CN108004269A - A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise - Google Patents
A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise Download PDFInfo
- Publication number
- CN108004269A CN108004269A CN201810005684.2A CN201810005684A CN108004269A CN 108004269 A CN108004269 A CN 108004269A CN 201810005684 A CN201810005684 A CN 201810005684A CN 108004269 A CN108004269 A CN 108004269A
- Authority
- CN
- China
- Prior art keywords
- beautiful
- promise
- agrobacterium
- seed
- explant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a kind of method that Agrobacterium tumefaciens mediated no seed genetic transformation promise is beautiful.Its technical solution is：Comprise the following steps：, will be without in the beautiful root segment of seed channel genes promise using agrobacterium tumefaciens-mediated transformation using the beautiful in vitro cuttings root segment of the promise of 30 d of subculture as explant：The beautiful aseptic seedling root segment of promise shakes preculture 3d in 3%MS fluid nutrient mediums, through Agrobacterium tumefaciems bacterium solution, infects 20 min, on base is co-cultured after light culture 3d, it is placed on resistance screening culture medium and cultivates 20 d, carry out screening and culturing, counts explant resistance inductivity；Beneficial effect is：The present invention is using the beautiful aseptic seedling root segment of promise as explant, will be without in the beautiful root segment of seed channel genes promise using agrobacterium-mediated transformation, realize the beautiful no seed of promise, with it is uncommon follow-up squeeze the juice using promise is beautiful when reduce industrial residue, while also be the referential technical method of the beautiful offer of other gene transformation promises and be that the identification of the beautiful functional gene of follow-up promise lays the foundation.
Description
Technical field
The present invention relates to a kind of method that no seed genetic transformation promise is beautiful, more particularly to a kind of Agrobacterium tumefaciens mediated no seed
The beautiful method of genetic transformation promise.
Background technology
Nuo Li（Morinda citrifolia）Belong to tropical evergreen perennial broadleaf shrub or dungarunga, be dicotyledonous madder
Careless section's Morinda, is a kind of xylophyta[1].Nuo Li is the call of Hawaiians, and name known at present, it
Also a lot of other names, such as Morinda, four seasons fruit or Loli etc..Nuo Li originates in the South Pacific Ocean heat along equatorial line distribution
With each island country, China is mainly distributed on the ground such as Taiwan, Hainan Island and the Xisha Islands, likes sparse woods or the beach level land of warm moist.
Nuo Li has higher utility value, almost each organ can be used as medicine, each to treating and preventing as a kind of natural fruit
Kind disease has significant effect, enjoys the title of " holy fruit in thousand ", in medical treatment, health care, food products market obtains the favor of general public.
About three or four hundred seeds in each Noni fruit, these seeds not only increase the difficulty and cost of processing in the application, also
Yield rate is reduced, if can produce no seed Noni fruit will effectively solve the problems, such as these.But people were beautiful to promise in recent years
Research is concentrated mainly in nutritional ingredient and pharmacological action, its research of fruit germplasm resource is lagged very much, though successful clone goes out promise
Beautiful deoxy-D-xylulose sugar -5- phosphoric acid ribozymes, but there has been no detailed functional study, main reason is that without the ripe beautiful something lost of promise
Pass transformation system.
Stenospermocarpy technology is to solve the problems, such as this available strategy, it can not only improve fruit quality, moreover it is possible to improve yield
With the fresh preservation phase, but there are parthenocarpy less varieties, external application hormone amount of application to be difficult to grasp for traditional stenospermocarpy production method
And a series of problems, such as tetraploid kind more difficult acquisition.Without seed gene（Patent No. US6268552）It is U.S. biologist Li Yi
The patented technology of professor, this patent provide the method that stenospermocarpy is obtained with transgenic technology.The technology passes through certain
Kind of approach or method make it be expressed in progeny plants by the genome of no seed channel genes recipient cell, so that
Induction produces stenospermocarpy.Transgenic technology mainly has particle bombardment, agrobacterium-mediated transformation, pollen tube passage method, electric shocking method etc.
Means, wherein agrobacterium-mediated transformation application are the most universal.80 % are above is using this in orchard fruit converts successful story
Method, has high conversion rate, stabilization, conversion plant is easy to expand the advantages that numerous, while can also improve crop resistance and yield and product
Matter.Therefore, this experiment, will be without the beautiful root segment of seed channel genes promise using agrobacterium-mediated transformation using the beautiful aseptic seedling root segment of promise as explant
In, realize the beautiful no seed of promise, industrial residue is reduced with uncommon follow-up use when promise is beautiful to squeeze the juice, while be also other gene transformations
Nuo Li provides referential technical method and lays the foundation for the identification of the beautiful functional gene of follow-up promise.
The content of the invention
The purpose of the present invention is aiming at drawbacks described above existing in the prior art, there is provided a kind of Agrobacterium tumefaciens mediated nothing
The beautiful method of seed genetic transformation promise.
A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise that the present invention mentions, its technical solution are：
Comprise the following steps：
, will be without seed channel genes using agrobacterium tumefaciens-mediated transformation using the beautiful in vitro cuttings root segment of the promise of 30 d of subculture as explant
In the beautiful root segment of promise：The beautiful aseptic seedling root segment of promise shakes preculture 3d in 3%MS fluid nutrient mediums, through Agrobacterium tumefaciems bacterium solution, infects
20 min, on base is co-cultured after light culture 3d, are placed on resistance screening culture medium and cultivate 20 d, carry out screening and culturing, statistics
Explant resistance inductivity；
Agrobacterium tumefaciems bacterium solution, by cultivating 8-9 h, OD600≈0.5；
Co-culturing the proportioning of base is：3+100 μm of ol/L AS of % MS solid mediums, resistance screening culture medium use 3 % MS
+ 200 mg/L Cef of+15 mg/L Kan of the mg/L of solid medium+1.5 6-BA.
Preferably, the every 30 d subcultures of tissue-cultured seedling that the beautiful in vitro cuttings root segment of the promise of 30 d of subculture uses once, after being commissioned to train
It is+0.2 mg/L NAA of 3 %MS solid mediums to support base.
Preferably, above-mentioned 3 %MS solid mediums are on the basis of 3%MS fluid nutrient mediums, add 6.5 g/L agar
Powder, in 121 DEG C of 20 min of sterilizing of high-pressure sterilizing pot.
Preferably, the culture of above-mentioned Agrobacterium tumefaciems comprises the following steps：
Agrobacterium tumefaciems bacterium solution is dipped with aseptic inoculation ring, line is dark after 28 DEG C of culture carton upside downs on YEB solid mediums
Culture is to growing single bacterium colony；Picking single bacterium colony is inoculated in YEB fluid nutrient mediums, 28 DEG C, 200 r/min shaking table cultures are to mixed
It is turbid, then take 1 mL bacterium solutions to add in the 50 ml YEB fluid nutrient mediums containing 100 μm of ol/L AS and carry out subculture, per small
When with ultraviolet specrophotometer measurement Agrobacterium bacterium solution OD values, drafting Agrobacterium growth curve.
Preferably, above-mentioned YEB solid mediums：It is on the basis of YEB fluid nutrient mediums, adds 6.5 g/L agar
Powder, in 121 DEG C of 20 min of sterilizing of high-pressure sterilizing pot.
Preferably, above-mentioned YEB fluid nutrient mediums：Containing 50 mg/L Rif+50 mg/L Kan+100 μm ol/L AS.
A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise that the present invention mentions, including walk in detailed below
Suddenly：
Using the beautiful seedling of sterile promise of 30 d of subculture as material, its root is cut into the segment of 0.5 cm, is put into containing MS fluid nutrient mediums
Culture dish in, slightly covered explant, 3 d of preculture under the conditions of the shaking table of 120 r/min, natural lighting；It is then placed in
Cultivate 8-9 h, OD60020 min are soaked in the Agrobacterium tumefaciems bacterium solution of ≈ 0.5, during which constantly gently shake bottle；Immersion terminates
After take out material, blot bacterium solution with aseptic filter paper, be placed on the co-cultivation base containing 100 μm of ol/L AS after light culture 3d, use
Sterile distilled water rinses 5-8 times, then explant is put into the distilled water containing 200 mg/L Cef and soaks 20 min, during which light
Shake several times, take out, and with aseptic filter paper suck dry moisture, be inoculated in+15 mg/L Kan of+1.5 mg/L 6-BA of 3 % MS+
On 200 mg/L Cef resistance screening culture mediums, screening and culturing is carried out, counts explant resistance inductivity.
Preferably, to above-mentioned steps statistics explant resistance inductivity after the beautiful aseptic seedling root segment sample of promise,
Southern hybridization checks are carried out with digoxin random primering label probe, the extraction through the beautiful genomic DNA of promise
Digestion, plasmid enzyme restriction, the preparation of probe, transferring film, hybridization step, find in the beautiful aseptic seedling root segment sample of promise of detection, Nuo Li
Transgenic line G9 has hybridising band, illustrates that no seed gene is successfully plugged on G9 chromosomes, transgenosis success.
The beneficial effects of the invention are as follows：The present invention, will using agrobacterium-mediated transformation using the beautiful aseptic seedling root segment of promise as explant
Without in the beautiful root segment of seed channel genes promise, having obtained containing whetheing there is the beautiful plant of promise of seed gene, and pass through Southern hybrid experiments
Prove to have been inserted into the beautiful chromosome of promise without seed gene, can will stablize without seed character entail offspring in theory, and be follow-up real
The existing beautiful no seed of promise has established material base；Present invention also offers a kind of method of genetic transformation, middle other are carried out promise is beautiful
Functional gene identify when also can be used this method carry out, all the time, the genetic transformation chance of success of xylophyta all than relatively low,
The present invention enriches woody plant transgenosis successful story, has reference to make to other equal xylophyta genetic transformations belonged to together
With；
In addition, the present invention it is good without the beautiful strain G9 growth conditions of seed transgenosis promise, can 3%MS culture mediums and it is potted plant in just
It is frequently grown.
Brief description of the drawings
Attached drawing 1 is " no seed gene " plasmid map；
Attached drawing 2 is the growth curve of subculture EHA105 agrobatcerium cells；
Attached drawing 3 is the albefaction bud schematic diagram that the root of the beautiful aseptic seedling of promise breaks up on screening and culturing medium；
Attached drawing 4 is the resistant buds schematic diagram that the root of the beautiful aseptic seedling of promise breaks up on screening and culturing medium；
Attached drawing 5 is the resistant plant schematic diagram that the root of the beautiful aseptic seedling of promise breaks up on screening and culturing medium；
Attached drawing 6 is the PCR testing result figures of II primers of Npt；
Attached drawing 7 is the electrophoresis detection schematic diagram of genomic DNA；
Attached drawing 8 is genomic DNA restriction enzyme digestion and electrophoresis detects schematic diagram；
Attached drawing 9 is plasmid enzyme restriction electrophoresis detection；
Attached drawing 10 is probe electrophoresis detection figure；
Attached drawing 11 is the schematic diagram of CSPD exposures 1h；
Attached drawing 12 is the schematic diagram of CSPD exposures 3h.
Embodiment
The preferred embodiment of the present invention is illustrated below in conjunction with attached drawing, it will be appreciated that described herein preferred real
Apply example to be merely to illustrate and explain the present invention, be not intended to limit the present invention.
A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise that the present invention mentions, comprises the following steps：
The beautiful genetic transformation of 1 promise
The culture of 1.1 Agrobacterium tumefaciems
Agrobacterium tumefaciems bacterium solution is dipped with aseptic inoculation ring, in YEB solid mediums（Containing 50 mg/L Rif+50 mg/L Kan+
100 umol/L AS）Upper line cultivates carton upside down light cultures after 28 DEG C to growing single bacterium colony.Picking single bacterium colony is inoculated in YEB
Fluid nutrient medium（Containing 50 mg/L Rif+50 mg/L Kan+100 μm ol/L AS）In, 28 DEG C, 200 r/min shaking table cultures
To muddiness, then take 1 mL bacterium solutions to add in the 50 ml YEB fluid nutrient mediums containing 100 μm of ol/L AS and carry out subculture,
Per hour with the OD values of ultraviolet specrophotometer measurement Agrobacterium bacterium solution, Agrobacterium growth curve is drawn.
1.2 transformation experiment using Nuo Ligen as explant
Using the beautiful seedling of sterile promise of 30 d of subculture as material, its root is cut into the segment of 0.5 cm or so, is put into and is trained containing MS liquid
In the culture dish for supporting base, explant was slightly covered, 3 d of preculture under the conditions of the shaking table of 120 r/min, natural lighting.Then
It is put into culture 8-9 h, OD60020 min are soaked in the bacterium solution of ≈ 0.5, during which constantly gently shake bottle.Taken out after immersion
Material, bacterium solution is blotted with aseptic filter paper, is placed on the co-cultivation base containing 100 μm of ol/L AS after 3 d of light culture, use is sterile
Distilled water flushing 5-8 times, then explant is put into the distilled water containing 200 mg/L Cef and soaks 20 min, during which jog is several
It is secondary, take out, and with aseptic filter paper suck dry moisture, be inoculated in+15 mg/L Kan+200 of+1.5 mg/L 6-BA of 3 % MS
In mg/L Cef resistance screening cultures, screening and culturing is carried out, counts explant resistance inductivity.Resistance inductivity=（Differentiation
The explant Shuo ∕ inoculation explant numbers of resistant buds）×100 %.
2 identifications without the beautiful transformant of seed promise
2.1 quickly screen the transformant with marker gene using Kan
It will break up to the resistant buds of 1 cm high, be forwarded in the screening and culturing medium containing 15 mg/L Kan, observation resistant buds growth feelings
Condition, statistics resistant buds pollution number, resistant buds albefaction number, transformant obtain number.
2.2 are used for the DNA extractions and PCR detections of PCR detections
Clip kanamycins filters out the blade with marker gene resistant buds, with Beijing Tiangeng Bioisystech Co., Ltd plant
Genome DNA extracting reagent kit extracts DNA, and carries out PCR detections.PCR reaction amplification gene fragment the primers are NptII
15 '-gct atg act ggg cac aac ag- 3 ' and 25 '-ata ccg taa agc acg agg aa- 3 ' of NptII.
It is positive control with plasmid pCAMBIA 1305.1, using the beautiful genomic DNA of wild type promise as negative control.PCR reaction systems are
20 µL：ddH2O 12.8 μ L, dNTP 2 μ L, Buffe（Mg2+）2 11 21 μ L of μ L, NptII of μ L, NptII, Taq enzyme
0.2 1 μ L of μ L, DNA.Response procedures are：95 DEG C of pre-degenerations 3 min, 94 DEG C of denaturation 30 s, 62.8 DEG C of 45 s that anneal, 72
DEG C extension 2 min, 35 circulation, 72 DEG C extension 5 min.5 μ L pcr amplification products are taken to carry out electricity in 1 % Ago-Gels
Swimming detects and takes photograph and count positive strain transformation frequency.Positive strain transformation frequency=（Positive plant Ge Shuo ∕ detection sums）×
100 %。
2.3 treat the digestion of the beautiful genomic DNA of transgenosis promise of Southern hybridization
After carrying out the extraction of DNA respectively to the beautiful plant of 8 transgenosis promises and 1 beautiful plant of wild type promise, in endonuclease reaction system
In (table 1), endonuclease reaction is carried out with EcoRI.Restriction endonuclease for the first time plus 10 μ l, gentle agitation, at a temperature of 37 DEG C digestion disappear
Change 2h, add 10 μ l, gentle agitation, 37 DEG C of digestions are overnight（About 16h）, next day adds 10 μ l, the reaction was continued 4h.Enzyme
After the completion of cutting 50 μ l deionized waters are dissolved in isometric phenol and chloroform recovery DNA, product.5 μ l are respectively taken to digestion sample, carry out 1%
Agarose gel electrophoresis detects.By agarose gel electrophoresis of the genome DNA sample prepared 0.7%, 25V, 4 DEG C
Electrophoresed overnight under the conditions of constant pressure constant temperature.
1 genomic DNA digestion system of table
Table 1 Genomic DNA digestion system
2.4 plasmid enzyme restriction
DNA plasmid is extracted, in plasmid enzyme restriction system（Table 2）After 37 DEG C of 2 h of digestion, 5 μ l are taken, carry out 1% Ago-Gel electricity
Swimming, to the plasmid after digestion recycle stand-by using agarose gel purification QIAquick Gel Extraction Kit.
2 plasmid enzyme restriction system of table
Table 2 Plasmid digestion system
The preparation of 2.5 Southern hybridization probes and electrophoresis detection
The synthesis of probe is with reference to digoxin hybridization check kit II (chemoluminescence method).With NPTII-F: 5’
GCTATGACTGGGCACAACAG3 ' and NPTII-R:5 ' ATACCGTAAAGCACGAGGAA 3 ' are used as upper and lower primer, anti-in PCR
Answer and expanded in system (table 3)；The amplification reaction condition of PCR is 94 DEG C of pre-degeneration 5min, then 94 DEG C denaturation 30s, 55 DEG C
Cool down 30s, and 72 DEG C extend 45s, and 35 circulations are carried out from be denatured to extending, and finally in 72 DEG C of whole extension 7min, is preserved at 4 DEG C.
1% agarose gel electrophoresis analysis is carried out to the PCR product after mark.
3 PCR reaction systems of table
Table 3 PCR reaction system
2.6 Southern hybridize
Transferring film and fixation：Gel is placed in plate, with distilled water flushing once after, add 3 times of volumes denaturing liquid room temperature shake
Swing 45 min denaturation, and with distilled water flushing 2 times.DNA gel after denaturing adds 2 × 15 min of neutralizer shaken at room temperature,
With distilled water flushing 2 times.2 × SSC solution is added with balanced gel and positively charged 5 min of nylon membrane, using upward capillary
Tube method carries out 20 h of transferring film.Film is removed after transferring film and performs mark, is rinsed in 2 × SSC solution once, is placed in 80 DEG C of baking boxes
2 h are fixed in baking.Hybridization：(1) prehybridization：10.0 ml Hyb-100 are taken, are added in hybrid pipe, 37 DEG C of 2 h of preheating prehybridization.
(2) probe is denatured：Probe is denatured 10 min in PCR instrument under the conditions of 100 DEG C, it is cold that the probe after taking-up denaturation puts ice-water bath immediately
But 5 min, this can reduce the loss [14] of probe to a certain extent.(3) hybridize：In 10 ml Hyb-100 of preheating
The probe that 20 μ l are newly denatured is added, is gently mixed uniformly, 37 DEG C of hybridized overnights.
2.7 wash film and signal detection
After hybridization at room temperature, 2 × 5 min of film is washed with 2 × SSC/0.1%SDS of 20ml.Afterwards again at 65 DEG C, 20 ml 1 ×
SSC/0.1%SDS washs 2 × 15 min.Film is placed in 20 ml lavation buffer solutions again and balances 2-5 min.Film is sealed in 10 ml
Close in liquid and close 30 min（Gently shaken on shaking table）.After Anti-Dig-AP centrifuges 5 min centrifugations under 10000 r/min
Anti-Dig-AP is diluted into (1: 5000) with confining liquid, the mixing of 10 ml confining liquids is added in 2.0 μ l Anti-Dig-AP.
Confining liquid is poured out after the completion of closing, adds the 10 ml antibody-solutions diluted, leaching film at least 30 min.Antibody-solutions are removed, are used
20 ml lavation buffer solutions slowly wash film 2 times, every time 15 min.In film front（Nucleic acid face）The CSPD of 1 ml is added dropwise, isolation is empty
15-25 DEG C of 5 min of reaction of gas, remove unnecessary liquid, 37 DEG C of 10 min of incubation.Machine exposes and records experimental result.
The result of the present invention and analysis
1 acquisition without the beautiful transformant of seed promise
1.1 EHA105 Agrobacterium growth curves
Agrobacterium tumefaciems is in 6 h of subculture, OD600Less than 0.19, cell division is slow, and Bacterial Physiological activity is weak；7 h start
Into exponential phase（Fig. 2）.OD600For 0.5 or so when, bacterium start at a high speed breed, bacterial cell number rises rapidly, invades
Contaminate energetic, therefore follow-up study chooses the Agrobacterium bacterium solution of subculture 8-9 h and is used to infect explant.
1.2 carry out resistant buds differentiation by explant of Nuo Ligen
Using the root of the beautiful aseptic seedling of promise as explant, multiple transformation experiment the results show is carried out：Explant is 20 on screening and culturing medium
D or so differentiates callus, these callus parts differentiate white bud point（Fig. 3）, and another part dissolve it is light green
Color resistance bud point (Fig. 4), resistance seedling (Fig. 5) was formed at follow-up 20 days or so.
Final to induce 225 plants of resistant buds, resistant buds average mark rate is 56.25%.
2 identifications without the beautiful transformant of seed promise
2.1 quickly screen the transformant with marker gene using kanamycins
The resistant buds differentiated on callus are transferred in time on fresh resistance culture base and continue kanamycins sieve
, when cultivating 8 d or so, there is the phenomenon covered by Agrobacterium in choosing around the explant of part, and in 30 d left-right parts explants
There is albinism in body, and another part is subsequently gradually being differentiated to form intact plant.The results show that in 225 plants of resistance seedlings,
59, albefaction 73 are polluted, obtains green seedling 93.
The PCR detections of 2.2 transformants
The DNA for 93 transformants that kanamycins is filtered out carries out PCR amplification, and transfer-gen plant is amplifiable to obtain 750bp's
Specific amplification products（Fig. 6）, consistent with positive control amplification, negative control there is no specific amplification products.Will
The band amplified is sequenced, and sequencing result is the partial sequence of NptII genes.PCR test experiences the result shows that, 93 plants turn
There are 18 sun plants in beggar, conversion ratio is 8 %.
Note：Swimming lane M：DNA molecular amount standard Maker5000；Swimming lane 1-15：The PCR amplification result of transformant；Swimming lane 16：
Positive control；Swimming lane-：Negative control.
2.3 are used for the detection of the beautiful transformant genomic DNA of promise of Southern hybrid experiments and the enzyme of restriction enzyme
Cutting is analysed
DNA is shown after agarose gel electrophoresis（Fig. 7）, the master tape of DNA is clear, sharp, no hangover, and no RNA residuals, show institute
The DNA concentration of extraction is high, integrality is good.DNA after digestion is in uniform disperse shape（Fig. 8）, show that the digestion of genomic DNA is complete
Entirely, follow-up Southern hybrid experiments can be carried out.
2.4 plasmid enzyme restriction
The general linear, ring-type of the structure of plasmid and helical form before digestion, after carrying out restriction enzyme digestion and electrophoresis to plasmid, the results show
（Fig. 9）There are two traces on electrophoretogram before digestion, and the plasmid electrophoresis detection figure after digestion only has a trace, shows plasmid
Digestion is a kind of form, and digestion is abundant.
Swimming lane M：1Kb DNA Ladder swimming lanes 1：Plasmid swimming lane 2 before digestion：Plasmid after digestion
Line M：1Kb DNA Ladder Line 1：Plasmids before enzyme digestion Line 2：
Plasmids after enzyme digestion
2.5 label probe electrophoresis detections
1% agarose gel electrophoresis is carried out to the PCR product after mark, finds to be compared with the molecular weight of the DNA probe of dUTP marks
Molecular weight compared with comparison DNA increases obvious increase（Figure 10）, show that DNA probe marks successfully.
Swimming lane M：Trans 2K DNA Marker swimming lanes 1：The DNA probe swimming lane 2 of dUTP marks：The DNA fragmentation of control
Lane M：Trans 2K DNA Marker Lane 1：DUTP labeled DNA probe Lane 2：A
controlled DNA fragment
2.6 Southern results of hybridization
Probe mark hybridization is carried out to the nylon membrane after fixation, experimental result is respectively to expose 1h（Figure 11）, can with 3h (Figure 12)
To find out that the background of exposure 3h is deeper, and the background for exposing 1h is shallower, it is easier to it was observed that probe results of hybridization.The results show that
No seed gene has been incorporated into the beautiful chromosome of G9 promises, and copy number is one.
Swimming lane M：Lambda DNA/HindIII Marker；Road C forever：Positive plasmid；
Swimming lane 1-9 is respectively beautiful transgenic line G1, G3, G4, G5, G7, G8, G9, G10 and Nuo Li WT lines T of promise.
LineM:1Kb DNA Ladder Lane C：Positive plasmids Line1-9:noni transgenic lines
G1, G3, G4, G5, G7, G8, G9, G。
In addition, it is necessary to the it is clear that corresponding Chinese of initialism such as following table：
3%MS fluid nutrient mediums：
It is 5.8 to adjust pH value, adds 30 g/L of sucrose.In 121 DEG C of 20 min of sterilizing of high-pressure sterilizing pot.
YEB fluid nutrient mediums：
It is 7.2 to adjust pH value.In 121 DEG C of 20 min of sterilizing of high-pressure sterilizing pot.
YEB solid mediums：On the basis of YEB fluid nutrient mediums, 6.5 g/L agar powders are added.In high-pressure sterilizing pot 121
DEG C sterilizing 20 min.
The above, is only the part preferred embodiment of the present invention, and any those skilled in the art may profit
Equivalent technical solution is changed or is revised as with the technical solution of above-mentioned elaboration.Therefore, the technology according to the present invention
Any simple modification or substitute equivalents that scheme is carried out, belong to the greatest extent the scope of protection of present invention.
Claims (8)
1. a kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise, it is characterized in that：Comprise the following steps：
, will be without seed channel genes using agrobacterium tumefaciens-mediated transformation using the beautiful in vitro cuttings root segment of the promise of 30 d of subculture as explant
In the beautiful root segment of promise：The beautiful aseptic seedling root segment of promise shakes preculture 3d in 3%MS fluid nutrient mediums, through Agrobacterium tumefaciems bacterium solution, infects
20 min, on base is co-cultured after light culture 3d, are placed on resistance screening culture medium and cultivate 20 d, carry out screening and culturing, statistics
Explant resistance inductivity；
Agrobacterium tumefaciems bacterium solution, by cultivating 8-9 h, OD600≈0.5；
Co-culturing the proportioning of base is：3+100 μm of ol/L AS of % MS solid mediums, resistance screening culture medium use 3 % MS
+ 200 mg/L Cef of+15 mg/L Kan of the mg/L of solid medium+1.5 6-BA.
2. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 1, it is characterized in that：Subculture
Once, subculture medium is 3 %MS solid cultures to the every 30 d subcultures of tissue-cultured seedling that the beautiful in vitro cuttings root segment of promise of 30 d uses
The mg/L of base+0.2 NAA.
3. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 1, it is characterized in that：It is described
3 %MS solid mediums are on the basis of 3%MS fluid nutrient mediums, 6.5 g/L agar powders are added, in high-pressure sterilizing pot 121
DEG C sterilizing 20 min.
4. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 1, it is characterized in that：It is described
The culture of Agrobacterium tumefaciems comprises the following steps：
Agrobacterium tumefaciems bacterium solution is dipped with aseptic inoculation ring, line is dark after 28 DEG C of culture carton upside downs on YEB solid mediums
Culture is to growing single bacterium colony；Picking single bacterium colony is inoculated in YEB fluid nutrient mediums, 28 DEG C, 200 r/min shaking table cultures are to mixed
It is turbid, then take 1 mL bacterium solutions to add in the 50 ml YEB fluid nutrient mediums containing 100 μm of ol/L AS and carry out subculture, per small
When with ultraviolet specrophotometer measurement Agrobacterium bacterium solution OD values, drafting Agrobacterium growth curve.
5. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 4, it is characterized in that：It is described
YEB solid mediums：It is on the basis of YEB fluid nutrient mediums, 6.5 g/L agar powders is added, in high-pressure sterilizing pot 121
DEG C sterilizing 20 min.
6. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 4 or 5, it is characterized in that：
The YEB fluid nutrient mediums：Containing 50 mg/L Rif+50 mg/L Kan+100 μm ol/L AS.
7. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 1, it is characterized in that：Including
Following steps：
Using the beautiful seedling of sterile promise of 30 d of subculture as material, its root is cut into the segment of 0.5 cm, is put into containing MS fluid nutrient mediums
Culture dish in, slightly covered explant, 3 d of preculture under the conditions of the shaking table of 120 r/min, natural lighting；It is then placed in
Cultivate 8-9 h, OD60020 min are soaked in the Agrobacterium tumefaciems bacterium solution of ≈ 0.5, during which constantly gently shake bottle；Immersion terminates
After take out material, blot bacterium solution with aseptic filter paper, be placed on the co-cultivation base containing 100 μm of ol/L AS after light culture 3d, use
Sterile distilled water rinses 5-8 times, then explant is put into the distilled water containing 200 mg/L Cef and soaks 20 min, during which light
Shake several times, take out, and with aseptic filter paper suck dry moisture, be inoculated in+15 mg/L Kan of+1.5 mg/L 6-BA of 3 % MS+
On 200 mg/L Cef resistance screening culture mediums, screening and culturing is carried out, counts explant resistance inductivity.
8. the beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise according to claim 7, it is characterized in that：To system
The beautiful aseptic seedling root segment sample of promise after explant resistance inductivity is counted, is carried out with digoxin random primering label probe
Southern hybridization checks, the extraction digestion through the beautiful genomic DNA of promise, plasmid enzyme restriction, the preparation of probe, transferring film, hybridization step,
It was found that in the beautiful aseptic seedling root segment sample of promise of detection, the beautiful transgenic line G9 of promise has hybridising band, illustrates no seed gene success
It is inserted on G9 chromosomes, transgenosis success.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810005684.2A CN108004269A (en) | 2018-01-03 | 2018-01-03 | A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810005684.2A CN108004269A (en) | 2018-01-03 | 2018-01-03 | A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108004269A true CN108004269A (en) | 2018-05-08 |
Family
ID=62050119
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810005684.2A Pending CN108004269A (en) | 2018-01-03 | 2018-01-03 | A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004269A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102487825A (en) * | 2011-12-09 | 2012-06-13 | 西南林业大学 | Method for inducing Morinda citrifolia calluses and regenerating plants using root as explant |
| WO2013078319A1 (en) * | 2011-11-22 | 2013-05-30 | Seminis Vegetable Seeds, Inc. | Seedless pepper plants |
| CN107254478A (en) * | 2017-06-23 | 2017-10-17 | 山西大学 | Tomato SLLCD genes and its application |
-
2018
- 2018-01-03 CN CN201810005684.2A patent/CN108004269A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013078319A1 (en) * | 2011-11-22 | 2013-05-30 | Seminis Vegetable Seeds, Inc. | Seedless pepper plants |
| CN102487825A (en) * | 2011-12-09 | 2012-06-13 | 西南林业大学 | Method for inducing Morinda citrifolia calluses and regenerating plants using root as explant |
| CN107254478A (en) * | 2017-06-23 | 2017-10-17 | 山西大学 | Tomato SLLCD genes and its application |
Non-Patent Citations (1)
| Title |
|---|
| 陈桂敏等: "转Barnase基因无籽植物的研究", 《农业生物技术学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101457235B (en) | Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation | |
| CN100415890C (en) | Method for regeration of citrus internode stem and genetic transformation | |
| CN103966258A (en) | Agrobacterium tumefaciens mediated cabbage type oilseed rape genetic transformation method | |
| CN103444524B (en) | Method for quickly building genetic transformation regeneration system of grapes | |
| CN104561089B (en) | A kind of breeding method of Transgenic melon tissue-cultured seedling and application | |
| CN102586317B (en) | Method for transforming and cultivating citrus transgenic plant by agrobacterium-mediated leaf | |
| WO2023005160A1 (en) | Method for genetic transformation of gramineous plants | |
| CN111876439B (en) | High-efficiency genetic transformation method for agrobacterium-mediated vacuum infection of pigeon pea | |
| CN111635904B (en) | Gene CsWRKY10 for enhancing cucumber target spot disease resistance and application thereof | |
| CN115011634B (en) | Genetic transformation method for promoting wild jujube callus to form adventitious buds by using phytoplasma effector SJP 1and SJP2 | |
| CN104726489B (en) | The method that agriculture bacillus mediated live body rataria conversion obtains transgene cotton | |
| CN104263752A (en) | Transgenic method for adult orange stem | |
| CN110305894A (en) | A kind of Chinese catalpa genetic transforming method rapidly and efficiently | |
| CN106811482A (en) | Pansy seed infusion method is introduced directly into the genetic transforming method of foreign gene | |
| CN105039391A (en) | Method of establishing genetic transformation of mature embryos of agrobacterium tumefaciens mediated Dongnong winter wheat No.1 | |
| CN113528535B (en) | Orphan gene PpDRO for improving stress resistance of plants and application thereof | |
| CN108004269A (en) | A kind of beautiful method of Agrobacterium tumefaciens mediated no seed genetic transformation promise | |
| US7026529B2 (en) | Methods for Agrobacterium-mediated transformation of dandelion | |
| CN107312794A (en) | Rose RrNUDX1 genes are changing the interim application of plant flowers | |
| CN103215307A (en) | Genetic transformation method of agrobacterium-induced plum blossom mature cotyledon regeneration system | |
| CN104017823A (en) | Screening method for fast and effectively reducing false positive rate of peanut genetic transformation plant | |
| CN115125267B (en) | Method for improving genetic transformation efficiency of oriental lily' Siberia | |
| Fukai et al. | Agrobacterium-mediated genetic transformation of chrysanthemum | |
| CN108277233A (en) | The method for inducing and cultivating of Mature Embryos of Rice callus | |
| AU2021107266A4 (en) | A method of vacuum infiltration assisting agrobacterium-mediated genetic transformation of sugarcane |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |