CN107976436B

CN107976436B - Copper high-salt-resistance nucleic acid sensor and application thereof

Info

Publication number: CN107976436B
Application number: CN201711024308.XA
Authority: CN
Inventors: 许文涛; 罗云波; 黄昆仑; 田晶晶; 杜再慧; 肖冰; 董凯
Original assignee: China Agricultural University
Current assignee: China Agricultural University
Priority date: 2017-10-27
Filing date: 2017-10-27
Publication date: 2021-04-06
Anticipated expiration: 2037-10-27
Also published as: CN107976436A

Abstract

The invention discloses a copper high-salt-resistance nucleic acid sensor and application thereof. The sensor comprises a molecular recognition element, a signal amplification element and a signal conversion element, wherein the molecular recognition element comprises copper ion deoxyribozyme; the copper ion deoxyribozyme consists of a substrate chain and a polymerase chain; the signal amplification element comprises an isothermal amplification system, and the isothermal amplification system comprises an amplification template; the signal conversion element comprises hemin and a color-developing agent. The sensor of the invention specifically identifies copper ions, and performs signal first-stage amplification and conversion through isothermal exponential amplification reaction; under the induction of hemin, active G-quadruplex structure is formed, and the color development of the color developing agent is catalyzed, so that secondary amplification and conversion are generated, and a visual signal is converted, and qualitative and quantitative detection in a high-salt environment can be performed.

Description

Copper high-salt-resistance nucleic acid sensor and application thereof

Technical Field

The invention belongs to the technical field of heavy metal detection, and particularly relates to a high-salt-resistance nucleic acid sensor for copper and application thereof. .

Background

Copper is a transition element, pure copper is a soft metal, has good ductility and high thermal and electrical conductivity, is the most common material in cables and electrical and electronic components, can be used as a building material, and can form a plurality of alloys. Pollution caused by copper (Cu) and its compounds in the environment is mainly generated by mining and smelting of copper-zinc ores, metal processing, machinery manufacturing, steel production and the like, wherein smoke dust discharged by smelting is a main source of atmospheric copper pollution.

Copper is an essential trace element for organisms, whether animals or plants. The amount of copper in normal humans is 100-200 mg, about 50-70% in muscle and bone, 20% in liver, and 5-10% distributed in the blood. Copper ions in a human body mainly serve as catalytic accessory factors or structural components of a plurality of enzymes and proteins (such as superoxide dismutase, cytochrome oxidase, dopamine beta-hydroxylase, tyrosinase, ceruloplasmin, prion protein and the like), are widely involved in a plurality of important metabolic processes in the body, influence the generation of blood, the formation of connective tissues, the central nervous system, the metabolism of cholesterol and glucose, the cardiac function, the immune system and the like of the human body, and the human body can maintain normal life activities only by trace copper.

However, a lack of copper or an excess of copper can have adverse health effects. Copper deficiency is generally accompanied by a deficiency in other nutrients or an excessive uptake of its biological antagonists, affecting the normal function of many enzymes in the cell and, in turn, the metabolic processes of the cell. Copper overdose is often caused by genetic diseases or by environmental heavy metal pollution, by mistaking large amounts of copper-containing food or by inhaling gases with high copper content. In food, copper is mainly in a divalent form and some organic substances, such as proteins, form complexes with amino acids and the like. When these complexes pass through the stomach, pepsin decomposes proteins, and gastric acid promotes the dissolution of copper ions, which are absorbed in the duodenum when passing through the small intestine, and finally transported to the liver. The liver is an important place for storing copper ions and is also an important organ for copper to enter bile, and the normal metabolism of liver and kidney is influenced by excessive copper, so that gastrointestinal dysfunction, hemolytic anemia and the like are caused; excessive copper ions, if deposited in the brain, heart, etc., can cause neurodegenerative diseases and systemic symptoms, including Wilson's syndrome and Alzheimer's disease.

The detection of copper ions is particularly important in view of the important role of copper ions in the living body and the huge harm to ecosystem, food safety and human health caused by the lack or excess of copper ions. Common detection methods for copper ions mainly include atomic spectroscopy, including atomic absorption spectroscopy, inductively coupled plasma emission spectroscopy, incineration spectroscopy, visible spectrophotometry, flow injection chemiluminescence, differential potential dissolution and the like, but these detection methods all require expensive instruments and specially trained operators, and sample pretreatment is complicated and has no general applicability. Therefore, it is necessary to develop a simple and rapid detection method with low cost and accurate quantification.

Disclosure of Invention

The invention solves the technical problem that in order to overcome the defects of the prior art, the invention provides the functional nucleic acid colorimetric sensor which can realize visual detection, is simple, convenient and quick, has high sensitivity and specificity and is high-salt-resistant.

The basic principle on which the invention is based is as follows: the copper ion deoxyribozyme consists of a substrate chain and a polymerase chain two oligonucleotide chains to form a specific secondary structure; the trace amount of copper ions can specifically recognize copper ion deoxyribozyme, combine ribozyme chain, activate ribozyme, cut ribozyme substrate chain and generate cut products. When the cleavage product exists, EXPAR generation and signal amplification are promoted, a large number of oligonucleotide sequences rich in guanine are generated, the sequences form a G-quadruplex structure under the induction of hemin, the activity of horseradish peroxidase (HRP) is exerted, hydrogen peroxide and tetramethyl benzidine are catalyzed to be green, and the sequences are yellow after the sulfuric acid termination reaction. Can be detected and quantified by a hand-held spectral detector.

In order to realize the purpose of the invention, the technical scheme of the invention is as follows:

the invention provides a copper high-salt-resistance nucleic acid sensor, which comprises a molecular recognition element, a signal amplification element and a signal conversion element,

the molecular recognition element comprises a copper ion deoxyribozyme; the copper ion deoxyribozyme consists of a substrate chain and a polymerase chain;

the signal amplification element comprises an isothermal amplification system, and the isothermal amplification system comprises an amplification template;

the signal conversion element comprises hemin and a color developing agent;

the deoxyribozyme substrate chain, the enzyme chain and the amplification template sequence are shown in the following table:

in the sensor, the isothermal amplification system comprises a system A and a system B;

the system A comprises: amplifying a template, dNTPs and a deoxyribozyme cleavage product;

the system B comprises: bst DNA polymerase and its buffer solution, nt.

The Bst DNA polymerase buffer solution was: 20mM Tris-HCl,10mM (NH)₄)₂SO₄,50mM KCl,2mM MgSO₄0.1% tween 20, 0.1% bovine serum albumin, pH 8.8;

BstNBI nicking endonuclease buffer solution is 100mM NaCl,50mM Tris-HCl and 10mM MgCl₂300. mu.g/ml trehalose, pH 7.9.

In the above sensor, the signal conversion element further comprises a terminator, preferably, the terminator is sulfuric acid (2 mol/L); the color developing agent is TMB color developing agent.

The sensor is applied to detecting copper ions.

The invention also provides a method for detecting copper ions, which comprises the following steps:

preparing a standard curve of the relation between the concentration of copper ions and the color development light density (OD value) of the G-quadruplex functional nucleic acid;

detecting a sample to be detected according to the process of preparing the standard curve to obtain a G-quadruplex functional nucleic acid chromogenic color light density value of the sample to be detected, and calculating the concentration of copper ions according to the standard curve;

wherein the step of preparing a standard curve relating the concentration of copper ions to the color density of the G-quadruplex functional nucleic acid comprises the following steps:

(1) preparation of copper ion deoxyribozyme cleavage product: mixing a copper ion deoxyribozyme substrate chain with a polymerase chain, heating and cooling to obtain copper ion deoxyribozyme, then adding copper ion solutions with different concentrations for reaction, and obtaining copper ion deoxyribozyme cleavage product solutions with different concentrations after terminating the reaction;

(2) isothermal amplification of target products:

the isothermal amplification system consists of a system A and a system B;

the A system comprises an amplification template, dNTPs and a copper ion deoxyribozyme cleavage product;

the system B comprises Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;

the sequences of the substrate chain, the enzyme chain and the amplification template of the protracted ribozyme are shown in the following table:

wherein GACTC in the amplification template is an Nt.BstNBI nicking endonuclease recognition sequence;

mixing the copper ion deoxyribozyme cleavage product solution with different concentrations with other component substances of the system A to prepare the system A with different copper ion concentrations, then mixing the system A with the system B respectively to carry out isothermal amplification reaction to obtain a series of amplification products with different concentrations;

(2) preparation of G-quadruplex structure color development substance

And (3) reacting hemin with the series of amplification products respectively, adding a developing solution, and detecting the OD value to obtain a standard curve of which the OD value changes along with the concentration of copper ions.

In the above method, the method for preparing the copper ion deoxyribozyme comprises: diluting the copper ion deoxyribozyme substrate chain and the copper ion deoxyribozyme chain by using buffer solution, heating at 95 ℃ for 15min, and then slowly cooling to 25 ℃.

In the above method, the isothermal amplification reaction comprises the steps of: incubating the system A added with the copper ion solution for 5min at 95 ℃ before carrying out isothermal amplification reaction, rapidly mixing the system A and the system B, and incubating and amplifying for 20min at 55 ℃; the reaction was stopped by holding at 95 ℃ for 10 min.

In the above method, the method for reacting hemin with the amplification product comprises: mixing hemin and amplification product, reacting at 37 deg.C for 30min, adding TMB color developing agent, mixing, reacting at 37 deg.C for 10min, and reacting at H₂SO₄The reaction was terminated.

The invention also provides a kit for detecting copper ions, which comprises: a copper ion deoxyribozyme system, an isothermal amplification system and a display system;

the copper ion deoxyribozyme system comprises a substrate chain, a polymerase chain and a copper ion standard solution;

the isothermal amplification system comprises an A system and a B system, wherein the A system comprises an amplification template and dNTPs;

the color development system comprises: hemin and a color developing agent, wherein the color developing agent is a TMB color developing agent.

In the above-mentioned kit, it is preferable that,

the A system comprises:

1 μ M amplification template stock: 6 μ L, final concentration 0.2 μ M;

3 mu L of 2.5mMdNTPs mother liquor;

the B system comprises:

8U/. mu.L Bst DNA polymerase stock: 0.1 μ L, final concentration 0.02U/μ L;

10 × polymerase reaction buffer solution stock (10 times amount): 3 μ L, final concentration 1 ×;

BstNBI nicking endonuclease mother liquor of 10U/. mu.L: 1.2 μ L, final concentration 0.37U/μ L;

bstnbi nicking endonuclease reaction buffer solution stock: 1.5 μ L, final concentration 0.5X.

The invention also provides a copper ion deoxyribozyme, which consists of a substrate chain and a polymerase chain;

the deoxyribozyme substrate chain and the enzyme chain sequence are shown in the following table:

the "amount of" or "x" in the present invention is a volume-equivalent amount unless otherwise specified.

The "final concentration" in the present invention is not particularly limited, and is a concentration in the total reaction system after mixing substances. For example, 6. mu.L of 1. mu.M amplification template mother solution with a final concentration of 0.2. mu.M refers to the concentration of the amplification template in the isothermal amplification system.

The invention has the advantages of

(1) The invention provides a copper functional nucleic acid sensor and a detection method, wherein a specific secondary structure is formed on the basis that copper ion deoxyribozyme consists of a substrate chain and a polymerase chain two oligonucleotide chain, trace copper ions can specifically recognize the copper ion deoxyribozyme and combine the ribozyme chain of the ribozyme, and the substrate chain of the ribozyme is activated and cut to generate a cut product. When the cleavage product exists, isothermal exponential amplification reaction (EXPAR) is promoted to occur, signal generation first-stage amplification and conversion are carried out, a large number of oligonucleotide sequences rich in guanine are generated, an active G-quadruplex structure is formed under the induction of hemin, hydrogen peroxide and tetramethyl benzidine are catalyzed to show green, and the reaction is stopped by sulfuric acid to show yellow, so that second-stage amplification and conversion are generated, a visual signal is converted, and qualitative judgment can be carried out.

(2) The sensor can carry out quantitative detection through signal amplification and conversion twice after signal conversion twice by the handheld spectrum detector, has high specificity and sensitivity, has rapid isothermal exponential amplification reaction, and can rapidly detect copper ions in a field environment.

(3) The sensor can resist the interference of high salt concentration, realizes the detection of copper ions in a high salt environment, can realize qualitative and quantitative analysis of the copper ions in the high salt environment, can keep higher specificity and sensitivity, and can detect trace copper ions.

Drawings

FIG. 1 is a polyacrylamide gel electrophoresis chart of the cleavage products of the prepared copper ion deoxyribozyme;

wherein the figures represent the columns: 1-Marker; lane 2-negative control: ribozyme substrate chain a; 3-negative control ii: ribozyme substrate chain A and ribozyme chain B, no copper ion; 4,5, 6-positive sample: copper chloride was added to the systems of both ribozyme substrate chain A and ribozyme chain B at a concentration of 10 nM.

FIG. 2 shows the result of isothermal amplification of the copper ion DNAzyme cleavage products;

wherein the figures represent the columns: 1-Marker; 2-amplifying the template; 3-positive sample: the product of isothermal amplification reaction of copper ion deoxyribozyme cleavage product; 4-Positive control: and amplifying the target product.

FIG. 3 is OD₄₅₀Standard curve of values as a function of copper ion concentration.

Detailed Description

The following examples facilitate a better understanding of the invention, but are not limited thereto. The equipment and reagents used in the examples were, except where specifically indicated, conventionally commercially available.

Example 1 preparation of copper ion deoxyribozyme and production of cleavage product

The substrate chain, the enzyme chain and the product of dnazyme cleavage designed for copper ions are shown below:

note: GACTC in the amplified template is an Nt.BstNBI nicking endonuclease recognition sequence, and four base pairs in the front of the sequence (between C and A) are synthetic strand cutting sites; the ribozyme cuts the target product and amplifies the target product and is fully complementary with the amplification template; the A-terminal TTGGGGGGT sequence of the ribozyme substrate strand is increased to increase the Tm value for binding to the amplification template D; the copper ion cleavage site follows the-G of ribozyme substrate strand A.

The preparation method of the copper ion deoxyribozyme comprises the following steps:

mu.L of 10. mu.M DNAzyme substrate chain stock solution and 4. mu.L of 10. mu.M DNAzyme enzyme chain stock solution buffer (final concentration of 50mM HEPES, 50mM NaCl, 5mM MgCl. RTM.) were added₂pH7.26) was diluted to 35. mu.L, heated at 95 ℃ for 15min, and then slowly brought to 25 ℃ for about 45min to obtain a copper ion deoxyribozyme solution.

mu.L of copper chloride solution (1. mu.M mother solution, dissolution solution 1M NaCl) was added to the above copper ion deoxyribozyme solution to form a 40. mu.L system, which was incubated at 25 ℃ for 6 minutes, and 5. mu.L of stop solution (concentration 0.2M EDTA, 2M NaCl,0.5M Tris) was added to the 40. mu.L system, and the mixture was mixed and stored at 4 ℃. And (3) verifying by using 20% denaturing polyacrylamide gel electrophoresis to obtain small fragments, namely cleavage products, of the copper ion ribozyme after cleavage, and proving that the preparation and the cleavage of the copper ion ribozyme are successful, as shown in FIG. 1.

Example 2 amplification of copper ion deoxyribozyme cleavage products

The system for isothermal amplification reaction consists of two parts (system A and system B). The amplification reaction system comprises: 30 μ L system.

The component A is 24.2 mu L system

Amplification template (1 μ M stock): 6 μ L (final concentration 0.2 μ M)

dNTPs (2.5mM stock solution) 3. mu.L

Cleavage product of copper ion deoxyribozyme (1 μ M): 6 μ L, final concentration 0.2 μ M

Ultrapure water: 9.2 μ L

And the component B comprises the following systems: 5.8 μ L

Bst DNA polymerase (8U/. mu.L stock): 0.1 μ L (final concentration 0.02U/. mu.L)

Polymerase reaction buffer (10 Xstock) 3. mu.L (final concentration 1X)

BstNBI nicking endonuclease (10U/. mu.L mother liquor): 1.2 μ L (final concentration 0.37U/. mu.L)

BstNBI nicking endonuclease reaction buffer (10 Xstock) 1.5. mu.L (final concentration 0.5X).

The mother solution of the polymerase reaction buffer solution is 20mM Tris-HCl,10mM (NH)₄)₂SO₄,50mM KCl,2mM MgSO₄0.1% tween 20, 0.1% bovine serum albumin, pH 8.8;

the mother solution of the reaction buffer solution of the Nt.BstNBI nicking endonuclease is 100mM NaCl,50mM Tris-HCl and 10mM MgCl₂300. mu.g/ml trehalose, pH 7.9.

Incubating the part A system at 95 ℃ for 5min before carrying out isothermal amplification reaction, rapidly mixing the part A system and the part B system, and incubating and amplifying at 55 ℃ for 20 min; the reaction was stopped by holding at 95 ℃ for 10 min. Then put at-20 ℃ for standby. The results of amplification of the isothermal amplification reaction using the copper ion dnazyme cleavage products were confirmed by 20% polyacrylamide gel electrophoresis, and as shown in fig. 2, amplification products appeared.

EXAMPLE 3 preparation of G-quadruplex functional nucleic acid colorimetric sensor

80 μ L of enzyme activity buffer (100mM Tris, 120mM NaCl, 10mM MgCl)₂100mM KCl, pH8.4), 10 mu L of hemin diluted solution (2 mu L hemin stock solution (10 mu M) is mixed with 1mL enzyme activity buffer solution) is mixed with 10 mu L substance to be developed (namely amplification product), the mixture is evenly mixed and reacts for 30min at 37 ℃ to ensure that the amplification product combines with hemin to form a G-quadruplex structure, 50 mu L TMB developing solution is added, the mixture is evenly mixed, the reaction is carried out for 10min at 37 ℃,50 mu L2M H is added₂SO₄And uniformly mixing to obtain a chromogenic product, thus obtaining the G-quadruplex functional nucleic acid chromogenic sensor.

Then an enzyme-linked immunosorbent assay is carried out to determine OD₄₅₀。

EXAMPLE 4 preparation of copper ion detection kit

A kit for detecting copper ions, comprising: a copper ion deoxyribozyme system, an isothermal amplification system and a color development system;

the method specifically comprises the following steps:

4 μ L of 10 μ M DNAzyme substrate chain stock;

4 u L10 u M DNAzyme chain mother liquor;

buffer (final concentration 50mM HEPES, 50mM NaCl, 5mM MgCl)₂，pH7.26)；

1 μ M copper chloride mother liquor (solution is 1M NaCl solution): when in use, 5 mu L of copper chloride solution with different concentrations is prepared;

stop solution (concentration 0.2M EDTA, 2M NaCl,0.5M Tris).

The isothermal amplification system comprises an A system and a B system.

The A system comprises:

amplification template (1 μ M stock): 6 μ L (final concentration 0.2 μ M)

dNTPs (2.5mM stock solution) 3. mu.L

The B system comprises:

Polymerase reaction buffer (10 Xstock) 3. mu.L (final concentration 1X)

The deoxyribozyme substrate chain, the enzyme chain and the amplification template sequence are shown in example 1.

The color development system comprises: 10 μ M hemin and TMB color reagent.

Example 5 detection of copper ions

1、OD₄₅₀Preparation of a Standard Curve whose value varies with the concentration of copper ions

In the copper ion deoxyribozyme system prepared according to the method in example 1, different volumes of copper ion chloride stock solution (dissolution solution is 1M NaCl solution) and water were added to form a 40. mu.L system in which the final concentrations of copper ions were 0nM, 10nM, 25nM, 50nM, 100nM, 150nM, 200nM, respectively, and the system was incubated at 25 ℃After 6 minutes, 5. mu.L of a stop solution (0.2M EDTA, 2M NaCl,0.5M Tris) was added to 40. mu.L of the system, mixed and stored at 4 ℃. Then, the OD corresponding to different copper ion concentrations was obtained according to the amplification method of the copper ion deoxyribozyme cleavage product in example 2 and the preparation method of the G-quadruplex functional nucleic acid colorimetric sensor in example 3₄₅₀Preparation of OD₄₅₀Standard curve as a function of copper ion concentration. The results are shown in FIG. 3, and the standard curve obtained is: y 0.0027x +0.0501, R²＝0.9925。

2. Detection of a sample to be tested

A copper ion deoxyribozyme system was prepared according to the method of example 1, a sample to be tested was added to form a 40. mu.L system, incubation was carried out at 25 ℃ for 6 minutes, and 5. mu.L of a stop solution (concentration: 0.2M EDTA, 2M NaCl,0.5M Tris) was added to the 40. mu.L system, and the mixture was mixed and stored at 4 ℃. Then, the OD of the product was measured by a microplate reader according to the method for amplifying the cleavage product of the copper ion deoxyribozyme in example 2 and the method for preparing the G-quadruplex functional nucleic acid colorimetric sensor in example 3₄₅₀. Determination of OD₄₅₀The value was 0.5431 and the standard curve y was taken to 0.0027X +0.0501, giving a copper ion concentration X182.5926 nM.

Claims

1. A copper high-salt-resistant nucleic acid sensor comprises a molecular recognition element, a signal amplification element and a signal conversion element,

the signal amplification element comprises an isothermal amplification system;

the signal conversion element comprises hemin and a color developing agent;

the isothermal amplification system comprises a system A and a system B;

the system B comprises: bst DNA polymerase and buffer solution thereof, Nt.BstNBI nicking endonuclease and buffer solution thereof;

the deoxyribozyme substrate chain sequence (5 '-3') is as follows:

AGCTTCTTTCTAATACGrGCTTACCTTGGGGGGTT，

the deoxyribozyme enzyme chain sequence (5 '-3') is:

GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC，

the amplification template sequence (5 '-3') is:

CCCTACCCGCCCTACCCAACTGACTCAACCCCCCAAGGTAAG。

2. the sensor of claim 1, wherein the signal conversion element further comprises a terminator, and the color-developing agent is a TMB color-developing agent.

3. The sensor of claim 2, wherein the terminating agent is sulfuric acid.

4. Use of a sensor according to any one of claims 1 to 3 for detecting copper ions.

5. A method for detecting copper ions is characterized by comprising the following steps:

preparing a standard curve of the relation between the concentration of copper ions and the color development light density of the G-quadruplex functional nucleic acid;

(2) isothermal amplification of target products:

the isothermal amplification system consists of a system A and a system B;

the deoxyribozyme substrate chain sequence (5 '-3') is as follows:

AGCTTCTTTCTAATACGrGCTTACCTTGGGGGGTT，

the deoxyribozyme enzyme chain sequence (5 '-3') is:

GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC，

the amplification template sequence (5 '-3') is:

CCCTACCCGCCCTACCCAACTGACTCAACCCCCCAAGGTAAG；

(3) preparation of G-quadruplex structure color development substance

6. The method according to claim 5, wherein the copper ion deoxyribozyme is prepared by a method comprising: diluting the copper ion deoxyribozyme substrate chain and the copper ion deoxyribozyme chain by using buffer solution, heating at 95 ℃ for 15min, and then slowly cooling to 25 ℃.

7. The method of claim 5, wherein the step of isothermal amplification reaction is: incubating the system A added with the copper ion solution for 5min at 95 ℃ before carrying out isothermal amplification reaction, rapidly mixing the system A and the system B, and incubating and amplifying for 20min at 55 ℃; the reaction was stopped by holding at 95 ℃ for 10 min.

8. The method of claim 5, wherein the hemin is reacted with the amplification product by: mixing hemin and amplification product, reacting at 37 deg.C for 30min, adding TMB color developing agent, mixing, reacting at 37 deg.C for 10min, and reacting at H₂SO4 stops the reaction.

9. A kit for detecting copper ions, comprising: a copper ion deoxyribozyme system, an isothermal amplification system and a color development system;

the deoxyribozyme substrate chain sequence (5 '-3') is as follows:

AGCTTCTTTCTAATACGrGCTTACCTTGGGGGGTT，

the deoxyribozyme enzyme chain sequence (5 '-3') is:

GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC，

the amplification template sequence (5 '-3') is:

CCCTACCCGCCCTACCCAACTGACTCAACCCCCCAAGGTAAG；