CN108004256A - Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application - Google Patents
Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application Download PDFInfo
- Publication number
- CN108004256A CN108004256A CN201711335811.7A CN201711335811A CN108004256A CN 108004256 A CN108004256 A CN 108004256A CN 201711335811 A CN201711335811 A CN 201711335811A CN 108004256 A CN108004256 A CN 108004256A
- Authority
- CN
- China
- Prior art keywords
- pichia pastoris
- glox
- glucose oxidase
- gene
- oxidase gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
- C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
- C12Y101/03—Oxidoreductases acting on the CH-OH group of donors (1.1) with a oxygen as acceptor (1.1.3)
- C12Y101/03004—Glucose oxidase (1.1.3.4)
Abstract
The invention belongs to the preparation of new gene and the structure of engineering bacteria, particularly relates to a kind of preparation, structure and the application of glucose oxidase gene Glox and pichia pastoris yeast.It is using 5 ￠ ends ATGAAGCTCCTTGGCCTCC and 3 ￠ ends CTAATTAACAGTAGCGTTGTAATC as special primer, using penicillium expansum DNA as template, glucose oxidase gene Glox is obtained using PCR amplification method, and successfully constructs pichia pastoris yeast engineering bacteria.The present invention solves the problems, such as that recombinating glucose oxidase gene at present carries out heterogenous expression, using present invention obtains the Glox genes of total length and its shuttle expression carrier of structure, Pichia pastoris X33 bacterial strains are further transformed into, one plant of bacterial strain compared with original strain higher secretion expression glucose oxidase is obtained through screening and identification.The method of the present invention is simple and practicable, of low cost, this haves laid a good foundation for glucose oxidase large-scale production.
Description
Technical field
The invention belongs to the preparation of new gene and the structure of engineering bacteria, a kind of glucose oxidase gene is particularly related to
Glox, albumen, pichia pastoris yeast and its preparation and application.
Background technology
Glucose oxidase is a kind of aerobic dehydrogenase, catalysis β-D-Glucose generation gluconic acid and mistake that can be single-minded
Hydrogen oxide.The catalysis characteristics of glucose oxidase makes it have the functions such as glucose, deoxidation, sterilization, and safe and non-toxic no pair
Effect, is to be allowed in the country one of enzyme preparation, processing and antistaling, medicine in food etc. is all widely used.
Glucose oxidase is distributed widely in animals and plants, in microbial body.Since mould enzymatic productivity is strong, currently used for grinding
Studying carefully and industrializing strain mainly has aspergillus niger and Penicillium bacterial strain, but in mold fermentation production glucose oxidase procedure, peroxide
The presence for changing a large amount of miscellaneous enzymes such as hydrogen enzyme, cellulase and amylase brings suitable difficulty to purifying.Penicillium expansum belongs to mould
One kind, equally exist the problem of such.Market increased the demand of glucose oxidase year by year in recent years, to quality requirement
Also improve year by year.So low output present in China's glucose oxidase technique level, enzyme activity is low, purification is cumbersome, enzyme activity inspection
The problems such as survey method is complicated is urgently to be resolved hurrily.
Restructuring glucose oxidase gene, which carries out heterogenous expression, can efficiently solve these problems.Especially Pichia pastoris table
Have the advantages that expression quantity is high, stability is good, toxigenic capacity is low and the easily separated purifying of product up to foreign protein, suitable for large volume height
Density is continuously fermented, and is had the advantages that strong and easily-controllable alcohol oxidase (Alcohol oxidase, AOX) promoter, can strictly be controlled
The expression of foreign gene processed.
Glucose oxidase is transformed by genetic engineering means and produces bacterial strain, obtains the production of grape carbohydrate oxidase precise and high efficiency
And extracting method, yield of enzyme is improved, guiding basis is provided for the industrialized production in later stage, improves its economic benefit.
Applicant discloses a kind of glucose oxidase in the application for a patent for invention of Application No. 201510893562.8
Gene GOD, utilize the albumen of its coding and the pichia yeast genetic engineering bacteria of conversion.Glucose oxidase gene GOD be with
5 ' end ATGAAGTCCACTATTATCACCTCCA and 3 ' end CTAGGCACTTTT GGCATAGTCTTCA are special primer, with point
Mould DNA is template, is obtained using PCR amplification method.The GOD genes of total length and its shuttle expression carrier of structure are obtained,
Pichia yeast genetic engineering bacteria is further transformed into, obtain one plant through screening and identification expresses glucose compared with original strain higher secretion
The bacterial strain of oxidizing ferment, the transgenic Pichia yeast engineering obtained, under 10L fermentation tank level testing conditions, methanol induction
144 it is small when, the enzyme activity in zymotic fluid reaches 594U/ml, significantly improves fermentation enzyme activity；And transformed by genetic engineering means
Glucose oxidase produces bacterial strain, can also obtain the production of grape carbohydrate oxidase precise and high efficiency, improves yield of enzyme (9g/L).It is above-mentioned
Problem existing in the prior art is that the widely used aspergillus niger of large-scale production of GOD or Penicillium notatum ferment, but aspergillus niger and mould
During bacterium fermenting and producing GOD, the presence of a large amount of foreign proteins such as catalase, cellulase and amylase brings phase to purifying
When big difficulty.Therefore, the heterologous high efficient expression of glucose oxidase is realized by building engineering bacteria, develops and produce high-quality
GOD preparations, be a both economical effective approach.
The documents of applicant's retrieval include：
1st, the heterogenous expression that starting strain does for the GOD of aspergillus niger in the patent document of Application No. CN105936910A,
But its enzyme activity expression is only 77U/ml.In addition it is mutated, and amino acid sequence has change, we only do gene order
Change, but amino acid sequence is consistent with original starting strain penicillium expansum.Its Pichia pastoris is recombinant yeast pichia pastoris
GS115, that we is X33.
2nd, bacterial strain used in the patent document of Application No. CN106591249A is aspergillus niger, the fermentation work to aspergillus niger
Skill optimizes, but in mold fermentation production glucose oxidase procedure, catalase, cellulase and amylase etc. are a large amount of
The presence of miscellaneous enzyme brings suitable difficulty to purifying.
3rd, the lifting in the patent document of Application No. CN105950577A to CN105936910A, does sequence above
Mutation so that enzyme heat stability increases.Fermentation enzyme activity is not referred to.
The content of the invention
It is an object of the present invention to provide a kind of glucose oxidase gene Glox.
The second object of the present invention is to provide a kind of preparation method of glucose oxidase gene Glox.
The third object of the present invention is to provide a kind of albumen encoded using glucose oxidase gene Glox.
The fourth object of the present invention be to provide a kind of Pasteur using glucose oxidase gene Glox conversions finish it is red
Yeast Pichia pastoris.
The fifth object of the present invention is to provide one kind using glucose oxidase gene Glox conversion Pichia pastoris genes
The method of engineering bacteria.
The overall technology of the present invention is conceived：
Glucose oxidase gene Glox, its gene order are SEQ ID No.1.
The preparation method of glucose oxidase gene Glox, is with 5 ' end ATGAAGCTCCTTGGCCTCC and 3 ' ends
CTAATTAACAGTAGCGTTGTAATC is special primer, using penicillium expansum DNA as template, is obtained using PCR amplification method.
The albumen encoded using glucose oxidase gene Glox, its sequence is SEQ ID No.2.
The pichia yeast genetic engineering bacteria converted using glucose oxidase gene Glox, its deposit number is CGMCC
No.13358。
Pichia yeast genetic engineering bacteria applicant in the present invention submits China Microbiological bacterium on November 30th, 2016
The common micro-organisms center preservation of kind of preservation administration committee, deposit number are CGMCC No.13358, the address of the preservation mechanism
Positioned at Yard 1, BeiChen xi Road, Chaoyang District, Beijing City 3 Institute of Microorganism, Academia Sinica, which is referred to as
CGMCC。
Utilize the preparation method of the pichia yeast genetic engineering bacteria of glucose oxidase gene Glox conversions, its preparation method
In step it is as follows：
A, primer is designed by PCR method to encode the signal peptide in the glucose oxidase gene sequence by penicillium expansum
Sequence removes, and primer sequence is as follows：Glox-F:5′GGCTGAAGCTTACGTAGAATTC CTTCCACAAGCTGACTTCGACC
3′；Restriction enzyme EcoRI recognition sites are added in underscore part for sense primer in sequence；Glox-R:5′
GAGATGAGTTTTTGTTCTAGAGCGGCCGCCTAATTAA CAGTAGCGTTGTAATC 3′；Underscore part is in sequence
Add restriction enzyme NotI recognition sites in downstream；
B, the purified recycling of PCR product is adopted GIBSON and is connected on EcoRI the and NotI sites of expression vector pMD-AOX,
E.coli DH5 α, digestion verification screening positive clone are transformed into, and send sequencing；
C, correct recombinant plasmid pMD-AOX-Glox is sequenced to linearize after PmeI digestions, pMD-AOX- is linearized with 2 μ g
Transformed cells, are then applied to by the electroporated 80 μ l Pichia pastoris Pichia pastoris X33 competent cells of Glox plasmids
On YPDS tablets containing 100 μ g/mlG418,30 DEG C of culture 96h；Obtain pichia pastoris yeast Pichia pastoris
CGMCC No.13358。
Pichia pastoris yeast Pichia pastoris CGMCC No.13358 answering in glucose oxidase is prepared
With.
The particular technique design of the present invention also has：
Pichia pastoris yeast Pichia pastoris CGMCC No.13358 answering in glucose oxidase is prepared
With comprising the technical steps that：
A, pichia pastoris yeast Pichia pastoris CGMCC No.13358 are inoculated in sterile YPD culture mediums
Cultivate 12-16h；
B, the strain transfer after step A is cultivated for 3% inoculum concentration by volume is trained in the sterile BMGY that volume is 100ml
Base is supported, Shaking culture is to OD under conditions of being 30 DEG C in temperature600≈6-7；
Strain after culture in step B is inoculated in the culture medium that fills sterile BSM according to 10% volume ratio C,
In fermentation tank, it is 30 DEG C, is cultivated under conditions of 550 revs/min of rotating speed, pH=5 to thalline OD in temperature600≈90；
D, stream adds 50% glycerine, and 12mLPTM1, flow acceleration 12mL/h/L are contained in every liter of glycerine, and temperature is 30 DEG C of bar
4h, OD are cultivated under part600≈ 150-170, stop feed supplement 0.5-1h, confirm glycerol depletion；
E, derivant methanol is added for 3.0mL-5.0mL/h/L streams according to flow acceleration, contains 12mLPTM1 in every liter of methanol,
PH maintains 6.0-6.5 with ammonium hydroxide, and enzyme activity is measured by sampling when 12 is small, the stuck fermentation when the flex point declined occurs in enzyme activity.
Substantive distinguishing features and significant technological progress acquired by the present invention are：
1st, the present invention obtains the Glox gene orders of a total length by round pcr, which is 1815bp, GC
Content is 47.6%.The gene homology of the homogeneous assays gene and the GOD of conventional report are 94.71%, it was demonstrated that should
Gene is a new glucose oxidase gene.
2nd, during traditional Penicillium notatum fermenting and producing GOD, do not only exist and be mingled with a large amount of catalases, cellulase and shallow lake
The problem of miscellaneous enzyme such as powder enzyme, hardly possible purifying.The transgenic Pichia yeast engineering obtained using the present invention can realize glucose
The heterologous high efficient expression of oxidizing ferment, and Pichia anomala expression foreign protein is with stability is good, toxigenic capacity is low and product is easy
The advantages that isolating and purifying.
3rd, being tested through applicant confirms, the transgenic Pichia yeast engineering that the present invention is obtained is in 10L ferment tanks
Enzyme activity reaches 305U/mL, and band is single, obtains the production of grape carbohydrate oxidase precise and high efficiency, greatly reduces post processing
Cost, provides guiding basis for the industrialized production in later stage, greatly improves economic benefit.
Brief description of the drawings
The attached drawing of the present invention has：
Fig. 1 is the sequence table of glucose oxidase gene Glox and the albumen using its coding in the present invention.
Fig. 2 penicillium expansum Glox full length gene results.
Using penicillium expansum genomic DNA as template, design special primer carries out PCR amplification, and amplification occurs one and is less than
The specific band of 2000bp, sequence analysis show piece segment length 1815bp.M is DNA Marker, and molecular weight is from big to small successively
For 10000bp, 5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp；1 is Glox
Gene amplification product.
Fig. 3 is expression plasmid pMD-AOX-GLOX double digestion testing results.
PCR amplification will be carried out through primer Glox-F and Glox-R and purify the penicillium expansum Glox genes and process of recycling
The carrier pMD-AOX of EcoRI with NotI double digestions carries out Gibson and connects with construction recombination plasmid.Experienced with recombinant plasmid transformed
State bacillus coli DH 5 alpha, and positive bacterium colony is screened on the LB tablets containing Amp.Positive bacterium colony plasmid is through the double enzymes of EcoRI and NotI
After cutting, two DNA fragmentations of about 6.5.0kb and 1.8kb are obtained, are also consistent with expected size.M is DNA Marker in figure, point
Son amount is followed successively by 10000bp, 8000bp, 6000bp, 5000bp, 4000bp, 3000bp, 2000bp, 1000bp, 1- from big to small
6 be expression plasmid pMD-AOX-Glox double digestion products.
Fig. 4 is the SDS-PAGE testing results of expression of the glucose oxidase in YPCS.
After the expression plasmid pMD-AOX-Glox of restructuring is linearized after PmeI digestions, electricity conversion Pichia pastoris X33 senses
By state, after YPDS plated growths 3d, positive bacterium colony switching liquid YPCS, after methanol induction 72h, measure fermentation are selected at random
Glucose oxidase activity in liquid supernatant, while fermented liquid supernatant liquid does protein s DS-PAGE electrophoresis, it is seen that a dense dye
About 80kD protein band, almost without remaining miscellaneous band.Marker is albumen Marker in figure, and molecular weight is from big to small successively
It is 220kD, 135kD, 90kD, 66kD, 45kD, 35kD, 29kD, 20kD, 14kD, 1-3 is that fermented supernatant fluid dilutes 10 times, 4-6
It is that fermented supernatant fluid dilutes 5 times.
Fig. 5 is expression SDS-PAGE testing result of the glucose oxidase in 10L fermentation tanks.
In 10L fermentation tanks, before methanol does not induce, in strain culturing and carbon source feeding period, in the two ranks
In section, thalline largely increases, the expression at this time without glucose oxidase albumen.With the induction of methanol, the grape in zymotic fluid
Sugar oxidase activity gradually increases, and it is 305U/ml to induce after 144h in zymotic fluid glucose oxidase activity, protein expression amount
Reach 5.2g, SDS-PAGE shows that glucose oxidase expressing quantity is also constantly accumulating in zymotic fluid at the same time.M is egg in figure
White Marker, 1-14 be through methanol induction 0h, 24h, 36h, 48h, 60h, 72h, 84h, 96h, 108h, 120h, 132h, 144h,
156h, 168h glucose oxidase expression quantity.
Embodiment
The embodiment of the present invention is further described below in conjunction with attached drawing, but it is not as a limitation of the invention.This hair
Bright protection domain is subject to the content of claim record, and any equivalent technical elements made according to specification are replaced,
The protection category of the present invention is not departed from.
The structure of 1 recombinant bacterium of embodiment and identification
The previously stored penicillium expansum Penicillium expansum CICC 40658 in laboratory are chosen, obtain enzyme activity
Stable and higher bacterial strain, designs primer by masterplate of the gene of this bacterial strain, obtains gene Glox.By PCR product after purification
It is connected using Gibson methods with shuttle vector pMD-AOX, bacillus coli DH 5 alpha competent cell, picking is converted after the completion of connection
The white positive colony bacterium on tablet is converted, obtains the recombinant expression plasmid pMD-AOX-Glox containing Glox genes.With double enzymes
Cut into capable verification.
By the electroporated Pichia pastoris X33 competent cells of recombinant plasmid pMD-AOX-Glox, gene is obtained
Engineering bacteria Pichia pastoris X33-Glox.
The conversion of Pichia pastoris uses electrotransformation：X33 line overnight incubations are taken, picking single bacterium falls within 5mL on tablet
Cultivated in YPD to OD600≈ 1.2, is then forwarded in 50mL YPD shaking flasks according to 10% inoculum concentration, cultivates to OD600≈
1.5；2500rpm centrifuges 5min, abandons supernatant；By the thalline being collected into 100mL 0.1M LiAc, 100M DTT, 0.6M sorbs
Alcohol, 10mM Tris-Hcl (pH=7.5) are resuspended, in 30 DEG C of low speed culture 30min；2500rpm centrifuges 5min and abandons supernatant again,
Washed 3 times, be resuspended in 1.5mLBEDS repeatedly with the sorbierite of 1M precoolings.80 μ L protoplasts and 5 μ L linearization plasmids DNA
(SacI is cut) mixes, and is transferred to ice-cold electric revolving cup, places 5 minutes；Shock by electricity cell and mixture (1.5kv, the 3.0- of DNA
4.9ms)；The recombinant bacterium converted is added into 1M sorbierites, 30 DEG C of standing 2-5h；Subsequent 5000rpm centrifugations 2min, uses physiology salt
Water is washed 3 times repeatedly, is coated on solid YPDS (containing G418) culture medium.30 DEG C of culture 72h picking single bacterium colonies, acquisition Pasteur are finished red
Yeast Pichia pastoris CGMCC No.13358.
The enzyme activity determination and protein electrophoresis of 2 recombinant bacterium of embodiment
Using the pichia pastoris yeast Pichia pastoris CGMCC No.13358 that embodiment 1 obtains as production bacterium,
Cultivated after activation under the conditions of 30 DEG C, 200rpm to OD600The seed culture fluid of ≈ 1.2 is transferred to YPCS cultures with 2% inoculum concentration
Base, is cultivated under the conditions of 30 DEG C, 200rpm；Cultivated in YPCS culture mediums to OD600During ≈ 1.2, yeast cells is transferred to YPCS
Inducing culture, adds 1% methanol continuous induction expression 72h daily.
Culture medium
Seed and slant medium are YPD culture mediums：Tryptone 2%, yeast extract 1%, glucose 2%；Inclined-plane
Culture medium adds agar 2%.
YPCS culture mediums：Tryptone 2%, yeast extract 1%, casein hydrolysate 2%, sorbierite 0.5%.
The protein band that one molecular size range as shown in Figure 4 is about 80kDa is obtained by protein electrophoresis (SDS-PAGE).
Glucose oxidase enzyme activity determination method：Glucose oxidase activity measure is generally using adjacent (two) anisidine
Spectrophotometry.In the reaction system of 3mL, comprising 0.5mol/L acetate buffer solutions (pH=5.1), the adjacent connection fennels of 0.17mmol/L
Fragrant amine aqueous solution and 1.72% glucose solution and 0.1mg/mL horseradish peroxidases, 35 DEG C of concussions mix, and add 0.1mL grapes
Oxidase solution, with spectrophotometer, the absorbance changed over time is recorded in A=500nm, according to formula X=automatically
(Δ A500 × 3.1 × df)/(7.5 × 0.1), calculate activity of glucose oxidase unit.
X：Sample enzyme activity (U/mL)；
Δ A500 is activity value；
3.1：Reaction volume；
Df is extension rate；
7.5：Gluconolactone A500 extinction coefficients；
0.1：Add enzyme liquid volume.
The verification of 3 recombinant bacterial strain of embodiment enzyme activity on 10L fermentation tanks
A, pichia pastoris yeast Pichia pastoris CGMCC No.13358 are inoculated in sterile YPD culture mediums
Cultivate 12-16h；
B, the strain transfer after step A is cultivated for 3% inoculum concentration by volume is trained in the sterile BMGY that volume is 100mL
Base is supported, Shaking culture is to OD under conditions of being 30 DEG C in temperature600≈6-7；
Strain after culture in step B is inoculated in the culture medium that fills sterile BSM according to 10% volume ratio C,
In fermentation tank, it is 30 DEG C, is cultivated under conditions of 550 revs/min of rotating speed, pH=5 to thalline OD in temperature600≈90；
D, stream adds 50% glycerine, and 12mLPTM1, flow acceleration 12mL/h/L are contained in every liter of glycerine, and temperature is 30 DEG C of bar
4h, OD are cultivated under part600≈ 150-170, stop feed supplement 0.5-1h, confirm glycerol depletion；
E, derivant methanol is added for 3.0mL-5.0mL/h/L streams according to flow acceleration, contains PTM1 in every liter of methanol
12mL, pH maintain 6.0-6.5 with ammonium hydroxide, and enzyme activity is measured by sampling when 12 is small, stop when the flex point declined occurs in enzyme activity
Fermentation.Enzyme activity of the recombinant bacterium on 10L fermentation tanks can reach 305U/mL.
Culture medium and reagent
BMGY culture mediums：Yeast extract 1%；Peptone 2%；Potassium phosphate pH6.0 100mM；YNB1.34%；Biotin
4 × 10-5%；Glycerine 1% or methanol 0.5%.
PTM1 (trace element)：Copper sulphate 6.0g/L；Sodium iodide 0.08g/L；Manganese sulfate 3.0g/L；Sodium molybdate 0.2g/L；
Boric acid 0.02g/L；Cobalt chloride 0.5g/L；Zinc chloride 20g/L；Ferrous sulfate 65g/L；Sulfuric acid 5.0mL/L；Biotin 0.2g/L；
VC80mg/L；VB20.5M。
BSM culture mediums：85%H3PO426.7mL/L；CaSO40.93g/L；K2SO418.2g/L；MgSO4·
7H2O14.9g/L；KOH 4.13g/L；Glycerine 40g/L；PTM14.35mL/L (filtration sterilization).
Sequence table
<110>Hebei Institute of Microbiology
Institute of Microorganism, Academia Sinica
<120>Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application
<130> 201510893562.8；CN105936910A；CN106591249A；CN105950577A
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1815
<212> DNA
<213> An artificial sequence
<400> 1
atgaagctcc ttggcctcct gtccgggctc gttgttgtag ccacggccct tccacaagct 60
gacttcgacc tgcaatcttc cctgctgact gacccaacca aggttgctgg taccactttc 120
gactacatca ttgccggtgg aggattgacc ggattgaccg tcgctgccag attgactgaa 180
aatcctaaca tcactgttct ggttatcgag cgtggttttt acgaatctaa cattggacca 240
attatcgaaa atttgaacca ctacggtgac atctttggaa cttccgtgga tcaagctttc 300
gaaaccattc cactggctat tcacaacaga actgagatcg ttagatcagg taagggtctg 360
ggtggttcca ccttggttaa cggaggatct tggactcgtc cacacaaggc tcaagttgac 420
tcctgggaat ctgttttcgg tatggaaggt tggaattggg attctttgtt gccatacatg 480
aagaagatcg aagccgctcg tgctccaaac gctgagcaga ttgccgctgg tcattactac 540
gatccatctt gtcacggaac cgatggtatc gtccatgttg gtccaagaga taccggagag 600
tccttctcac caatgattaa atctttgatg aagaacgcta ataactctgg tattcctgtc 660
caaaaagatt tgggatgtgg agttcctcac ggaatttcaa tgattttgaa tgacgtccac 720
gaggatcaaa ctagatccga tgctgctcgt gagtggcttc tgcctaacta ccagagatcc 780
aatcttaaga tcctgactgg acaaatggtt ggtaaggtgc tgtttgatac caccactact 840
actccaaaag ccgtcggtgt gaattttggt actcacgcca aggtcaactt cgacgtgcac 900
gctagacacg aagttttgct tgcttctggt tccgccgttt ctccacagat tctggagcat 960
tccggagttg gtcttaaggc tgtcctggat aacgtcggtg ttgaacagtt ggttgatctt 1020
ccagtcggtt tgaacctgca ggaccaaact actactaccg ttagatccaa cattaattct 1080
attggtgctg gacagggtca agctgcttac tttgccactt tcaacgaaac ctttggtgat 1140
caagctccac gtgctcatca gttgttgaac actaagctgg aggagtgggc taaggacgtt 1200
gtttctagag gtggtttcca caacgaaacc gctcttcttg tccagtacga gaactacaga 1260
gactggttgg ttaacgagga cgtctccttt gctgagattt tcatcgatac cgccggaaag 1320
ttgaatctgg acctgtggga tcttattcca tttactcgtg gatatgttca catcctggat 1380
tcagatccat atttgagaag attcgcctat gacccacagt tcttcctgaa cgagcttgac 1440
gttcttggtc aagccgctgc ctccaaactg gccagagaga tttccaacac cggtgaaatg 1500
acccaatatt tcaatggtga agccatccca ggtaataacc ttgcctacaa cgccactctt 1560
gacgactggg ttgatcacgt taagcagaac tttcgtgcta actaccatgg tgtcggaacc 1620
tgttccatga tgtctaagga gttgggtggt gttgttgacg ccgctgctcg tgtgtacggt 1680
gttgagtccc ttagagtcat cgatggttcc attcctccaa cccaactttc ttcccatgtt 1740
atgaccgtgt tttacggaat ggcccaaaaa gtttcagagg ccattttggc cgattacaac 1800
gctactgtta attag 1815
<210> 2
<211> 588
<212> PRT
<213> An artificial sequence
<400> 2
Leu Pro Gln Ala Asp Phe Asp Leu Gln Ser Ser Leu Leu Thr Asp Pro
1 5 10 15
Thr Lys Val Ala Gly Thr Thr Phe Asp Tyr Ile Ile Ala Gly Gly Gly
20 25 30
Leu Thr Gly Leu Thr Val Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile
35 40 45
Thr Val Leu Val Ile Glu Arg Gly Phe Tyr Glu Ser Asn Ile Gly Pro
50 55 60
Ile Ile Glu Asn Leu Asn His Tyr Gly Asp Ile Phe Gly Thr Ser Val
65 70 75 80
Asp Gln Ala Phe Glu Thr Ile Pro Leu Ala Ile His Asn Arg Thr Glu
85 90 95
Ile Val Arg Ser Gly Lys Gly Leu Gly Gly Ser Thr Leu Val Asn Gly
100 105 110
Gly Ser Trp Thr Arg Pro His Lys Ala Gln Val Asp Ser Trp Glu Ser
115 120 125
Val Phe Gly Met Glu Gly Trp Asn Trp Asp Ser Leu Leu Pro Tyr Met
130 135 140
Lys Lys Ile Glu Ala Ala Arg Ala Pro Asn Ala Glu Gln Ile Ala Ala
145 150 155 160
Gly His Tyr Tyr Asp Pro Ser Cys His Gly Thr Asp Gly Ile Val His
165 170 175
Val Gly Pro Arg Asp Thr Gly Glu Ser Phe Ser Pro Met Ile Lys Ser
180 185 190
Leu Met Lys Asn Ala Asn Asn Ser Gly Ile Pro Val Gln Lys Asp Leu
195 200 205
Gly Cys Gly Val Pro His Gly Ile Ser Met Ile Leu Asn Asp Val His
210 215 220
Glu Asp Gln Thr Arg Ser Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn
225 230 235 240
Tyr Gln Arg Ser Asn Leu Lys Ile Leu Thr Gly Gln Met Val Gly Lys
245 250 255
Val Leu Phe Asp Thr Thr Thr Thr Thr Pro Lys Ala Val Gly Val Asn
260 265 270
Phe Gly Thr His Ala Lys Val Asn Phe Asp Val His Ala Arg His Glu
275 280 285
Val Leu Leu Ala Ser Gly Ser Ala Val Ser Pro Gln Ile Leu Glu His
290 295 300
Ser Gly Val Gly Leu Lys Ala Val Leu Asp Asn Val Gly Val Glu Gln
305 310 315 320
Leu Val Asp Leu Pro Val Gly Leu Asn Leu Gln Asp Gln Thr Thr Thr
325 330 335
Thr Val Arg Ser Asn Ile Asn Ser Ile Gly Ala Gly Gln Gly Gln Ala
340 345 350
Ala Tyr Phe Ala Thr Phe Asn Glu Thr Phe Gly Asp Gln Ala Pro Arg
355 360 365
Ala His Gln Leu Leu Asn Thr Lys Leu Glu Glu Trp Ala Lys Asp Val
370 375 380
Val Ser Arg Gly Gly Phe His Asn Glu Thr Ala Leu Leu Val Gln Tyr
385 390 395 400
Glu Asn Tyr Arg Asp Trp Leu Val Asn Glu Asp Val Ser Phe Ala Glu
405 410 415
Ile Phe Ile Asp Thr Ala Gly Lys Leu Asn Leu Asp Leu Trp Asp Leu
420 425 430
Ile Pro Phe Thr Arg Gly Tyr Val His Ile Leu Asp Ser Asp Pro Tyr
435 440 445
Leu Arg Arg Phe Ala Tyr Asp Pro Gln Phe Phe Leu Asn Glu Leu Asp
450 455 460
Val Leu Gly Gln Ala Ala Ala Ser Lys Leu Ala Arg Glu Ile Ser Asn
465 470 475 480
Thr Gly Glu Met Thr Gln Tyr Phe Asn Gly Glu Ala Ile Pro Gly Asn
485 490 495
Asn Leu Ala Tyr Asn Ala Thr Leu Asp Asp Trp Val Asp His Val Lys
500 505 510
Gln Asn Phe Arg Ala Asn Tyr His Gly Val Gly Thr Cys Ser Met Met
515 520 525
Ser Lys Glu Leu Gly Gly Val Val Asp Ala Ala Ala Arg Val Tyr Gly
530 535 540
Val Glu Ser Leu Arg Val Ile Asp Gly Ser Ile Pro Pro Thr Gln Leu
545 550 555 560
Ser Ser His Val Met Thr Val Phe Tyr Gly Met Ala Gln Lys Val Ser
565 570 575
Glu Ala Ile Leu Ala Asp Tyr Asn Ala Thr Val Asn
580 585
Claims (7)
1. glucose oxidase gene Glox, it is characterised in that its gene order is SEQ ID No.1.
2. the preparation method of glucose oxidase gene Glox, it is characterised in that be with 5 ' end ATGAAGCTCC TTGGCCTCC and
3 ' end CTAATTAACAGTAGCGTTGTAATC are special primer, using penicillium expansum DNA as template, are obtained using PCR amplification method
.
3. utilize the albumen of glucose oxidase gene Glox codings, it is characterised in that its sequence is SEQ ID No.2.
4. utilize the pichia pastoris yeast Pichia pastoris of glucose oxidase gene Glox conversions, it is characterised in that
Its deposit number is CGMCC No.13358.
5. the preparation method of pichia pastoris yeast Pichia pastoris according to claim 4, it is characterised in that adopt
Prepare with the following method：
A, primer is designed by the grape glycosyloxy of penicillium expansum Penicillium expansum CICC 40658 by PCR method
The signal coding sequence changed in enzyme gene sequence removes, and primer sequence is as follows：
Glox-F:5 ' GGCTGAAGCTTACGTAGAATTCCTTCCACAAGCTGACTTCGACC3 ', underscore part in sequence
Restriction enzyme EcoRI recognition sites are added for sense primer；Glox-R:5′
GAGATGAGTTTTTGTTCTAGAGCGGCCGCCTAATTAACAGTAGCGTTGTAATC3 ', under underscore part is in sequence
Trip addition restriction enzyme NotI recognition sites；
B, the purified recycling of PCR product is adopted GIBSON and is connected on EcoRI the and NotI sites of expression vector pMD-AOX, converts
To E.coli DH5 α, digestion verification screening positive clone, and send sequencing；
C, correct recombinant plasmid pMD-AOX-Glox is sequenced to linearize after PmeI digestions, pMD-AOX-Glox is linearized with 2 μ g
Transformed cells, are then applied to containing 100 by the electroporated 80 μ l Pichia pastoris Pichia pastoris X33 competent cells of plasmid
On the YPDS tablets of μ g/mlG418,30 DEG C of culture 72h；Obtain pichia pastoris yeast Pichia pastoris CGMCC
No.13358。
6. pichia pastoris yeast Pichia pastoris according to claim 4 are in glucose oxidase is prepared
Using.
7. application according to claim 6, it is characterised in that comprise the technical steps that：
A, pichia pastoris yeast Pichia pastoris CGMCC No.13358 are inoculated in sterile YPD medium cultures
12-16h；
B, the strain transfer after step A is cultivated for 3% inoculum concentration by volume is cultivated in the sterile BMGY that volume is 100ml
Base, Shaking culture is to OD under conditions of being 30 DEG C in temperature600≈6-7；
C, the nutrient solution in step B is inoculated in the fermentation tank for the culture medium for filling sterile BSM according to 10% volume ratio,
Temperature is 30 DEG C, is cultivated under conditions of 550 revs/min of rotating speed, pH=5 to thalline OD600≈90；
D, stream adds 50% glycerine, 12mLPTM1, flow acceleration 12mL/h/L is contained in every liter of glycerine, under conditions of temperature is 30 DEG C
Cultivate 4h, OD600≈ 150-170, stop feed supplement 0.5-1h, confirm glycerol depletion；
E, derivant methanol is added for 3.0mL-5.0mL/h/L streams according to flow acceleration, 12mLPTM1 is contained in every liter of methanol, pH is used
Ammonium hydroxide maintains 6.0-6.5, and enzyme activity is measured by sampling when 12 is small, the stuck fermentation when the flex point declined occurs in enzyme activity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711335811.7A CN108004256A (en) | 2017-12-14 | 2017-12-14 | Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711335811.7A CN108004256A (en) | 2017-12-14 | 2017-12-14 | Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108004256A true CN108004256A (en) | 2018-05-08 |
Family
ID=62059112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711335811.7A Pending CN108004256A (en) | 2017-12-14 | 2017-12-14 | Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108004256A (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110894219A (en) * | 2019-12-26 | 2020-03-20 | 河北省微生物研究所 | Pichia pastoris transcription factor HAC1, protein, pichia pastoris and preparation and application thereof |
| CN111334538A (en) * | 2020-03-20 | 2020-06-26 | 鄂州职业大学 | Method for producing gluconic acid by strengthening penicillium funiculosum fermentation glucose |
| CN111718862A (en) * | 2019-03-20 | 2020-09-29 | 中国科学院天津工业生物技术研究所 | High-throughput pichia pastoris screening method based on droplet microfluidic chip |
| CN112961791A (en) * | 2021-02-24 | 2021-06-15 | 华南理工大学 | Recombinant strain of non-specific peroxygenase and construction method and application thereof |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925375A (en) * | 2012-09-19 | 2013-02-13 | 江南大学 | Engineered yeasts producing glucose oxidase and construction method and use thereof |
| CN105420252A (en) * | 2015-12-07 | 2016-03-23 | 河北省微生物研究所 | Glucose oxidase gene GOD, protein coded by GOD, pichia pastoris transformed by GOD and preparation method of pichia pastoris |
-
2017
- 2017-12-14 CN CN201711335811.7A patent/CN108004256A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925375A (en) * | 2012-09-19 | 2013-02-13 | 江南大学 | Engineered yeasts producing glucose oxidase and construction method and use thereof |
| CN105420252A (en) * | 2015-12-07 | 2016-03-23 | 河北省微生物研究所 | Glucose oxidase gene GOD, protein coded by GOD, pichia pastoris transformed by GOD and preparation method of pichia pastoris |
Non-Patent Citations (3)
| Title |
|---|
| BALLESTER,A.R.等: "Glucose-methanol-choline oxidoreductase [Penicillium expansum]", 《GENBANK》 * |
| ZHAOWEI GAO等: "High-level expression of the Penicillium notatum glucose", 《BIOTECHNOL LETT》 * |
| 邓华凤等: "《杂交水稻知识大全》", 30 September 2014, 中国科学技术出版社 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111718862A (en) * | 2019-03-20 | 2020-09-29 | 中国科学院天津工业生物技术研究所 | High-throughput pichia pastoris screening method based on droplet microfluidic chip |
| CN111718862B (en) * | 2019-03-20 | 2022-06-14 | 中国科学院天津工业生物技术研究所 | High-throughput pichia pastoris screening method based on droplet microfluidic chip |
| CN110894219A (en) * | 2019-12-26 | 2020-03-20 | 河北省微生物研究所 | Pichia pastoris transcription factor HAC1, protein, pichia pastoris and preparation and application thereof |
| CN111334538A (en) * | 2020-03-20 | 2020-06-26 | 鄂州职业大学 | Method for producing gluconic acid by strengthening penicillium funiculosum fermentation glucose |
| CN111334538B (en) * | 2020-03-20 | 2023-04-11 | 鄂州职业大学 | Method for producing gluconic acid by strengthening penicillium funiculosum fermentation glucose |
| CN112961791A (en) * | 2021-02-24 | 2021-06-15 | 华南理工大学 | Recombinant strain of non-specific peroxygenase and construction method and application thereof |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108004256A (en) | Glucose oxidase gene Glox, albumen, pichia pastoris yeast and its preparation and application | |
| CN104130951A (en) | Recombinant pichia pastoris engineering bacteria and metabolic recombinant xylanase as well as preparation of metabolic recombinant xylanase | |
| CN105420252A (en) | Glucose oxidase gene GOD, protein coded by GOD, pichia pastoris transformed by GOD and preparation method of pichia pastoris | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN110117602A (en) | Grifola frondosus UDP-glucose pyrophosphorylase and its application | |
| CN105176947A (en) | Inulase mutant and application thereof | |
| CN1325633C (en) | Glycerol channel protein gene deleted brewing microzyme strain capable of reducing glycerol output and increasing ethanol output and construction method thereof | |
| CN102994406A (en) | Genetically engineered bacterium for producing glucose oxidase as well as construction and application thereof | |
| CN102220369A (en) | Recombinant vector and recombinant bacterium of Trichoderma reesei beta-glucosaccharase gene BGL1, and expression of Trichoderma reesei beta-glucosaccharase gene BGL1 in recombinant bacterium | |
| CN101497866B (en) | Saccharomyces cerevisiae for producing low alcohol beer | |
| CN101550422B (en) | Beta-mannase coding gene and uses thereof | |
| CN100348720C (en) | Mannase and its coding gene and uses | |
| CN107058144A (en) | A kind of restructuring yeast strains for producing itaconic acid and its construction method and application | |
| CN101736023B (en) | Cellulose hydrolytic enzyme beta-1,4 glucose incision enzyme gene | |
| CN101560475A (en) | Uracil auxotroph Hansenula yeast, construction method thereof and application thereof | |
| CN101372693A (en) | Heat resisting cellulase gene, recombinant engineering bacterium, heat resisting cellulase and use | |
| CN111424048A (en) | Gene for expressing acidic β -mannase, vector and application thereof | |
| CN101307295A (en) | Pichia yeast engineering strain for expressing chaetomium thermophilum gene cbh3 | |
| CN108410903B (en) | The endo-xylanase and its encoding gene of a kind of resistance to low ph value and application | |
| CN102643842A (en) | Heat-resisting xylanase gene derived from actinomycetes (streptomyces rameus L2001) and product xylanase (Xyn A) thereof | |
| CN101906405A (en) | Cloning of inulin ftructotransferase and efficient expression thereof | |
| CN105062906B (en) | A kind of production method optimizing organophosphor hydrolytic enzyme Yeast engineering bacteria and its enzyme | |
| CN106148255A (en) | Engineering bacteria lacking organic acid production way and application thereof in co-production of 1, 3-propylene glycol, 2, 3-butanediol and ethanol | |
| CN1233826C (en) | Reformed lactase of Pichia pastoris and its application | |
| CN102827817B (en) | Thermotolerant glucoamylase GAI, its gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |