CN108014333A - Animal targets immunopotentiator and its application in live vaccine with mucous membrane - Google Patents
Animal targets immunopotentiator and its application in live vaccine with mucous membrane Download PDFInfo
- Publication number
- CN108014333A CN108014333A CN201711324750.4A CN201711324750A CN108014333A CN 108014333 A CN108014333 A CN 108014333A CN 201711324750 A CN201711324750 A CN 201711324750A CN 108014333 A CN108014333 A CN 108014333A
- Authority
- CN
- China
- Prior art keywords
- vaccine
- immunopotentiator
- animal
- mucous membrane
- immune
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5252—Virus inactivated (killed)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55583—Polysaccharides
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Mycology (AREA)
- General Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention relates to biomedicine field, and in particular to animal targets immunopotentiator and its application in live vaccine with mucous membrane.For problem present in currently available technology, and the expectation for preferable live vaccine, the invention discloses a kind of animal with mucous membrane target immunopotentiator, containing 0.5 μ g~500 μ g/mL CpG, α GC, the Poly of 0.1 μ g~3mg/mL of 0.1 μ g~1mg/mL（I:C）, the PLGA of 1 μ g~5mg/mL, the PEI of 0.1 μ g~5mg/mL, 1 μ g~10mg/mL chitosans.The animal is also disclosed at the same time applies possible and application process in live vaccine with mucous membrane targeting immunopotentiator.So as to produce good mucosal immunity, while shorten immune window phase, effectively reduce antigen dosage and produce sterile immumity.
Description
Technical field
The present invention relates to biomedicine field, and in particular to animal targets immunopotentiator and its in live vaccine with mucous membrane
In application.
Background technology
All kinds of viral infectious restrict China or even world's aquaculture development, cause heavy economic losses, or even jeopardize
The public health security of the mankind.At present clinic largely use based on mineral oil adjuvant prepare inactivated vaccine, to prevention and control these
Epidemic disease has played important function.But these vaccines still suffer from the defects of certain, and vaccine quality is up for further lifting.These are lacked
Falling into includes the following aspects：
First, the inactivated vaccine based on mineral oil is nearly free from mucoantibody after body is immunized.But virus infection is main
Approach is mucosal route.Therefore, mucous membrane is the first line of defence of host defense system.Mucosal immune response is improved, can be by disease
Poison is removed or stopped when pathogen will enter host, so as to reduce the risk of infection epidemic disease.
Second, side reaction is larger after body is immunized in the inactivated vaccine based on mineral oil.Specifically, for quickly delivering for sale
Broiler chicken, mineral oil vaccine are difficult to absorb, and can influence meat and subsequently eat.And for laying hen, egg drop reduction can be produced to laying hen
Influence.It can cause to have a fever for pig, ox etc., after mineral oil vaccine immunity, enlargement, the serious side reactions such as decline of searching for food.
3rd, the generation phase that rear antibody is immunized in the inactivated vaccine based on mineral oil is longer.After mineral oil vaccine immunity,
Generally reach within 3rd week the qualified antibody effectively protected after immune, cause there is longer time to be in the poison that can not make a variation to field
Strain provides the state effectively protected.This just brings very big epidemic disease risk to clinical production.
4th, the inactivated vaccine based on mineral oil is, it is necessary to higher vaccine antigen content.Live vaccine is using raising antigen
Measure improve vaccine it is immune after effect, but live vaccine is limited to cheap price, causes vaccine antigen purity difference, miscellaneous egg
It is white more, also cause side reaction larger.
In conclusion a kind of preferably live vaccine should have following characteristics：（1）High-level mucosal immunity can be produced；
（2）It is easy to absorb, almost without side reaction；（3）The antibody generation phase is short, and antibody titer is high, duration length；（4）Ensureing vaccine effect
On the premise of power, antigen dosage is effectively reduced, reduces side reaction, reduces production cost；（5）Sterile immumity can be produced.So as to
In order to control epidemic disease, finally put out and eliminate epidemic disease, there is provided strong technical support.
The content of the invention
For problem present in currently available technology, and the expectation for preferable live vaccine, invention of the invention
The first purpose be to provide it is a kind of can produce good mucosal immunity, while shorten immune window phase, effectively reduce antigen dosage
Immunopotentiator is targeted with the animal mucous membrane for producing sterile immumity.
Another goal of the invention of the present invention is to provide said animal mucous membrane and targets immunopotentiator in live vaccine
Using possible and application process.
Animal disclosed by the invention contained with mucous membrane targeting immunopotentiator CpG, the 0.1 μ g of the μ g/mL of 0.5 μ g~500~
The Poly of the α-GC of 1mg/mL, 0.1 μ g~3mg/mL（I:C）, the PLGA of 1 μ g~5mg/mL, the PEI of 0.1 μ g~5mg/mL, 1
μ g~10mg/mL chitosans.
CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan mass concentration ratio be 1:(3~8):(2~8):
(2~8):(3~7):(2~7).
It is further preferable that CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan mass concentration ratio be 1:(4
~6):(3~5):(4~6):(3~5):(3~5).
Animal disclosed by the invention with mucous membrane targeting immunopotentiator preparation method be：Divide in phosphate buffer solution
Jia Ru not CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan, adjust pH to 7.0-7.2, be prepared into mixed solution, mistake
Filter, is degerming, to obtain the final product.
The present invention further discloses application of the animal with mucous membrane targeting immunopotentiator in live vaccine.
Include animal in the live vaccine and target immunopotentiator and killed vaccine antigen with mucous membrane.
The live vaccine includes but are not limited to H9 subtype avian influenza vaccines, newcastle disease vaccine, infectious bursa of Fabricius
Vaccine, infectious bronchitis vaccine, ewcastle disease-H9 bird flu bigeminy vaccines, ewcastle disease-infectious bursa of Fabricius bigeminy vaccine,
Ewcastle disease-infectiousness bronchitis bigeminy vaccine, ewcastle disease-infective bronchitis-H9 subtype avian influenza triple vaccines, pig are thin
Small virus disease vaccine, pig japanese b encephalitis disease vaccine, pseudorabies disease vaccine, pig circular ring virus disease vaccine.
Further, the invention discloses be with the content of mucous membrane targeting immunopotentiator containing animal in live vaccine
CpG, α-GC, the Poly of 0.1 μ g~3mg/mL of 0.1 μ g~1mg/mL of the μ g/mL of 0.5 μ g~500（I:C）, 1 μ g~5mg/mL
PLGA, PEI, the 1 μ g~10mg/mL chitosans of 0.1 μ g~5mg/mL.
In addition, it is with application process of the mucous membrane targeting immunopotentiator in live vaccine the invention also discloses animal：
It is first according to CpG, α-GC, the Poly of 0.1 μ g~3mg/mL of 0.1 μ g~1mg/mL of the μ g/mL of 0.5 μ g~500（I:C）、1μg
The PLGA of~5mg/mL, the PEI of 0.1 μ g~5mg/mL, the chitosan of 1 μ g~10mg/mL configure to obtain animal to be targeted with mucous membrane
Immunopotentiator, then the vaccine antigen of required vaccine is added to the animal prepared mucous membrane target in immunopotentiator,
Mix, to obtain the final product.
The addition of vaccine antigen（Content i.e. in product）With reference to existing the every of vaccine is prepared using mineral oil as adjuvant
Plumage part antigenic content.The vaccine antigen can be the lyophilized inactivation antigen preserved or inactivation antigen solution.
Animal disclosed by the invention targets synergistic effect of the immunopotentiator by each component with mucous membrane, can produce good
Mucosal immunity, significantly shorten immune window phase, effectively improve antibody titer, extend the antibody duration.The present invention discloses at the same time
Animal with mucous membrane targeting immunopotentiator with other vaccine antigens formed live vaccine during can be directed to homotype poison
Strain attacks poison and provides sterile immumity protection, antigen dosage is effectively reduced, the purpose of so as to fulfill cost is reduced.Also, the present invention
Disclosed animal with mucous membrane target immunopotentiator during live vaccine is prepared it is easy to operate, flexible, raising family can be
Reinforcing agent and existing vaccine antigen are used in mixed way in actual mechanical process, had broad application prospects.
Brief description of the drawings
Fig. 1 shows the serum antibody titer and Mucosal Antibody Titers that H9 is directed in embodiment 2.
Fig. 2 shows the serum antibody titer and Mucosal Antibody Titers for H9 saved in embodiment 4 after antigen.
Fig. 3 shows the serum antibody titer and Mucosal Antibody Titers that ND is directed in embodiment 5.
Fig. 4 shows the serum antibody titer and Mucosal Antibody Titers that IBD is directed in embodiment 6.
Fig. 5 shows the serum antibody titer and Mucosal Antibody Titers that IB is directed in embodiment 7.
Fig. 6 shows the serum antibody titer and Mucosal Antibody Titers that ND is directed in embodiment 8.
Fig. 7 shows the serum antibody titer and Mucosal Antibody Titers that IB is directed in embodiment 8.
Fig. 8 shows the serum antibody titer and Mucosal Antibody Titers that H9 is directed in embodiment 8.
Fig. 9 shows the serum antibody titer and Mucosal Antibody Titers that ND is directed in embodiment 9.
Figure 10 shows the serum antibody titer and Mucosal Antibody Titers that IB is directed in embodiment 9.
Figure 11 shows the serum antibody titer and Mucosal Antibody Titers that IBD is directed in embodiment 9.
Figure 12 shows the serum antibody HI potency that PPV is directed in embodiment 10.
Figure 13 shows the serum antibody ELISA potency that PPV is directed in embodiment 10.
Figure 14 shows the serum antibody ELISA potency that JEV LAT are directed in embodiment 11.
Figure 15 shows the serum neutralizing antibody that PRV is directed in embodiment 12.
Figure 16 shows the serum antibody ELISA potency that PCV2 is directed in embodiment 13.
Embodiment
In order to be better understood from the present invention, below we in conjunction with specific embodiments to the present invention further explained
State.
The preparation of 1 compound adjuvant of embodiment and animal vaccine
（1）Test material
CpG is screened by this room and obtained, and sequence is TCGTCGTTATAGTCGTTTTAGTCGTT (SEQ NO:1) Nanjing gold, is transferred to think
Auspicious synthesis, makees thio-modification during synthesis by its skeleton.α-galactosylceramide (α-galactosylceramide, referred to as
α-GC) and Poly（I:C）Purchased from Invivogen.PLGA, PEI and chitosan are purchased from SIGMA companies.Prepare phosphate-buffered
The inorganic salts of liquid are purchased from Sinopharm Chemical Reagent Co., Ltd..
（2）Test method
Prepare compound adjuvant：
The preparation of compound adjuvant solution：Match somebody with somebody producing phosphate first（PBS）Buffer solution, the Na containing 1.44g/L during it is formulated2HPO4,
1.44g/L KH2PO4, the KCl of the NaCl of 8g/L, 0.2g/L, dissolve above-mentioned salt, adjustment pH is 7.0, sterilizing with distilled water
It is spare afterwards.Added in the PBS buffer and add CpG, α-GC, Poly according to formula ratio（I:C）, PLGA, PEI and shell gather
Sugar, adjustment pH are 7.0-7.2, are configured to aqueous solution.The aqueous solution is filtered, is degerming, animal is obtained and targets immune increase with mucous membrane
Strong agent.The reinforcing agent can long term sealed save.
Wherein formula ratio refers to：CpG, α-GC, the 0.1 μ g of 0.1 μ g~1mg/mL of the aqueous solution containing the μ g/mL of 0.5 μ g~500
The Poly of~3mg/mL（I:C）, the PLGA of 1 μ g~5mg/mL, the PEI of 0.1 μ g~5mg/mL, 1 μ g~10mg/mL chitosans.
In order to express easily, animal is referred to as compound adjuvant by us with mucous membrane targeting immunopotentiator in the present invention,
Or represented with MA." animal targets immunopotentiator with mucous membrane ", " compound adjuvant ", " MA " refer both to animal mucous membrane in the present invention
Target immunopotentiator.
Wherein CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan mass concentration ratio be 1:(3~8):(2~8):
(2~8):(3~7):(2~7).
Or further, CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan mass concentration ratio be 1:(4~
6):(3~5):(4~6):(3~5):(3~5).
Live vaccine and its preparation method：
In live vaccine containing 0.5 μ g~500 CpG of μ g/mL, the α-GC of 0.1 μ g~1mg/mL, 0.1 μ g~3mg/mL
Poly（I:C）, the PLGA of 1 μ g~5mg/mL, the PEI of 0.1 μ g~5mg/mL, the chitosan of 1 μ g~10mg/mL；And inactivation
Vaccine antigen.
In order to mutually be distinguished with existing vaccine, the animal vaccine is referred to as the beast containing compound adjuvant in embodiment 2-13
With vaccine, represented with "-MA " and target immunopotentiator containing animal mucous membrane.
CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan mass concentration ratio be 1:(3~8):(2~8):
(2~8):(3~7):(2~7).
CpG, α-GC, Poly（I:C）, PLGA, PEI and chitosan mass concentration ratio be 1:(4~6):(3~5):
(4~6):(3~5):(3~5).
Wherein killed vaccine antigen as needed be respectively H9 subtype avian influenza vaccines, newcastle disease vaccine, infectiousness Fa Shi
Capsule vaccine, infectious bronchitis vaccine, ewcastle disease-H9 bird flu bigeminy vaccines, ewcastle disease-infectious bursa of Fabricius bigeminy epidemic disease
Seedling, ewcastle disease-infectiousness bronchitis bigeminy vaccine, ewcastle disease-infective bronchitis-H9 subtype avian influenza triple vaccines,
Pig parvoviral disease vaccine, pig japanese b encephalitis disease vaccine, pseudorabies disease vaccine, Porcine circovirus desease vaccine antigen.
Preparing the method for live vaccine can be summarized as：Required vaccine is added in the compound adjuvant solution of above-mentioned preparation
Antigen, mixes, up to required vaccine.The vaccine antigen content refers to existing every plumage part that vaccine is prepared based on mineral oil
Antigenic content.The vaccine antigen can be to freeze the inactivation antigen preserved, or inactivation antigen solution.
, can be by the compound adjuvant and various existing vaccines according to the raising family of present each vaccine in actual mechanical process
Antigen is used in mixed way, easy to operate, flexibly.
In order to complete the contrast test in embodiment 2-15, three kinds of formulas are respectively configured in various live vaccines by us：Beast
With vaccine L, M and H.In each live vaccine containing 0.5 μ g~500 CpG of μ g/mL, the α-GC of 0.1 μ g~1mg/mL, 0.1
The Poly of μ g~3mg/mL（I:C）, the PLGA of 1 μ g~5mg/mL, the PEI of 0.1 μ g~5mg/mL, 1 μ g~10mg/mL shells gather
Sugar.
We illustrate detailed process for preparation by taking H9 subtype avian influenza vaccines as an example below：
Compound adjuvant component CpG, α-GC, Poly in live vaccine L（I:C）, PLGA, PEI and chitosan concentration be respectively：
0.5 μ g/mL, 0.1 μ g/mL, 0.1 μ g/Ml, 1 μ g/mL, 0.1 μ g/mL and 1 μ g/mL, H9 vaccines prepared by compound adjuvant, letter
Referred to as H9-MAL.
CpG, α-GC, Poly in live vaccine M（I:C）, PLGA, PEI and chitosan concentration be respectively：20μg /mL、
50 μ g/mL, 500 μ g/ mL, 1 μ g/mL, 1mg/mL and 1mg/mL, referred to as H9 vaccines prepared by compound adjuvant, H9-MAM.
CpG, α-GC, Poly in live vaccine H（I:C）, PLGA, PEI and chitosan concentration be respectively：500μg /mL、
1mg/mL, 3mg/ mL, 5mg/mL, 5mg/mL and 10mg/mL, referred to as H9 vaccines prepared by compound adjuvant, H9-MAH.
In the present embodiment, the H9 vaccine antigens of vaccine are used to prepare before inactivation, its potency is not less than 107EID50/mL。
Unit of weight in the present embodiment according to dose volume, can be nanogram, microgram, milligram or gram.
In the present embodiment, each component of compound adjuvant can be flexibly combined in the ratio range provided, herein not
Enumerate.In addition to above-mentioned immunopotentiator component is added, it is those skilled in the art institute that above method, which prepares vaccine,
The conventional method known.
Influence of 2 compound adjuvant of embodiment to H9 subtype avian influenza vaccine immunity effect
（1）Test material
Using existing H9 subtype avian influenzas vaccine, the H9 hypotypes containing compound adjuvant are prepared according to the method disclosed in embodiment 1
Avian influenza vaccine L, M and H.H9 subtype avian influenzas vaccine and H9 subtype avian influenza standard detection antigens are purchased from Nanjing day nation biology
Science and Technology Ltd..No-special pathogen（Specific Pathogen Free, SPF）Chicken system ties up logical experiment from Beijing Cimmeria
Zoo technical Co., Ltd buys chicken embryo, through voluntarily hatching after being raised in isolator, raises stand-by to 5-15 ages in days.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, H9-MAL, H9-MAM and H9-MAH vaccine group and commodity H9 subtype avian influenzas containing compound adjuvant are set up
Vaccine group（It is abbreviated as H9）And not immune blank control group（Referred to as C）, totally 5 groups, each group has 40 chickens.
（3）Influence of the compound adjuvant to H9 subtype avian influenza vaccine immunity effect
Blood sampling and antibody titer detection：Through venous blood collection, serum is separated, with H9 subtype avian influenzas within immune latter 2nd, 3 and 4 week
Standard detection antigen.At the same time 1st, 2 and 3 week after immune, every group is slaughtered 3 chickens, gathers lung lavage.Serum and lung are rushed
Washing lotion, detects serum antibody titer using microdose cytopathogenic effect assay (HI), and HI detection methods refer to version in 2010《Chinese beast
Pharmacopeia》.According to the geometric average antibody titer of every group of chicken（GMT）And variance（SD）, compare compound adjuvant to existing H9 hypotypes fowl
The immunoenhancement result of influenza vaccines.
As a result
Serum antibody result.2 weeks after immune, the antibody titer of the vaccine group containing compound adjuvant is higher than conventional vaccine potency, its
The qualified antibody titer of latter 4 weeks is immunized higher than the conventional vaccine of regulatory requirements by middle H9-MAM and H9-MAH（7log2）.And conventional epidemic disease
Seedling reaches qualified for 3 weeks after immune, i.e., immune window phase can be shortened 1 week by the vaccine containing compound adjuvant.3 weeks after immune, containing exempting from
The antibody titer of the vaccine group of epidemic disease compound adjuvant is above conventional vaccine group antibody titer.Refer to Fig. 1-A.
Lung lavage mucoantibody result.The compound adjuvant formula of various dose can improve H9 subtype avian influenza vaccines and exist
The lung lavage Mucosal Antibody Titers of chicken body, have obvious mucosal immunity humidification.Refer to Fig. 1-B.
Comprehensive serum antibody and mucoantibody the result shows that, compared with vaccine of the routine based on mineral oil adjuvant, this item
The compound adjuvant of mesh invention can significantly improve mucosal immunity and sero-immunity response of the H9 vaccines in chicken body.
（3）Compound adjuvant attacks H9 subtype avian influenzas variation strain the influence of suppression toxin expelling after poison
Attack poison and toxin expelling detection is immune 4th week latter, take out 10 at random from immune group, blank control group 10.Attack poison strain
For NJ/02 plants, purchased from Nanjing Tianbang Bio-industry Co., Ltd..Toxic agent amount is attacked as 107.0Chicken embryo median infective dose（EID50）/
0.1mL, poison is attacked through eye droppings collunarium approach.Attack after poison the 3rd day, 5 days and 7 days, take cotton swab from larynx tracheae and cloaca respectively.
This cotton swab is dipped in containing 5% calf serum and the PBS of 5000U kanamycins and 5000U gentamicins（pH7.0）In.Each cotton
Wipe after extruding, 12000 revs/min, centrifuge 10 minutes.Centrifugation gained supernatant is pressed into 0.1mL/ embryos, is inoculated with 10 age in days SPF chickens
Embryo, each 3 pieces of chicken embryos of cotton swab sample inoculation, for isolated viral.After egg inoculation, put in 37 DEG C of incubators, shine embryo 2 daily
It is secondary, discard 24 it is small when interior dead chicken embryo, observation to be inoculated with after 120 it is small when, dead chicken embryo is taken out in time, detect blood clotting
（Heamagglutinin, HA）Potency.HA potency is measured with 1 or more in 3 embryos and is judged to virus purification higher than 2log2 person
It is positive.
And conclusion as a result
In the larynx tracheae and cloacal swabs sample detection of the 3rd day, 5 days and 7 days after attacking poison, the vaccine group containing compound adjuvant
It is not separated to virus.And conventional vaccine immune group the 3rd day, 5 days and 7 days after poison is attacked are separated from the larynx tracheae of partial immunity chicken
To virus, cloaca is then separated to virus in the 3rd day and 5 days after poison is attacked.Non-immune all control chickens are the 3rd day after poison is attacked, 5
It and can be separated to virus from larynx tracheae and cloaca within 7 days.Refer to table 1.
Result of the test shows that the compound adjuvant in the present invention can couple virus attack identical with vaccine antigen complete inhibition row
Poison, you can provide sterile immumity protection, this provides strong technical support for the elimination of certain class infectious disease in the future.
Virus isolated rate of the different immune groups of table 1 after poison is attacked
3 compound adjuvant of embodiment to H9 subtype avian influenzas vaccine the security of chicken body influence
（1）Test material
Using existing H9 subtype avian influenzas vaccine, the H9 hypotypes containing compound adjuvant are prepared according to the method disclosed in embodiment 1
Avian influenza vaccine H9-MAM.H9 subtype avian influenzas vaccine and H9 subtype avian influenza standard detection antigens are purchased from Nanjing day nation biology
Science and Technology Ltd..No-special pathogen（Specific Pathogen Free, SPF）Chicken system ties up logical experiment from Beijing Cimmeria
Zoo technical Co., Ltd buys chicken embryo, through voluntarily hatching after being raised in isolator, raises stand-by to 5-15 ages in days.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations.
It is grouped as follows：Set up the H9-MAM single single doses containing compound adjuvant（0.3mL）Immune group (referred to as, H9-MAM-
S), H9-MAM singles doubling dosage (0.6mL) immune group (referred to as, H9-MAM-D), H9-MAM single dose (0.3mL+ twice
0.3mL) immune group (referred to as, H9-MAM-R).Wherein H9-MAM-S and H9-MAM-D, was only immunized once, subsequently not at the 15th day
It is immunized again.And 0.3mL separately is immunized once again in 29 ages in days after 0.3ml is immunized in 15 ages in days in H9-MAM-R.
If 9 vaccine of conventional H is set as control, immunization ways such as compound adjuvant immune group, totally three groups.H9 single single doses
Amount（0.3mL）Immune group (referred to as, H9-S), H9 singles doubling dosage (0.6mL) immune group (referred to as, H9-D), H9 single dose twice
Measure (0.3mL+0.3mL) immune group (referred to as, H9-R).
The another blank control group that cannot do not set immunely（Control）.
（3）Compound adjuvant to H9 subtype avian influenzas vaccine chicken body security influence
Detect every group of each 15 chicken.14 days and 28 days after last time is immune, each group is divided on the two timing nodes
Do not take 5 chickens to slaughter, absorbed for detecting vaccine.
And conclusion as a result
14 days each groups slaughter 5 chickens after immune, observe vaccine absorbing state.3 test groups of compound adjuvant, absorb completely,
It is similar with blank control group.Only in single doubling dosage immune group, H9-MAM-D, has 1 chicken to have yellow class fat granule.It is and conventional
3 test groups of H9 vaccine immunities, every chicken have yellow class fat granule.The tissue of blank control group is normal.
28 days each groups slaughter 5 chickens after immune, observe vaccine absorbing state.3 test groups of compound adjuvant, absorb
Completely, it is similar with blank control group.And 3 test groups of 9 vaccine immunity of conventional H, part chicken have yellow class fat granule.Its
In, H9 single single doses（0.3mL）Single dose (0.3mL+0.3mL) immune group (H9-R) respectively has twice by immune group (H9-S) and H9
1 chicken has yellow class fat granule.And H9 singles doubling dosage (0.6mL) immune group (H9-D) has 2 chickens to have class fat granule.
Result of the test shows, compared with 9 mineral oil vaccine of conventional H, the compound adjuvant in the present invention does not influence H9 hypotype fowl
Influenza vaccines chicken body absorption, to chicken safety.
4 compound adjuvant of embodiment reduces H9 subtype avian influenza vaccine antigen dosages
（1）Test material
Using existing H9 subtype avian influenzas vaccine antigen, MAM containing compound adjuvant is prepared according to the method disclosed in embodiment 1.
It is prepared by vaccine：It is prepared into the compound adjuvant H9 vaccines of different antigenic contents.First group is normal antigen content, with business
H9 subtype avian influenza vaccine contg of the product based on mineral oil is identical, abbreviation H9-MAM；Second group of vaccine is half antigenic content,
The 1/2 of the antigenic content for the H9 subtype avian influenza vaccines based on mineral oil that are Normal Goods, abbreviation H9-HAM-1/2；3rd group
Vaccine is 1/4 antigenic content, is the 1/4 of the antigenic content of H9 subtype avian influenza vaccine of the Normal Goods based on mineral oil, letter
Claim H9-HAM-1/4.
Commercialization H9 subtype avian influenza vaccines（Normal antigen content）It is purchased from H9 subtype avian influenza standard detection antigens
Nanjing Tianbang Bio-industry Co., Ltd..No-special pathogen（Specific Pathogen Free, SPF）Chicken is from Beijing plum
Li Yaweitong experimental animals Technology Co., Ltd. buys chicken embryo, through voluntarily hatching after being raised in isolator, raises to 5-15 days
Age is stand-by.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, H9-MAM, H9-MAM-1/2 and H9-MAM-1/4 vaccine group containing compound adjuvant and commodity H9 Asias are set up
Type avian influenza vaccine group（It is abbreviated as H9）, totally 4 groups, each group has 20S chicken.
It is used as antibody test through venous blood collection, separation serum within 2nd, 3,4 week after blood sampling and antibody titer detection are immune.Together
When 4th week after immune, from each immune group, 3 chickens collection lung lavages are taken out, as mucoantibody detection.Detect antigen
With H9 avian influenza antigens, serum antibody titer is detected using microdose cytopathogenic effect assay (HI).
（3）And conclusion as a result
Serum antibody titer is 2,3 and 4 weeks after immune, the vaccine group containing compound adjuvant, 1/4 and 1/2 antigenic content group, its blood
Clear HI antibody titers are slightly above the potency of commercially available vaccine.Compare HI antibody effect between the compound adjuvant group containing not synantigen row amount
Valency, shows obvious dosage effect, i.e. antigenic content is high, and antibody titer is high, but 1/2 antigenic content group and normal antigen amount group
Between difference unobvious.Refer to Fig. 2-A.
Mucosal Antibody Titers are 4 weeks after immune, the vaccine group containing compound adjuvant, 1/4 and 1/2 antigenic content group, it is viscous
Film HI antibody titers are significantly higher than the potency of commercially available vaccine.Compare HI antibody between the compound adjuvant group containing not synantigen row amount
Potency, difference unobvious.Refer to Fig. 2-B.
Result of the test shows, in the case where reducing antigen dosage, compound adjuvant can improve H9 subtype avian influenza vaccines and resist
Body potency, has obvious immunological enhancement, this plays an important roll for the compatibility of various seedlings.
Influence of 5 compound adjuvant of embodiment to newcastle disease vaccine immune efficacy
（1）Test material
Using existing ewcastle disease（ND）Vaccine, 1 first method of reference implementation example prepare ND vaccines L, M containing compound adjuvant
And H.ND vaccines and ND standard detection antigens are purchased from Nanjing Tianbang Bio-industry Co., Ltd..No-special pathogen
（Specific Pathogen Free, SPF）Chicken system buys chicken embryo from Beijing Cimmeria Wei Tong experimental animals Technology Co., Ltd.,
Through voluntarily hatching after being raised in isolator, raise stand-by to 5-15 ages in days.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, ND-MAL, ND-MAM and ND-MAH vaccine group and commodity ND vaccine groups containing compound adjuvant are set up（Abbreviation
For ND）, totally 4 groups, each group has 30 chickens.
（3）Influence of the compound adjuvant to ND vaccine immunity effect
Blood sampling and antibody titer detection：Through venous blood collection, separation serum, is resisted with ND standard detections within 2nd, 3 and 4 week after immune
It is former.At the same time 4th week after immune, every group is slaughtered 3 chickens, gathers lung lavage.By serum and lung lavage, using micro
Hemagglutination-inhibition test (HI) detects serum antibody titer, and HI detection methods refer to version in 2010《Chinese veterinary pharmacopoeia》.According to every group
The antibody titer of chicken, compares immunoenhancement result of the compound adjuvant to existing ND vaccines.
As a result
Serum antibody result.2 weeks after immune, the antibody titer of the vaccine group containing compound adjuvant is higher than conventional vaccine potency, its
The qualified antibody titer of latter 3 weeks is immunized higher than the conventional vaccine of regulatory requirements by middle ND-MAM and ND-MAH（7log2）.And conventional epidemic disease
Seedling reaches qualified for 3 weeks after immune, i.e., immune window phase can be shortened 1 week by the vaccine containing compound adjuvant.3rd week and the after immune
4 weeks, the antibody titer of the vaccine group containing immune compound adjuvant was above conventional vaccine group antibody titer.Refer to Fig. 3-A.
Lung lavage mucoantibody result.The compound adjuvant formula of various dose can improve ND vaccines and be rushed in the lung of chicken body
Washing lotion Mucosal Antibody Titers, have obvious mucosal immunity humidification.Refer to Fig. 3-B.
Comprehensive serum antibody and mucoantibody the result shows that, compared with vaccine of the routine based on mineral oil adjuvant, this item
The compound adjuvant of mesh invention can significantly improve mucosal immunity and sero-immunity response of the ND vaccines in chicken body.
Influence of 6 compound adjuvant of embodiment to infectious bursa of Fabricius vaccine immunity effect
（1）Test material
Using existing infectious bursa of Fabricius（IBD）Vaccine, 1 first method of reference implementation example prepare the IBD containing compound adjuvant
Vaccine L, M and H.IBD commercially available vaccines are purchased from Nanjing Tianbang Bio-industry Co., Ltd., IBD standard detection strains, and BC6-85 is equal
Purchased from China Veterinary Drugs Supervisory Inst., DF-1 cells are purchased from American Type Culture research institute（ATCC）.No-special pathogen
（Specific Pathogen Free, SPF）Chicken system buys chicken embryo from Beijing Cimmeria Wei Tong experimental animals Technology Co., Ltd.,
Through voluntarily hatching after being raised in isolator, raise stand-by to 5-15 ages in days.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, IBD-MAL, IBD-MAM and IBD-MAH vaccine group and commodity IBD vaccine groups containing compound adjuvant are set up
（It is abbreviated as IBD）, totally 4 groups, each group has 25 chickens.
（3）Influence of the compound adjuvant to IBD vaccine immunity effect
Blood sampling and antibody titer detection：Through venous blood collection, separation serum, is resisted with IBD standard detections within 2nd, 3 and 4 week after immune
It is former.At the same time 4th week after immune, every group is slaughtered 3 chickens, gathers lung lavage.By serum and lung lavage, using DF-1
Cell serum virus neutralization tests detects serum antibody titer, and serum neutralizing antibody detection method refers to version in 2010《Chinese beast
Pharmacopeia》.
Serum neutralization test is summarized as follows：By BC6-85 viral dilutions to 200TCID50(50tissue infection dose)/
0.1mL, presses 2 times of multiple proportions gradient dilution blood by this dilution containing virus, the serum virus of 0.1mL is taken in each dilution gradient
Mixed liquor is placed in 37 DEG C of incubation effect 1h.This Incubating Solution is added to and is covered with advance in 96 orifice plates of DF-1 cells, cell plates are turned
Move to 37 DEG C of CO2Incubator, observes 120h.Record result.
The antibody titer according to every group of chicken is taken, compares immunoenhancement result of the compound adjuvant to existing IBD vaccines.Above blood
Clear neutralization test is the general experimental working technique of this research field.
As a result
Serum antibody result.2 weeks after immune, the antibody titer of the vaccine group containing compound adjuvant is higher than conventional vaccine potency, its
The qualified antibody titer of latter 3 weeks is immunized higher than the conventional vaccine of regulatory requirements by middle IBD-MAM and IBD-MAH（7log2）.It is and conventional
Vaccine reaches qualified for 3 weeks after immune, i.e., immune window phase can be shortened 1 week by the vaccine containing compound adjuvant.After immune 3rd week with
4th week, the antibody titer of the vaccine group containing immune compound adjuvant was above conventional vaccine group antibody titer.Refer to Fig. 4-A.
Lung lavage mucoantibody result.The compound adjuvant formula of various dose can improve lung of the IBD vaccines in chicken body
Flushing liquor Mucosal Antibody Titers, have obvious mucosal immunity humidification.Refer to Fig. 4-B.
Comprehensive serum antibody and mucoantibody the result shows that, compared with vaccine of the routine based on mineral oil adjuvant, this item
The compound adjuvant of mesh invention can significantly improve mucosal immunity and sero-immunity response of the IBD vaccines in chicken body.
Influence of 7 compound adjuvant of embodiment to infectious bronchitis vaccine immune efficacy
（1）Test material
Using existing infective bronchitis（IB）Vaccine, 1 first method of reference implementation example prepare the IB containing compound adjuvant
Vaccine L, M and H.IB vaccine standards detection antigen is purchased from Nanjing Tianbang Bio-industry Co., Ltd., and M41 detection antigens are purchased from lotus
Blue GD companies.No-special pathogen（Specific Pathogen Free, SPF）Chicken system ties up logical experimental animal from Beijing Cimmeria
Technology Co., Ltd. buys chicken embryo, through voluntarily hatching after being raised in isolator, raises stand-by to 5-15 ages in days.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, IB-MAL, IB-MAM and IB-MAH vaccine group and commodity IB vaccine groups containing compound adjuvant are set up（Abbreviation
For IB）, totally 4 groups, each group has 20 chickens.
（3）Influence of the compound adjuvant to IB vaccine immunity effect
Blood sampling and antibody titer detection：Through venous blood collection, separation serum, is resisted with IB standard detections within 2nd, 3 and 4 week after immune
It is former.At the same time 4th week after immune, every group is slaughtered 3 chickens, gathers lung lavage.By serum and lung lavage, using micro
Hemagglutination-inhibition test (HI) detects serum antibody titer.According to the antibody titer of every group of chicken, compare compound adjuvant to existing IB epidemic diseases
The immunoenhancement result of seedling.
As a result
Serum antibody result.2,3,4 weeks after immune, the antibody titer of the vaccine group containing compound adjuvant is imitated higher than conventional vaccine
Valency.Generally conventional vaccine needs first to be immunized through live vaccine, and conventional inactivated vaccine is immunized after 1 week again, improves the effect of inactivated vaccine
Valency.Refer to Fig. 5-A.
Lung lavage mucoantibody result.The compound adjuvant formula of various dose can improve IB vaccines and be rushed in the lung of chicken body
Washing lotion Mucosal Antibody Titers, have obvious mucosal immunity humidification.Refer to Fig. 5-B.
Comprehensive serum antibody and mucoantibody the result shows that, compared with vaccine of the routine based on mineral oil adjuvant, this item
The compound adjuvant of mesh invention can significantly improve mucosal immunity and sero-immunity response of the IB vaccines in chicken body.
8 compound adjuvant of embodiment is to ewcastle disease-infective bronchitis-H9 subtype avian influenza triple vaccines（ND-IB-
H9）The influence of immune efficacy
（1）Test material
Using existing ewcastle disease（ND）Vaccine, infective bronchitis（IB）Vaccine, H9 subtype avian influenza triple vaccines, reference
1 first method of the embodiment preparation ewcastle disease containing compound adjuvant-infective bronchitis-H9 subtype avian influenza triple vaccines L,
M and H.ND vaccines and ND standard detection antigens are purchased from Nanjing Tianbang Bio-industry Co., Ltd.；IB vaccine standards detect antigen
Purchased from Nanjing Tianbang Bio-industry Co., Ltd., M41 detection antigens are purchased from GD companies of Holland；H9 subtype avian influenzas vaccine and H9 are sub-
Type bird flu standard detection antigen is purchased from Nanjing Tianbang Bio-industry Co., Ltd..No-special pathogen（Specific
Pathogen Free, SPF）Chicken system buys chicken embryo from Beijing Cimmeria Wei Tong experimental animals Technology Co., Ltd., through voluntarily hatching
After being raised in isolator, raise stand-by to 5-15 ages in days.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, ND-IB-H9-MAL, ND-IB-H9-MAM and ND-IB-H9-MAH vaccine group containing compound adjuvant are set up
With commodity ND-IB-H9 vaccine groups（It is abbreviated as ND-IB-H9）, totally 4 groups, each group has 20 chickens.
（3）Influence of the compound adjuvant to ND-IB-H9 vaccine immunity effect
Blood sampling and antibody titer detection：Through venous blood collection, separation serum, is marked with ND standards, IB within 2nd, 3 and 4 week after immune
Accurate, H9 subtype avian influenza standard detections antigen detection antibody.At the same time 4th week after immune, every group is slaughtered 3 chickens, gathers lung
Flushing liquor.By serum and lung lavage, serum antibody titer is detected using microdose cytopathogenic effect assay (HI).According to every group of chicken
Antibody titer, compare immunoenhancement result of the compound adjuvant to existing ND-IB-H9 vaccines.
As a result
Serum antibody result.2,3,4 weeks after immune, the various antibody titers of the vaccine group containing compound adjuvant are higher than conventional vaccine
Potency.Generally conventional vaccine needs first to be immunized through live vaccine, and conventional inactivated vaccine is immunized after 1 week again, improves inactivated vaccine
Potency.Refer to Fig. 6-A, 7-A, 8-A.
Lung lavage mucoantibody result.The compound adjuvant formula of various dose can improve ND-IB-H9 vaccines in chicken body
Lung lavage Mucosal Antibody Titers, there is obvious mucosal immunity humidification.Refer to Fig. 6-B, 7-B, 8-B.
Comprehensive serum antibody and mucoantibody the result shows that, compared with vaccine of the routine based on mineral oil adjuvant, this item
The compound adjuvant of mesh invention can significantly improve mucosal immunity and sero-immunity response of the ND-IB-H9 vaccines in chicken body.
9 compound adjuvant of embodiment is to ewcastle disease-infective bronchitis-infectious bursa of Fabricius triple vaccine（ND-IB-
IBD）The influence of immune efficacy
（1）Test material
Using existing ewcastle disease（ND）Vaccine, infective bronchitis（IB）Vaccine, infectious bursa of Fabricius（IBD）Three epidemic diseases
Seedling, 1 first method of reference implementation example prepare ewcastle disease-infective bronchitis-infectious bursa of Fabricius containing compound adjuvant
（ND-IB-IBD）Triple vaccine L, M and H.ND vaccines and ND standard detection antigens are purchased from the Nanjing day limited public affairs of nation's biotechnology
Department；IB vaccine standards detection antigen is purchased from Nanjing Tianbang Bio-industry Co., Ltd., and M41 detection antigens are purchased from GD companies of Holland；
IBD commercially available vaccines are purchased from Nanjing Tianbang Bio-industry Co., Ltd., IBD standard detection strains, and BC6-85 is purchased from Chinese veterinary drug
Institute is supervised, DF-1 cells are purchased from American Type Culture research institute（ATCC）.No-special pathogen（Specific Pathogen
Free, SPF）Chicken system buys chicken embryo from Beijing Cimmeria Wei Tong experimental animals Technology Co., Ltd., through voluntarily hatching after isolation
Raising, is raised stand-by to 5-15 ages in days in device.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 4 week old with
Interior chicken immune 0.3mL/ chickens, immunization route are muscle or hypodermic injection.This experiment takes 15 age in days chickens, through neck subcutaneous route
By 0.3mL/ chicken inoculations, ND-IB-IBD-MAL, ND-IB-IBD-MAM and ND-IB-IBD-MAH vaccine containing compound adjuvant are set up
Group and commodity ND-IB-IBD vaccine groups（It is abbreviated as ND-IB-IBD）, totally 4 groups, each group has 20 chickens.
（3）Influence of the compound adjuvant to ND-IB-IBD vaccine immunity effect
Blood sampling and antibody titer detection：Through venous blood collection, separation serum, is marked with ND standards, IB within 2nd, 3 and 4 week after immune
Accurate, IBD standard detections antigen detection antibody.At the same time 4th week after immune, every group is slaughtered 3 chickens, gathers lung lavage.Will
Serum and lung lavage, detect serum antibody titer using microdose cytopathogenic effect assay (HI).Imitated according to the antibody of every group of chicken
Valency, compares immunoenhancement result of the compound adjuvant to existing ND-IB-IBD vaccines.
As a result
Serum antibody result.2,3,4 weeks after immune, the various antibody titers of the vaccine group containing compound adjuvant are higher than conventional vaccine
Potency.Generally conventional vaccine needs first to be immunized through live vaccine, and conventional inactivated vaccine is immunized after 1 week again, improves inactivated vaccine
Potency.Refer to Fig. 9-A, 10-A, 11-A.
Lung lavage mucoantibody result.The compound adjuvant formula of various dose can improve ND-IB-IBD vaccines in chicken
The lung lavage Mucosal Antibody Titers of body, have obvious mucosal immunity humidification.Refer to Fig. 9-B, 10-B, 11-B.
Comprehensive serum antibody and mucoantibody the result shows that, compared with vaccine of the routine based on mineral oil adjuvant, this item
The compound adjuvant of mesh invention can significantly improve mucosal immunity and sero-immunity response of the ND-IB-IBD vaccines in chicken body.
10 compound adjuvant of embodiment is to pig parvoviral disease vaccine（PPV）The influence of immune efficacy
（1）Test material
Using existing pig parvoviral disease vaccine（PPV）, it is thin that 1 first method of reference implementation example prepares the pig containing compound adjuvant
Minor illness viral disease PPV vaccines L, M and H.Swine parvovirus vaccine is purchased from Nanjing Tianbang Bio-industry Co., Ltd.；Pig parvoviral
ELISA antibody assay kits, purchased from Shenzhen Lv Shiyuan Bioisystech Co., Ltd；5 ~ 6 monthly age feminine gender replacement gilts（Pig is tiny
Viral HI negative antibodies）, purchased from Jiangsu agriculture and animal husbandry tomorrow scientific ＆ technical corporation.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 5 ~ 6 monthly ages
Negative replacement gilt, immunization route are muscle or hypodermic injection, are inoculated with by 2mL/ parts；Two exempt from after 2 weeks, are connect by 2mL/ parts
Kind.1 week after head exempts from, take a blood sample within 2 weeks, 3 weeks, 4 weeks, 9 weeks, 18 weeks, resisted respectively with PPV in HI and ELISA method detection serum
Body, while set up PPV-MAL, PPV-MAM and PPV-MAH vaccine group and commodity PPV vaccine groups containing compound adjuvant（It is abbreviated as
PPV）, totally 4 groups, each group has 10 pigs.
（3）Influence of the compound adjuvant to PPV vaccine immunity effect
The detection serum processing of pig parvoviral hemagglutination inhibition antibody (HI)：100 μ L positive serums are taken to be placed in 56 DEG C of water-baths
1h is inactivated in pot, 25% kaolinite soil suspension, 300 μ L is then added and fully mixes to be placed in 37 DEG C of incubators and act on 30min, 3000
R/min centrifuges 5min, draws supernatant and adds 100 μ L, 20% guinea pig red blood cells mud, concussion mixes to be acted in 37 DEG C of incubators of postposition
1h, 1500 r/min centrifuge 10min, and it is 1 to collect supernatant：Positive serum to be checked after 4 dilutions.First 96 hole V shaped slabs 1 to
11 holes add 50 μ L PBS, and the 12nd hole adds 100 μ L of PBS for red blood cell control wells.Then only processed treat is added in the 1st hole
50 μ L of serum are examined, then doubling dilution is to the 10th hole, and suctions out 50 μ L from the 10th hole and discard, and serum to be checked is respectively 1 at this time：
8、1：16、……1：4096.Add 4 unit PPV Antigen Using, 50 μ L per hole in addition to the 12nd row's red blood cell control wells, at this time the
11 holes are virus control wells, and concussion mixing is put in wet box acts on 1h in 37 DEG C of incubators.Add 0.6% guinea pig red blood cells suspension, 50 μ per hole
L, concussion mixing is put acts on 2 h in 37 DEG C of incubators in wet box, observe result.Result judgement：It can suppress 100% erythrocyte agglutination
Serum highest extension rate be tested serum hemagglutination inhibition antibody effect.
Indirect ELISA antibody test will separate method of the serum to be checked according to ELISA detection kit operation instructions
Carry out PPV ELISA antibody.OD is read by microplate reader630Value, measures blood serum sample ELISA antibody titers, OD630﹥ 0.32 sentences
For the positive.
3. result
HI testing results.It is conventional vaccine immune group HI antibody moieties turn sun (HI antibody is not less than 6) after 1 week, all after 2 weeks
The positive, HI antibody is in higher level within 1 ~ 4 week, has declined within 18 weeks to after being immunized.The compound adjuvant formula vaccine of various dose
Immune group after 1 week HI antibody all turn sun, it is immune after 4 months antibody levels be kept at higher level and apparently higher than conventional epidemic disease
Seedling immune group (Figure 12).
Indirect ELISA antibody test result.The ELISA antibody test result tables after replacement gilt are immunized in PPV inactivated vaccines
Bright, 1 week ELISA antibody all turns sun (OD after each immune group is immunized630>=0.32) it is, within 1~3 week ascent stage, 4~18 weeks water
It is flat relatively to stablize.1 ~ 4 month antibody level is kept at higher level after the compound adjuvant formula vaccine group of various dose is immunized.Contain
Immunopotentiator group each period antibody level obviously higher than conventional vaccine immune group (Figure 13).
Comprehensive Serum HI antibody and indirect ELISA Antibody Results show, compared with routine is based on the vaccine of mineral oil adjuvant
Compared with the compound adjuvant of this project invention can significantly improve sero-immunity response of the PPV vaccines in pig body.
11 compound adjuvant of embodiment is to pig japanese b encephalitis disease vaccine（JEV）The influence of immune efficacy
（1）Test material
Using existing pig japanese b encephalitis disease vaccine（JEV）, pig second of 1 first method of the reference implementation example preparation containing compound adjuvant
Type encephalitis disease JEV vaccines L, M and H.Pig japanese b encephalitis disease vaccine is purchased from Nanjing Tianbang Bio-industry Co., Ltd.；Pig japanese b encephalitis
Latex agglutination（LAT）Antibody assay kit, purchased from Wuhan Keqian Animal Biological Products Co., Ltd..40 ages in days of experiment
Sodium selenite, purchased from Jiangsu agriculture and animal husbandry tomorrow scientific ＆ technical corporation.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 40 ages in days are good for
Health piglet, immunization route are muscle or hypodermic injection, are inoculated with by 2mL/ parts；Two exempt from after 2 weeks, are inoculated with by 2mL/ parts.At the same time
Set up JEV-MAL, JEV-MAM and JEV-MAH vaccine group and commodity JEV vaccine groups containing compound adjuvant（It is abbreviated as JEV）, totally 4
Group, each group have 10 pigs.Experiment swinery first takes a blood sample through vena cava anterior before first immunisation and separates serum, every two weeks later
Blood sampling once, is exempted from ten weeks latter to two.Detection gathers the JEV LAT antibody levels of serum sample.
（3）Influence of the compound adjuvant to JEV vaccine immunity effect
Indirect ELISA antibody test by separate serum to be checked according to ELISA detection kit operation instructions method into
Row JEV LAT ELISA antibody.OD is read by microplate reader630Value, measures blood serum sample ELISA antibody titers, OD630﹥ 0.32
It is judged to the positive.
2. result
Indirect ELISA antibody test result.JEV LAT antibody test results show after vaccine immunity piglet, and all dosage groups are young
Pig is immunized 1 week antibody after being immunized and all turns sun, and subsequent antibody titer progressively increases, immune rear 2~4 weeks antibody titers maintain compared with
High level, group containing immunopotentiator each period antibody level obviously higher than conventional vaccine immune group (Figure 14).
Indirect ELISA Antibody Results show, compared with vaccine of the routine based on mineral oil adjuvant, the invention of this project is answered
Square adjuvant can significantly improve sero-immunity response of the JEV vaccines in pig body.
12 compound adjuvant of embodiment is to pseudorabies disease vaccine（PRV）The influence of immune efficacy
（1）Test material
Using existing pseudorabies disease vaccine（PRV）, it is mad that 1 first method of reference implementation example prepares the pig puppet containing compound adjuvant
Dog disease PRV vaccines L, M and H.Pseudo- mad dog live vaccine Bartha-K61, Nanjing day biology section of nation
Skill Co., Ltd produces；BHK21 cells are purchased from American Type Culture research institute（ATCC）, neutralizing antibody detection uses
Popular variation strain is PRV-NJ plants, is the separated identification of this research.The standby of porcine pseudorabies virus serum antibody negative healthy is female
Pig, purchased from Jiangsu agriculture and animal husbandry tomorrow scientific ＆ technical corporation.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", healthy standby
Sow, immunization route are muscle or hypodermic injection, 2.0mL vaccines, after 14d with Isodose booster immunization once.Set up at the same time
PRV-MAL, PRV-MAM and PRV-MAH vaccine group and commodity PRV vaccine groups containing compound adjuvant（It is abbreviated as PRV）, totally 4 groups, respectively
Group has 5 pigs.14 d and 35d blood samplings, neutralizing antibody to be detected after immune.
（3）Influence of the compound adjuvant to PRV vaccine immunity effect
Serum aseptic process, 56 DEG C of inactivation 30min are used for neutralization test by neutralizing antibody detection.With maintaining liquid by serum into
Row 1：2,1：4,1：8 ... ... doubling dilutions, with 200 TCID50PRV-NJ strain virus liquid mixes, 37 DEG C of incubation 1h；It is inoculated with 96 holes
Plate BHK-21 cells, 100uL/ holes, each serum dilution set 4 repeating holes.It is placed in 5% CO237 DEG C of cultures of cell incubator
5d, observes cytopathy（CPE）Record lesion number of perforations.Neutralize antibody titers are calculated by Reed-Muench methods.
2. result
Neutralizing antibody testing result.The blood serum sample of 14d and 35d carries out the detection of neutralizing antibody, each vaccine immunities of PRV after immune
Group 14d after immune can detect specific neutralizing antibody, exempt from antibody water of the group containing immunopotentiator in each period
Averagely apparently higher than PRV vaccines.(Figure 15).
Neutralizing antibody testing result shows, compared with vaccine of the routine based on mineral oil adjuvant, the invention of this project is answered
Square adjuvant can significantly improve sero-immunity response of the PRV vaccines in pig body.
13 compound adjuvant of embodiment is to porcine circovirus type 2 vaccines（PCV2）The influence of immune efficacy
Using existing porcine circovirus type 2 vaccines（PCV2）, pig of 1 first method of the reference implementation example preparation containing compound adjuvant
Circovirus-II vaccine L, M and H.Porcine circovirus 2 type inactivated vaccine（SH plants）（Product batch number 1305009）By the agriculture of Jiangsu south
High-tech limited company produces.Porcine circovirus type 2 vaccines ELISA antibody assay kits, give birth to purchased from Shenzhen Lv Shi sources
Thing Technology Co., Ltd.；The sodium selenite of 35 ages in days of experiment, purchased from Jiangsu agriculture and animal husbandry tomorrow scientific ＆ technical corporation.
（2）Test method
Immune and packet：According to《Veterinary biologics quality standard collects（2006-2008）》, referred to as " code ", 35 ages in days
Sodium selenite, immunization route are injected for musculi colli, 2mL/ parts.2 weeks booster immunizations are spaced after first immunisation once.After immune
Took a blood sample once to each test group every 2 weeks, detection porcine circovirus 2 type antibody is horizontal, while sets up the PCV2- containing compound adjuvant
MAL, PCV2-MAM and PCV2-MAH vaccine group and commodity PCV2 vaccine groups（It is abbreviated as PCV2）, totally 4 groups, each group has 10
Pig.
（3）Influence of the compound adjuvant to PCV2 vaccine immunity effect
The PCV2 antibody being had built up using this laboratory, ELISA detection method detect the antibody level in sample, operation step
It is rapid as follows：（1）The PCV2 recombinant Cap proteins of Bacillus coli expression are diluted to 5 μ g/m L of final concentration with coating buffer, are coated with enzyme mark
Plate per 100 μ L, 37 DEG C of 1h of hole, 4 DEG C overnight after wash 3-4 each 3min.（2）The skimmed milk power of 300 μ L 5% is added per hole
3-4 each 3min is washed after 37 DEG C of closing 1h.（3）By serum to be checked PBS 1：50 dilutions, it is dilute then to do 2 times of series again
Release, per sample l rows, washed 3-4 times after 100 μ L, 37 DEG C of effect 1h are added per hole, each 3min.（4）Add horseradish peroxidase
The sheep anti mouse secondary antibody (1 of mark：2000 times dilution), 100 μ L/ holes, 37 DEG C effect 1h after wash 3-4 times, each 3min.（5）Add
Substrate nitrite ion TMB, 100 μ L/ holes, 37 DEG C of lucifuges colour developing 15min.（6）Adding 2mol/L sulfuric acid, 50 μ L/ holes terminate reaction,
The OD values of 450nm wavelength are read in 10min in microplate reader.
Result judgement：Serum OD to be checked450Nm values are judged to the positive more than 0.211, with OD450When nm values are more than 0.211
ELISA antibody titer of the serum maximum dilution multiple as the serum
2. result
ELISA antibody test results.The ELISA antibody test result tables after the sodium selenite of 35 ages in days are immunized in PCV2 inactivated vaccines
Bright, 1 week ELISA antibody all turns positive vaccine after each immune group is immunized；Antibody titer is up to 800 times when being inoculated with 2 weeks；3 weeks~4 weeks anti-
Body potency is substantially increased, and can reach 4000 times；Antibody titer is up to 12800 times within 5 weeks~7 weeks.Group containing immunopotentiator is each
The antibody level of period is obviously higher than conventional vaccine immune group (Figure 16).
Indirect ELISA Antibody Results show, compared with vaccine of the routine based on mineral oil adjuvant, the invention of this project is answered
Square adjuvant can significantly improve sero-immunity response of the PCV2 vaccines in pig body.
Sequence table
<110>Jiangsu Province Agriculture Science Institute
<120>Animal targets immunopotentiator and its application in live vaccine with mucous membrane
<130> 20171213
<150> 2017109434048
<151> 2017-10-11
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213>Artificial synthesized (artificial sequence)
<400> 1
tcgtcgttat agtcgtttta gtcgtt 26
Claims (9)
1. animal with mucous membrane target immunopotentiator, it is characterized in that, containing 0.5 μ g~500 μ g/mL CpG, 0.1 μ g~1mg/
The Poly of the α-GC of mL, 0.1 μ g~3mg/mL（I:C）, the PLGA of 1 μ g~5mg/mL, the PEI of 0.1 μ g~5mg/mL, 1 μ g~
10mg/mL chitosans.
2. animal according to claim 1 targets immunopotentiator with mucous membrane, it is characterized in that, CpG, α-GC, Poly（I:
C）, PLGA, PEI and chitosan mass concentration ratio be 1:(3~8):(2~8):(2~8):(3~7):(2~7).
3. animal according to claim 1 targets immunopotentiator with mucous membrane, it is characterized in that, CpG, α-GC, Poly（I:
C）, PLGA, PEI and chitosan mass concentration ratio be 1:(4~6):(3~5):(4~6):(3~5):(3~5).
4. the animal preparation method of mucous membrane targeting immunopotentiator in claim 1-3 described in any one, its feature
It is：CpG, α-GC, Poly are separately added into phosphate buffer solution（I:C）, PLGA, PEI and chitosan, adjust pH to 7.0-
7.2, be prepared into mixed solution, filter, is degerming, to obtain the final product.
5. application of the animal with mucous membrane targeting immunopotentiator in live vaccine in claim 1-3 described in any one.
6. application according to claim 5, it is characterized in that, animal is included in the live vaccine and is exempted from mucous membrane targeting
Epidemic disease reinforcing agent and killed vaccine antigen.
7. application according to claim 6, it is characterized in that, in live vaccine immunopotentiator is targeted containing animal mucous membrane
Composition for the μ g/mL of 0.5 μ g~500 CpG, α-GC, the Poly of 0.1 μ g~3mg/mL of 0.1 μ g~1mg/mL（I:C）、1μg
The PLGA of~5mg/mL, the PEI of 0.1 μ g~5mg/mL, 1 μ g~10mg/mL chitosans.
8. application according to claim 6, it is characterized in that, the live vaccine is H9 subtype avian influenzas vaccine, new city
Epidemic disease vaccine, infectious bursa of Fabricius vaccine, infectious bronchitis vaccine, ewcastle disease-H9 bird flu bigeminy vaccines, ewcastle disease-biography
Metachromia bursa of farbricius bigeminy vaccine, ewcastle disease-infectiousness bronchitis bigeminy vaccine, ewcastle disease-infective bronchitis-H9 hypotypes
Bird flu triple vaccine, pig parvoviral disease vaccine, pig japanese b encephalitis disease vaccine, pseudorabies disease vaccine, Porcine circovirus desease
Vaccine.
9. application according to claim 6, it is characterized in that, the preparation method of live vaccine be first according to 0.5 μ g~
The CpG of 500 μ g/mL, the α-GC of 0.1 μ g~1mg/mL, the Poly of 0.1 μ g~3mg/mL（I:C）, 1 μ g~5mg/mL PLGA,
The PEI of 0.1 μ g~5mg/mL, the chitosan of 1 μ g~10mg/mL configure to obtain animal mucous membrane targeting immunopotentiator, then
The vaccine antigen of required vaccine is added to the animal prepared mucous membrane and is targeted in immunopotentiator, is mixed, to obtain the final product.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710943404 | 2017-10-11 | ||
| CN2017109434048 | 2017-10-11 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108014333A true CN108014333A (en) | 2018-05-11 |
| CN108014333B CN108014333B (en) | 2020-10-20 |
Family
ID=62073247
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711324750.4A Active CN108014333B (en) | 2017-10-11 | 2017-12-13 | Mucosal targeted immunopotentiator for animals and application thereof in veterinary vaccines |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108014333B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111558036A (en) * | 2020-05-14 | 2020-08-21 | 中国医学科学院医学生物学研究所 | Herpes zoster vaccine composition, and preparation method and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102743750A (en) * | 2012-07-09 | 2012-10-24 | 江苏省农业科学院 | Compound immunoenhancement agent, vaccine for birds and method for preparing compound immunoenhancement agent |
| CN102793920A (en) * | 2012-08-21 | 2012-11-28 | 江苏省农业科学院 | Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof |
| WO2013123432A2 (en) * | 2012-02-16 | 2013-08-22 | Atyr Pharma, Inc. | Histidyl-trna synthetases for treating autoimmune and inflammatory diseases |
| CN105327363A (en) * | 2010-11-16 | 2016-02-17 | 塞莱克塔生物科学股份有限公司 | Immunostimulatory oligonucleotides |
-
2017
- 2017-12-13 CN CN201711324750.4A patent/CN108014333B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105327363A (en) * | 2010-11-16 | 2016-02-17 | 塞莱克塔生物科学股份有限公司 | Immunostimulatory oligonucleotides |
| WO2013123432A2 (en) * | 2012-02-16 | 2013-08-22 | Atyr Pharma, Inc. | Histidyl-trna synthetases for treating autoimmune and inflammatory diseases |
| CN102743750A (en) * | 2012-07-09 | 2012-10-24 | 江苏省农业科学院 | Compound immunoenhancement agent, vaccine for birds and method for preparing compound immunoenhancement agent |
| CN102793920A (en) * | 2012-08-21 | 2012-11-28 | 江苏省农业科学院 | Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof |
Non-Patent Citations (1)
| Title |
|---|
| 王志明等: "黏膜疫苗的研究现状与进展", 《中国药学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111558036A (en) * | 2020-05-14 | 2020-08-21 | 中国医学科学院医学生物学研究所 | Herpes zoster vaccine composition, and preparation method and application thereof |
| CN111558036B (en) * | 2020-05-14 | 2023-08-08 | 中国医学科学院医学生物学研究所 | Herpes zoster vaccine composition and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108014333B (en) | 2020-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA1204055A (en) | Infectious-bronchitis vaccines for poultry, combined infectious-bronchitis vaccines, process for preparing such vaccines, process for preventing infectious bronchitis and infectious-bronchitis virus strain | |
| CN103305474B (en) | Porcine pseudorabies poison strain and its inactivated vaccine and application | |
| CN106497890B (en) | A kind of XF-1 plants of porcine pseudorabies virus variant and preparation method and application | |
| CN102220287B (en) | Avian infectious bronchitis cold adaptation attenuated vaccine strain and application thereof | |
| CN102068695B (en) | Method for producing quadruple inactivated vaccine for newcastle disease, infectious bronchitis, avian influenza (H9 subtype) and infectious bursal disease | |
| CN104043117B (en) | A kind of vaccine combination and its preparation method and application | |
| CN102166352B (en) | Preparation method of swine influenza bivalent inactivated vaccine and product of swine influenza bivalent inactivated vaccine | |
| CN108969492B (en) | Oral attenuated freeze-dried vaccine for swine fever and preparation method thereof | |
| CN102793920B (en) | Compound immunopotentiator, inactivated vaccine for poultry, and preparation method thereof | |
| CN108014333A (en) | Animal targets immunopotentiator and its application in live vaccine with mucous membrane | |
| CN106190991A (en) | A kind of avian encephalomyclitis virus, inactivated vaccine and preparation method thereof | |
| CN102961742A (en) | Bivalent inactivated vaccine of porcine circovirus type 2 and porcine parvovirus and preparation method thereof | |
| CN109055320A (en) | One plant of infectious bronchitis virus separation strains and the application in vaccine preparation | |
| CN104474542A (en) | Preparation method of bi-combined inactivated vaccine | |
| CN104031888B (en) | Newcastle disease virus low virulent strain, inactivated vaccine and application thereof | |
| CN108703952B (en) | Freeze-drying protective agent for swine fever oral attenuated freeze-dried vaccine and application | |
| CN103497933B (en) | One application of strain H9N2 type bird flu strain on vaccine development | |
| CN102114243A (en) | Method for preparing polyvalent vaccine of primary hamster kidney cells of flu | |
| CN102908619A (en) | Preparation method of egg yolk antibody injection for treating porcine respiratory syndrome | |
| CN103316334A (en) | Infectious bursal disease live vaccine and production method thereof | |
| CN103834620A (en) | Newcastle disease virus, newcastle disease inactivated vaccine and preparation method of newcastle disease inactivated vaccine | |
| CN105749273A (en) | Bivalent inactivated vaccine for porcine circovirus type 2 and porcine parvovirus and preparation method thereof | |
| CN103263667B (en) | Chicken infectious bursal disease live vaccine and production method thereof | |
| CN109350738B (en) | Pseudorabies live vaccine diluent and preparation method and application thereof | |
| CN101906404B (en) | Avian infectious bronchitis virus (IBV) as well as culture method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |