to controlling or eradicating the insect pest infestation in crop production.

Microbial insecticide, can particularly from bacillus thuringiensis (Bacillus thuringiensis, abbreviation Bt) Using the substitute as chemical insecticide, important function is played in agricultural production, it is to Lepidoptera, coleoptera and Semiptera There is certain insecticidal activity Deng insect, but requirement of the microbial insecticide for dispenser environment is higher, if plantation ring Border is not suitable for the growth of these microorganisms, then needs to repeat dispenser, and even repetitive administration can not reach control evil in some cases The purpose of worm, considerably increases production cost and pest-resistant difficulty.

RNAi antisense technologies are had reported in this area to lower or hinder target insect related gene to be difficult to very to murder Used in multisystem, this there are three main causes.First, the antisense sequences expressed in transformed cells are unstable.Second, conversion is thin The unstability for the antisense sequences expressed in born of the same parents.3rd, with the transport of unstability and antisense sequences run into it is difficult for Also manufacture is difficult for following attempt, and the attempt is：There is provided and can effectively adjust inside the recombinant cell for encoding the antisense sequences The dosage of the positive sense nucleotide sequence expression of program mark.

RNA disturb or RNAi be under cell or whole biological environment with sequence-specific fashion down-regulated gene table A kind of method reached, it is contained by selectively targeted selection and efficient mRNA, can reach orientation interference expression of target gene Purpose.Although being known to this area to carry out control of insect using RNAi technology, this technology is used as control elder brother The key factor of worm invasion and attack measure is the optimal target gene of selection, i.e. afunction causes required bioprocess heavy damage And/or those genes of organisms die.Therefore, the present invention comes real using the specific target gene lowered in pest as a kind of means Insect infestations are now controlled, particularly control the insect infestations of plant.

The content of the invention

The object of the present invention is to provide a kind of insecticides and preparation method thereof, i.e., press following sides using RNAi technology Formula lowers the expression of target sequence：Weaken insect survival, growth, breed, colonize specific environment and/or attack the energy of host Power, to realize control insect infestations and infringement as caused by it.

To achieve the above object, the present invention provides a kind of insecticides, including at least one separated polynucleotides Sequence, the polynucleotide sequence include：

(a)SEQ ID NO:2nd, the polynucleotide sequence shown in 4,5；Or

(b) polynucleotide sequence of the polynucleotide sequence hybridization limited under strict conditions with (a)；Or

(c) polynucleotide sequence limited with (a) has the polynucleotide sequence of more than 80% homogeneity；Or

(d) polynucleotide sequence of at least 19 continuous nucleotides of the polynucleotide sequence that (a) is limited, wherein Thysanoptera Insect pest intake includes the double-stranded RNA with least one chain of polynucleotide sequence complementation, suppresses the Thysanoptera elder brother The growth of insect pest worm；Or

(e) complementary series for the polynucleotide sequence that above-mentioned (a), (b), (c) or (d) is limited.

Further, the polynucleotide sequence further includes the complementary series of above-mentioned polynucleotide sequence, more nucleosides Acid sequence further includes intervening sequence, it is preferable that the polynucleotide sequence is SEQ ID NO:8th, 10 or 11, more nucleosides Acid sequence forms expression cassette under the regulating and controlling sequence regulation and control effectively connected, and the polynucleotide sequence is disturbance ribonucleic acid sequence Row.

Further, the interference RNA sequence plays after being taken in by Thysanoptera insect pest lowers the tassel wing The effect of at least one of mesh insect pest target sequence expression, wherein the interference RNA sequence includes at least one sink Silent element, wherein the silencing elements are a double-stranded regions of the complementary strand comprising annealing, wherein a chain includes and institute State in target sequence target fragments and a complementary nucleotide sequence or be made from it, the target sequence at least in part Row include above-mentioned polynucleotide sequence.

Further, it is suitable to include polynucleotide sequence and at least one described in any of the above-described for the insecticides Carrier, excipient or diluent, or express comprising a kind of or the host cell of the interference RNA sequence can be expressed, Preferably, the host cell is microbial cell.

Further, the composition is pesticide spray.

What the present invention was adjusted or suppressed comprising the expression to one or more target sequences in Thysanoptera insect pest Method, the described method includes：By through stable double-stranded RNA (such as dsRNA) or its modified forms (for example, sequences of small interfering RNAs) Be partly or entirely incorporated into no vertebra harmful insect body in cell or extracellular environment.In insect bodies, dsRNA or SiRNA is entered in cell, and the expression at least one or more of target sequence is suppressed, and this suppression is generated and subtracted Weak insect survival, growth, breeding and the ability for attacking host.

Frankliniella occidentalis (Frankliniella occidentalis) is also known as alfalfa thrips, belongs to Thysanoptera Thysanoptera, Thripidae Thripidae.The worm originates in North America, and nineteen fifty-five finds in Hawaii Kauai first, once It is California, USA the most common type thrips.From after the 1980s, become surging species, varying environment and insecticide are resisted Property enhancing, therefore gradually to external expansion.Frankliniella occidentalis feeding habits are miscellaneous, are currently known host plant up to more than 500 and plant, mainly have Lee, Peach, apple, grape, strawberry, eggplant, capsicum, romaine lettuce, tomato, beans, orchid, chrysanthemum etc., it is climing with the constantly diffusion of Frankliniella occidentalis Prolong, its host types is continuing to increase always.It is said that the habit according to Frankliniella occidentalis is analyzed, it is nearly all in its distributed area Viewing and admiring class flowers has the possibility of entrainment Frankliniella occidentalis.For different types of host plant, though Frankliniella occidentalis has fancy grade Difference, but can survive and there is suitable fertility.

The present invention " RNA disturbs (RNAi) " refers to that some RNA can efficiently, specifically block the table of internal specific gene Reach, promote mRNA to degrade, lure that cells show goes out the phenotype of specific gene missing into, it is also referred to as RNA and intervenes or interfere.RNA is done Disturb be high special the gene silencing mechanism in mRNA level in-site.

The present invention provides a kind of insecticides and preparation method thereof, has the following advantages：

1st, present invention firstly discloses a kind of insecticides, it is used to control Thysanoptera insect pest western it includes multiple The nucleic acid inhibitor of flower thrips, can be directly used for control Thysanoptera infringement plant.

2nd, the present invention is for controlling the target fragment of Thysanoptera insect pest Frankliniella occidentalis not influence the non-target sequence in host The expression of row.

3rd, include multiple nucleic acid inhibitors the present invention provides insecticides, irregular replacement target sequence or Mixed target sequence can avoid Frankliniella occidentalis from producing resistance.

4th, the dsRNA of acquisition can be directly applied to field control pest attacks, operation by the RNAi technology that the present invention utilizes Simplicity, cost is low, environment compatibility is good.

Below by drawings and examples, technical scheme is described in further detail.

Brief description of the drawings

Fig. 1 is that the present invention is used to control the nucleotide sequence of insect infestations and its recombinant expression carrier XHJM-01 of method Carrier schematic diagram.

Embodiment

A kind of technology of insecticides of the present invention and preparation method thereof is further illustrated below by specific embodiment Scheme.

Embodiment 1, target sequence determine

Step 1: extraction Frankliniella occidentalis total serum IgE：With the RNA of conventional Trizol methods extraction Frankliniella occidentalis larva, routine side Method purifies, and DNA enzymatic processing, obtains concentration >=280ng/ μ l, μ g of total amount >=10, OD_260/280For the total serum IgE sample of 1.9-2.1.

Step 2: separation mRNA and synthesis cDNA：Go out the mRNA with polyA with the Beads enrichment with oligo-dT, Then the first chains of cDNA are synthesized with random hexamer and Invitrogen kits.

Step 3: filtering out target sequence, by being compared with NCBI, filtered out through researching and analysing from each metabolic pathway The target sequence of 6 Frankliniella occidentalis, corresponding GENBANK accession number are：GT301184, GenBank:GT308845.1 is specific Information is as follows：

Target sequence 1：GTTACGCTAACGGTCAAATG(SEQ ID NO:1)

Target sequence 2：AATGCCTCCTGATTTTGCCAAT(SEQ ID NO:2)

Target sequence 3：CACTTGAATCTGTCTGCTACT(SEQ ID NO:3)

Target sequence 4：GTGCTTTGTTGTACAATAACG(SEQ ID NO:4)

Target sequence 5：TGCTGACTGCCATTAAAGCCG(SEQ ID NO:5)

Target sequence 6：CTCTCTCGGGTGCATTTTACCT(SEQ ID NO:6).

The structure of embodiment 2, plant expression vector

It is linked together according to tomato Ubi promoters-target sequence positive-sense strand-intervening sequence-target sequence antisense strand, and Expression vector is formed with marker gene Hpt.Sense primer both ends are respectively provided with III restriction enzyme site of EcoR I and Hind, and antisense draws Thing both ends are respectively provided with Xho I and Sac I restriction enzyme sites, and intervening sequence primer both ends are respectively provided with Hind III and Sac I digestions Site.By the recombinant cloning vector double digestion containing positive-sense strand, and recycle positive-sense strand fragment.Recombinant expression carrier XHJM is done together The plasmid of the double digestion recycling linearisation of sample, is connected with purpose fragment, obtains recombinant expression carrier XHJM-X1.Will recombination expression Carrier XHJM-X1 double digestions, and recycle linearization plasmid.By the recombinant cloning vector double digestion containing antisense strand, and recycle anti- Adopted chain fragment.Recombinant expression carrier XHJM-X1 after double digestion is attached with antisense strand fragment, obtains recombinant expression carrier XHJM-Y1.Use Hind III and Sac I double respectively recombinant expression carrier XHJM-Y1 and the puc-Spacer with intervening sequence The XHJM-Y1 of digestion, recycling intervening sequence and linearisation, and both are connected, it is built into containing tomato Ubi promoters-target The recombinant expression carrier XHJM-01 of sequence positive-sense strand-intervening sequence-target sequence antisense strand.Utilize conventional enzymatic cleavage methods structure It is well-known to those skilled in the art, the carrier schematic diagram (Kan as shown in Figure 1 of recombinant expression carrier XHJM-01 to build carrier： Kanamycin gene；RB：Right margin；prCaMV35S：Ubi promoters；X1 (SEQ ID NO:7)：The nucleotide of target sequence 1 Sequence (SEQ ID NO:1) the reverse complemental nucleotide sequence of+intervening sequence+target sequence 1；tNos：Rouge alkali synthetase base The terminator of cause；Hpt：Hygromycin phosphotransferase gene；LB：Left margin), sequencing identification recombinant expression carrier structure is correct.

Recombinant expression carrier XHJM-02, XHJM-03, XHJM-04, XHJM-05, XHJM-06 are built according to the method described above, Determine that recombinant expression carrier XHJM-02, XHJM-03, XHJM-04, XHJM-05, XHJM-06 are correctly connected with target sequence respectively (the SEQ ID NO of row 2:2), (the SEQ ID NO of target sequence 3:3), (the SEQ ID NO of target sequence 4:4), 5 (SEQ of target sequence ID NO:5), (the SEQ ID NO of target sequence 6:6) hair fastener form, the nucleotide sequence of hair fastener form is respectively X2 (SEQ ID NO:8)、X3(SEQ ID NO:9)、X4(SEQ ID NO:10)、X5(SEQ ID NO:11)、X6(SEQ ID NO:12)。

Embodiment 3, obtain transgene tomato

To oneself constructed correctly recombinant expression carrier XHJM-01, XHJM-02, XHJM-03, XHJM-04, XHJM-05 With XHJM-06 Agrobacterium EHA105 (Invitrgen, Chicago, USA, CAT are transformed into liquid nitrogen method：In 18313-015), According to the Agrobacterium infestation method routinely used, the Agrobacterium described in the tomato seedling and 3rd embodiment of sterile culture is trained altogether Support, recombinant expression carrier XHJM-01, XHJM-02, XHJM-03, XHJM-04, the XHJM-05 that will be built in second embodiment With in XHJM-06 T-DNA (including X1 nucleotide sequences, X2 nucleotide sequences, X3 nucleotide sequences, X4 nucleotide sequences, X5 nucleotide sequences, X6 nucleotide sequences, corn Ubi promoter sequences, Hpt genes and Nos terminator sequences) it is transferred to kind In eggplant genome, obtain and be transferred to the tomato plant of X1 nucleotide sequences, be transferred to the tomato plant of X2 nucleotide sequences and turn Enter the tomato plant of X3 nucleotide sequences, the tomato plant for being transferred to the tomato plant of X4 nucleotide sequences, being transferred to X5 nucleotide sequences Strain and the tomato plant for being transferred to X6 nucleotide sequences；Control is used as using wild-type tomatoes plant at the same time.

It is as follows for agriculture bacillus mediated tomato plant preculture, specific method：Tomato seeds sterile water washing by soaking Twice, tomato seeds 5min is soaked with 75% ethanol, ethanol is discarded, adds sterile water to wash twice, discard sterile water, with 15% Hypochlorite disinfectant 1min.Jog container, increases contact of the seed with solution, sodium hypochlorite is discarded, with rinsed with sterile water 6-7 Excessive moisture is blotted after secondary, seed is moved into the triangular flask equipped with MS culture mediums, 10~20 every bottle, is uniformly put, seed Between reserve appropriate gap, illumination cultivation is clamped for 7 days to 120 degree of cotyledon opening angle with tweezers after 28 DEG C of lucifuge cultures buddings Seedling plumular axis part, makes that two panels cotyledon is overlapping, is laid in culture dish bottom, and cotyledon top is cut, then close to petiole portion Position partial application about at 1cm, cuts square cotyledon piece；Plumular axis is truncated into segment and is placed on MS+50 μ g/ μ l AS culture mediums, preculture 3 days.The preculture cotyledon of 3 days and plumular axis are removed from culture dish, is put into the conical flask for filling Agrobacterium bacterium solution, gently shakes Swing, infect 13min, control time of infection, the time easy browning of long explant, the time, short then infect efficiency was low.Liquid is used after taking-up Body MS is rinsed on postposition aseptic filter paper and blotted, and is transferred to the co-cultivation base plate added with 80 μ g/ μ lAS MS, and lucifuge co-cultures 2 My god.The explant that terminates will be co-cultured and go on screening and culturing medium that (MS+3mg/L 6BA+0.25mg/L IAA+20 μ g/ml tides are mould Plain+15 μ g/ml zeatin), add zeatin and promote explant differentiation.26-28 DEG C, 16h illumination cultivations, break up green callus group Knit.Every 10 days subcultures once, discard callus undergrowth person, seedling are moved into new culture medium.Treat that seedling grows to 2-3cm, (+150 μ g/ml cephalosporins of MS+0.25mg/L IAA+20 μ g/ml kanamycins) is returned again on root media, treats that seedling grows Go out 4-5 bar roots, and there are a large amount of lateral roots to carry out hardening when bearing, be transplanted to after well developed root system in the soil of sterilizing, treat that seedling grows to four During piece leaf, root and blade is taken to be identified.

Embodiment 4, identify insecticidal effect of the transgene tomato to Frankliniella occidentalis

By the tomato plant for being transferred to X1 nucleotide sequences, it is transferred to the tomato plant of X2 nucleotide sequences, is transferred to X1 nucleotide The tomato plant of sequence, the tomato plant for being transferred to X4 nucleotide sequences, the tomato plant for being transferred to X5 nucleotide sequences and it is transferred to X6 The tomato plant of nucleotide sequence carries out insect resistant effect detection to Frankliniella occidentalis.

Select and be identified as the positive XHJM-01 tomato conversions event (X1) 5 singly copied, the XHJM- that the positive singly copies 02 tomato conversion event (X2) 5, the XHJM-03 tomato conversions event (X3) 5 that the positive singly copies, is identified as the positive and singly copies The XHJM-04 tomato conversions event (X4) 5 of shellfish, the XHJM-05 tomato conversions event (X5) 5 that the positive singly copies are positive single The XHJM-06 tomato conversions event (X6) 5 of copy, the tomato conversion event (NGM1) 3 of feminine gender is accredited as through taqman, Each transformation event chooses 3 strains, and each strain chooses 3 seedlings；Control (CK1) is used as using wild-type tomatoes plant at the same time； Plantation is extremely emerged in the greenhouse；The blade of area about 1X2cm is taken on every seedling, tiling is put into the culture dish for being covered with moisturizing filter paper In so that plant part overlapped will not be easy to the later observations death rate as far as possible；20 brooding times are put into per ware not surpass Cross 24 it is small when it is first incubate Frankliniella occidentalis, and cover tightly culture dish lid, by culture dish be put under be lined with the raw of moisturizing gauze and survey box In, and raw box of surveying is put into 24 ± 2 DEG C, D/L 24/0 of temperature, humidity is in the life measuring tank of 70-80%；For prevention damage children Worm, keeps culture dish motionless on the 1st day as far as possible on the day of connecing worm and after connecing worm；Since being connect worm the 2nd day, counted daily outside culture dish The Frankliniella occidentalis quantity of survival, for each transformation event using 3 strains as average level, each carrier is flat using 5 transformation events Equal survival number is horizontal；The Frankliniella occidentalis survived in culture dish was transferred in the culture dish equipped with fresh blade in every 3 days, experiment knot Fruit is as shown in table 1.

The experimental result of table 1, tomato conversion event filigree feeding Frankliniella occidentalis

Table 1 test result indicates that：X1 nucleotide sequences, X2 nucleotide sequences, X3 nucleotide sequences, X4 nucleotides sequences Row, the tomato plant of X5 nucleotide sequences, X6 nucleotide sequences are respectively provided with Frankliniella occidentalis preferable inhibition, dead larvae Rate is up to 90% or so.

Sequence table

<110>Hangzhou Geng Lan bio tech ltd

<120>A kind of insecticides and preparation method thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 2

<211> 20

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223>Target sequence 1

<400> 2

gttacgctaa cggtcaaatg 20

<210> 2

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223>Target sequence 2

<400> 2

aatgcctcct gattttgcca at 22

<210> 3

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223>Target sequence 3

<400> 3

cacttgaatc tgtctgctac t 21

<210> 4

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223>Target sequence 4

<400> 4

gtgctttgtt gtacaataac g 21

<210> 5

<211> 21

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223>Target sequence 5

<400> 5

tgctgactgc cattaaagcc g 21

<210> 6

<211> 22

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223>Target sequence 6

<400> 6

ctctctcggg tgcattttac ct 22

<210> 7

<211> 51

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223> X1

<400> 7

gttacgctaa cggtcaaatg tttaatatta ccatttgacc gttagcgtaa c 51

<210> 8

<211> 55

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223> X2

<400> 8

aatgcctcct gattttgcca attttaatat tacattggca aaatcaggag gcatt 55

<210> 9

<211> 53

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223> X3

<400> 9

cacttgaatc tgtctgctac ttttaatatt acagtagcag acagattcaa gtg 53

<210> 10

<211> 53

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223> X4

<400> 10

gtgctttgtt gtacaataac gtttaatatt accgttattg tacaacaaag cac 53

<210> 11

<211> 53

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223> X5

<400> 11

tgctgactgc cattaaagcc gtttaatatt accggcttta atggcagtca gca 53

<210> 12

<211> 55

<212> DNA

<213>Artificial sequence (Artificial Sequence)

<220>

<221> gene

<223> X6

<400> 12

ctctctcggg tgcattttac cttttaatat tacaggtaaa atgcacccga gagag 55

Claims (5)

1. a kind of insecticides, it is characterised in that including at least one separated polynucleotide sequence, the polynucleotides Sequence includes：

(a)SEQ ID NO:2nd, the polynucleotide sequence shown in 4,5；Or

(b) polynucleotide sequence of the polynucleotide sequence hybridization limited under strict conditions with (a)；Or

(c) polynucleotide sequence limited with (a) has the polynucleotide sequence of more than 80% homogeneity；Or

(d) polynucleotide sequence of at least 19 continuous nucleotides of the polynucleotide sequence that (a) is limited, wherein Thysanoptera insect Pest intake includes the double-stranded RNA with least one chain of polynucleotide sequence complementation, suppresses the Thysanoptera insect evil The growth of worm；Or

(e) complementary series for the polynucleotide sequence that above-mentioned (a), (b), (c) or (d) is limited.

2. insecticides according to claim 1, it is characterised in that the polynucleotide sequence further includes right will The complementary series of 1 polynucleotide sequence is sought, the polynucleotide sequence further includes intervening sequence, it is preferable that the multinuclear Nucleotide sequence is SEQ ID NO:8th, 10 or 11, polynucleotide sequence composition table under the regulating and controlling sequence regulation and control effectively connected Up to box, the polynucleotide sequence is interference RNA sequence.

3. insecticides according to claim 1 or 2, it is characterised in that the interference RNA sequence is in quilt Play the role of lowering the expression of at least one of Thysanoptera insect pest target sequence after the intake of Thysanoptera insect pest, its Described in interference RNA sequence include at least one silencing elements, wherein the silencing elements be comprising annealing complementary strand A double-stranded region, wherein chain include it is complementary at least in part with a target fragments in the target sequence A nucleotide sequence or be made from it, the target sequence includes polynucleotide sequence described in claim 1.

4. insecticides according to claim 3, it is characterised in that the insecticides include at least one Any one of the claim 1-3 polynucleotide sequences and at least one suitable carrier, excipient or diluent, or include one Kind expression or the host cell that the interference RNA sequence can be expressed, it is preferable that the host cell is thin for microorganism Born of the same parents.

5. insecticides according to claim 4, it is characterised in that the composition is pesticide spray.