CN107937427A - A kind of homologous repair vector construction method based on CRISPR/Cas9 systems - Google Patents

Abstract

The invention relates to a method for constructing a homologous repair vector based on a CRISPR/Cas9 system, which belongs to the technical field of genetic engineering; the steps are: using the plasmid PCBC and the wild-type Arabidopsis genome as templates, respectively amplifying the vectors containing the targeting sequence by PCR Target band AS-gRNA and AS homologous repair template fragment, electrophoresis, gel cutting to recover the target band; digest plasmid PHDE-mCH with Bsa1; assemble the completely digested PHDE-mCh vector and ASgRNA by homologous recombinase Ligation to form recombinant plasmid PHDE‑ASgRNA, transformation and sequencing identification, and then the correctly sequenced PHDE‑ASgRNA plasmid was digested with EcoR1 and ligated with AS homologous repair template fragments with homologous recombinase, transformed and sequenced to construct PHDE‑ASgRNA ASgRNA‑AS homologous repair carrier, the technology of the present invention can truly realize the fixed-point editing function of the target biological genome CRISPR/Cas9 system method, the carrier construction only needs one-step PCR, which is simple and easy, and does not need to cut the carrier and PCR products Purification and recovery, high assembly efficiency.

Description

A method for constructing homologous repair vector based on CRISPR/Cas9 system

technical field

The invention relates to a method for constructing a homologous repair vector based on a CRISPR/Cas9 system, in particular to a method for constructing a plasmid vector for constructing a cDNA library and screening, and belongs to the technical field of genetic engineering.

Background technique

CRISPR/Cas9 genome-directed editing technology is a technology developed in recent years for targeted and precise genome modification. By introducing exogenous DNA into a specific site on the chromosome of the recipient cell, the genome can be specifically modified to study the function of the gene. This technology can perform operations such as deletion, knock-in, and nucleotide correction on target sites in the genome. In 2013, scientists applied CRISPR/Cas9 to human and mouse cell lines for the first time to knock out genes, and then people also successfully applied it in model plants and other crops, and the modified CRISPR/Cas9 system also rapidly It has been applied to the targeted editing research of Arabidopsis, tobacco, sorghum, rice, wheat, corn and other different plant genomes, and obtained a higher rate of induced mutations and stable hereditary genome editing plants. Compared with transgenic technology, the CRISPR/Cas9 system is simple and fast to operate, does not require huge capital investment, does not leave traces of transgenes after genetic editing, and does not need to introduce foreign genes, so it has high biological safety and no transgenic disputes.

So far, the use of CRISPR/Cas9 system to achieve directional genome editing can only target knockout of endogenous genes, and it is still impossible to achieve targeted introduction of exogenous genes, which limits the comprehensive study of gene functions. Therefore, based on the existing CRISPR/Cas9 vector, construct a CRISPR/Cas9 system that can exchange exogenous genes to endogenous genes at a fixed point, and truly realize the fixed-point editing function of the genome of the target organism. Improvement and targeted introduction of new genes are of great significance.

Contents of the invention

The purpose of the present invention is to provide a method for the CRISPR/Cas9 system that can exchange exogenous genes to endogenous gene positions, and truly realize the fixed-point editing function of the target biological genome. The vector construction only needs one-step PCR, which is simple and easy Yes, there is no need to purify and recover enzyme-cut vectors and PCR products, and the assembly efficiency is high.

For realizing the above-mentioned purpose of the invention, the technical scheme that the present invention takes is as follows:

A method for constructing a homologous repair vector based on the CRISPR/Cas9 system, comprising the steps of:

(1) Target site design

The selection of sgRNA target sites used the CRISPR online design tool (http://crispr.dbcls.jp/), taking the Arabidopsis AS gene as the target gene, and selecting the G-N19-NGG 23bp sequence with the highest score near the 5' end, Among them, the first G is the starting signal site of small RNA transcription, NGG is the PAM sequence of the Cas9 gene positioning, and the 20bp sequence of G-N19 needs to be inserted into the gRNA carrier. A total of two Target sites are designed to achieve large Fragment knockout; at the same time, a homologous repair fragment of the AS gene is installed on the targeting carrier of the AS gene, so that the AS gene can be knocked out at the same time as the CAS9, and the homology arm of the AS gene on the carrier is used as a template for repair.

(2) Primer design

The primers used are listed in Table 1.

Table 1 Primer information used in this study

Table 1Primers μsedinthis stμdy

Note: The underlined part indicates the homologous end sequence, and the bold italic part is the target site sequence

Note, Μnderlinedis thehomologoμs arms of PHDE and the bold seqμence is the target locμs.

(3) Construction of targeting carrier PHDE-ASgRNA

①PCR amplification of the target fragment: The total volume of the PCR reaction is 100 μL, which is evenly distributed into 2 small PCR tubes; the PCR reaction conditions are 98°C preheating for 4 minutes, 40 cycles (98°C for 45s, 55°C for 10s, 72°C for 30s), 72 ℃ insulation;

②Agarose gel electrophoresis purification and target fragment recovery: 1.5% agarose gel electrophoresis PCR product, cut out the target band on a UV transillumination platform, put the target band into a 1.5mL EP tube, and freeze at -4°C for 20min , 15000rpm low-temperature centrifugation for 20min, draw the supernatant into a small PCR tube, measure the concentration, record OD ₂₆₀ /OD ₂₈₀ , store at -20°C;

③Enzyme digestion and identification of the PHDE plasmid: the total volume of the enzyme digestion system was 20 μL, and the temperature was kept overnight at 50°C. Then, using the PHDE plasmid before enzyme digestion as a control, a 0.5% agarose gel was prepared for electrophoresis analysis;

④ Recombination of target fragment and vector: Take a small PCR tube, add 0.3 μL linearized PHDE vector, 3 μL recombinase and 1.2 μL recovered AS gene fragment successively, use recombinase technology to digest the recovered and purified AS gene fragment with BsaI The linearized vector was recombined and connected, and the assembly condition was constant temperature reaction at 50°C for 1 hour;

⑤ Recombinant transformation and identification: transform the recombinant product into DH5a competent Escherichia coli by heat shock method, resuscitate and culture for 12 hours, pick a single colony and culture on a shaker for 3 to 4 hours, do bacterial liquid PCR identification, and analyze by 0.5% agarose gel electrophoresis , PCR reaction conditions are: 94°C for 3min, 30 cycles (94°C for 30S, 55°C for 30S, 72°C for 45S), 72°C for 2min;

⑥Extraction and identification of recombinant plasmids: after culturing the positive clones overnight, extract the plasmids by alkaline lysis, measure the concentration, record OD ₂₆₀ /OD ₂₈₀ , use the plasmid as a template for PCR analysis, and use 1.2% agarose gel electrophoresis PCR product, recombinant plasmid extracted by agarose gel electrophoresis at 0.5% concentration;

⑦Recombinant plasmid sample delivery and sequencing: The plasmids identified as positive by PCR were sent to Sangon Guangzhou Branch for sequencing verification, and the sequencing primer was M626-IDF.

(4) Construction of homologous recombination repair template vector PHDE-ASgRNA-AS

①PCR amplification of AS gene homology arm fragments: The PCR reaction system is the same as above, with a total volume of 100 μL, mixed evenly and divided into 2 small PCR tubes. 45s, 55°C 10s, 72°C 30s), 72°C keep warm;

② Purification by agarose gel electrophoresis and recovery of target fragments: after 1.5% agarose gel electrophoresis, cut the gel to recover the target bands, measure the concentration, record OD ₂₆₀ /OD ₂₈₀ , and store at -20°C;

③Digestion and identification of the PHDE-ASgRNA plasmid: the total volume of the enzyme digestion system was 20 μL, and the reaction was carried out at a constant temperature of 37°C for 15 minutes, and analyzed by electrophoresis with 0.5% agarose gel;

④ Recombination of the target fragment and the vector: Take a small PCR tube, add 0.3 μL linearized PHDE-ASgRNA vector, 3 μL recombinase and 1.2 μL recovered homology arm fragment, the assembly condition is 50 ℃ constant temperature reaction for 1 hour;

⑤ Recombinant transformation and identification: transform the recombinant product into DH5a competent Escherichia coli by heat shock method, resuscitate and culture for 12 hours, pick a single colony and culture on a shaker for 3 to 4 hours, do bacterial liquid PCR identification, and analyze by 0.5% agarose gel electrophoresis ;PCR reaction conditions: 94°C for 3min, 30 cycles (94°C for 30S, 55°C for 30S, 72°C for 45S), 72°C for 2min;

⑥ Extraction and identification of recombinant plasmids: extract the plasmids after culturing the positive clones overnight, measure the concentration, record OD ₂₆₀ /OD ₂₈₀ , use the plasmid as a template for PCR analysis, use 1.2% agarose gel electrophoresis for PCR products, 0.5 The recombinant plasmid extracted by agarose gel electrophoresis of % concentration;

⑦Recombinant plasmid sample delivery and sequencing: The plasmid PCR identified as positive was sent to Sangon Guangzhou Branch for sequencing, and the sequencing primer was EcoR1-F.

The beneficial effects of the present invention are:

(1) The PHDE-ASgRNA-AS recombinant plasmid is based on the PHDE-ASgRNA recombinant plasmid, which is loaded with a homology arm homologous to the AS gene knockout sequence but missing part of the base sequence at a specific site (EcoR1 site insertion ), as a template for homologous recombination repair, to achieve the purpose of site-specific introduction of reverted mutant genes.

(2) Using homologous recombination technology to amplify the target band by PCR, recover it, linearize the vector by restriction enzyme digestion, assemble and other processes, clone the gene knockout target fragment and the homologous recombination repair arm fragment into the same vector successively, which can It is a method of CRISPR/Cas9 system to exchange exogenous genes to endogenous genes at fixed points, and realize the fixed-point editing function of the target biological genome. The vector construction only needs one-step PCR, which is simple and easy, and does not require enzyme-cut vectors and PCR. The product is purified and recovered, and the assembly efficiency is high.

Detailed ways

The present invention will be further described in detail by examples below, and these examples are only used to illustrate the present invention, and do not limit the scope of the present invention.

The hypocotyls of Eucalyptus rugosa sterile seedlings were used as explants for tissue culture regeneration, and the specific methods were as follows:

1 Cultivation of Arabidopsis seedlings

Take 50-80 seeds in a 1.5mL centrifuge tube, add 1mL of 75% alcohol and shake slowly for 6 minutes to fully disinfect the seeds, discard the alcohol, add 1mL of absolute ethanol, shake well and let it stand for more than 5min, then use a 1mL pipette gun to gently Gently aspirate the seeds from the centrifuge tube and dry on sterile filter paper. Sprinkle the dried seeds evenly in the basic medium (MS medium + 7g/L agar + 20g/L sucrose, pH5.8), wrap the medium in newspaper (to prevent exposure to light) and place it in the refrigerator at 4°C for overnight treatment , to vernalize the seeds to promote flower bud formation and flower organ development. The whole operation process needs to be completed in the ultra-clean workbench. The next day, the culture medium treated overnight at low temperature (removing the newspaper) was placed in a light incubator at 23°C for 7 days, and the seedlings were transplanted to flowerpots, and then placed in a light incubator at 23°C for subsequent experiments.

2 Target site design

The target site of the sgRNA is a sequence conforming to (N) ₂₀ NGG. In this paper, two target sites were designed for the Arabidopsis AS1 gene. The sequence information of AS1 is as follows, the underlined part at the 5' end is the target site 1, and the underlined sequence at the 3' end is the target site 2. Sequences with tilde underlines are PAM.

5'- GCGGGATCACTGGGTTAGGAGG CCATTCTCACCATCCTTCTTCATC -3'

3 Primer design

The construction of the expression vector in this experiment adopts homologous recombination method, so the primer design is different. When designing sgRNA primers, it is necessary to add 20 bp of homologous sequences to the 5' ends of the upstream and downstream primers respectively, as recombination adapters, and other primers are designed normally. The primers used in this paper are listed in Table 2.

Table 2 PCR primer sequences used in this paper

Note: The underlined part indicates the homologous end sequence, and the bold italic part is the target site sequence.

4 Construction of expression vector PHDE-ASgRNA

4.1PCR amplification of the target gene

See Table 3 for the PCR reaction system (PrimeSTAR Max DNA Polymerase). The total volume is 100 μL. After mixing, centrifuge in a mini centrifuge (to collect the liquid on the tube wall to the bottom of the tube) for 1 second, and then gently pipette with a pipette gun (the concentration at the bottom of the tube is high after centrifugation) and evenly distribute to 2 small PCR tubes. . The whole operation process needs to be operated on ice and completed quickly.

The PCR reaction conditions (PrimeSTARMax DNA Polymerase) were preheated at 98°C for 4 minutes, 40 cycles (98°C for 45s, 55°C for 10s, 72°C for 30s), and 72°C for incubation.

Table 3 AS-gRNA gene PCR amplification reaction system

4.2 Agarose gel electrophoresis purification and target fragment recovery

(1) Preparation of agarose gel (3-hole comb): Weigh 0.42g of agarose and dissolve it in 28mL of 1×TAE buffer, namely 1.5% agarose gel;

(2) Electrophoresis Add all PCR products into one gel well, 100bp marker for comparison, voltage 100V, current 50mA, power 50W, time 1h, electrophoresis solution 1×TAE;

(3) Take photos and record on the gel imaging system, and then cut out the target band on the UV transillumination platform;

(4) Put the target band into a 1.5mL EP tube, freeze at -4°C for 20min, centrifuge at 15,000rpm for 20min at low temperature, and finally pipette the supernatant into a small PCR tube, measure the concentration, record OD ₂₆₀ /OD ₂₈₀ , and store at -20°C.

4.3 Digestion (linearization) and identification of PHDE-mCh plasmid

The enzyme digestion system is shown in Table 4, the total volume is 20 μL, and the temperature is kept at 50°C overnight;

Electrophoresis analysis: 0.5% agarose gel was prepared for electrophoresis with the PHDE-mCh plasmid before digestion as a control.

Table 4 PHDE-mCh vector digestion system

4.4 Target fragment and vector recombination

Take a small PCR tube, add 0.3 μL linearized PHDE-mCh vector, 3 μL recombinase and 1.2 μL recovered AS gene fragment successively. Using recombinase technology, the recovered and purified AS gene fragment was recombined with the BsaI-digested and linearized vector. The assembly condition was constant temperature reaction at 50°C for 1 h.

4.5 Recombinant transformation and identification

(1) Transformation: Take out 1 tube (100 μL) of prepared DH5a competent cells and put it on ice to thaw; add all the recombinant products (about 4.5 μL) into the tube, mix gently, and place on ice for 30 minutes; Place the centrifuge tube at 42°C for 90 seconds, do not shake the centrifuge tube, and quickly transfer the centrifuge tube to the ice bath for more than 2 minutes;

(2) Recovery: Add 500 μL LB liquid medium without antibiotics, shake the bacteria at 150 rpm for 40-60 minutes;

(3) Cultivation: Centrifuge at 5000rpm for 1min, discard the supernatant, and leave about 100μL tube bottom plate (YEP solid medium with 50mg/L kanamycin added), and set a positive control (YEP without kanamycin) Coat a small amount of bacterial liquid on the solid plate) and negative control (YEP solid medium with 50 mg/L kanamycin, and coat 100 μL sterile water), invert the petri dish, incubate at 37°C for 12 hours, and observe the colonies;

(4) Screen recombinants: pick a single colony to a 1.5mL centrifuge tube, add 500 μL of YEP liquid medium containing 50 mg/L kanamycin (the number of single colonies picked is not less than 10), 200 rpm, 37 ° C Shake the bacteria for 3-4 hours; do bacterial liquid PCR (see Table 3-4 for the system). The product was identified by 1.2% agarose gel electrophoresis.

Table 5 Bacterial solution PCR system

4.6 Extraction and identification of recombinant plasmids

Prepare a sterilized 10 mL centrifuge tube, add 3 mL of liquid YEP medium containing 50 mg/L kanamycin, select 100 μL of each positive clone into each tube, and culture overnight at 37°C and 200 rpm on a shaker. The next day, the plasmid was extracted, its concentration was measured, and the OD ₂₆₀ /OD ₂₈₀ was recorded. The plasmid was used as a template for PCR analysis. The system is shown in Table 6. The PCR product was electrophoresed with 1.2% agarose gel, and the extracted recombinant plasmid was electrophoresed with 0.5% agarose gel.

Plasmid extraction steps:

(1) Pour 1.5mL of culture solution into a 1.5mL Eppendorf tube, centrifuge at 10,000rmp for 1min, discard the supernatant, collect again, and place the tube upside down on filter paper to drain the remaining bacterial solution;

(2) Resuspend the bacterial cell pellet in 200 μL solution I (violent shaking is required, you can use a vortex to disperse and mix the bacterial cell, and place it for more than 2 minutes);

(3) Add 300 μL of solution II, cap the tube tightly, quickly and gently invert the Eppendorf tube several times to mix the contents (do not shake, be gentle, and do not exceed 2 minutes);

(4) Add 300 μL of pre-cooled solution III, cap the tube tightly, and gently invert the tube several times to mix well, and white flocculent precipitates can be seen. Centrifuge at 15000rmp for 10min;

(5) Transfer 750 μL of supernatant to an Eppendorf tube added with 750 μL of isopropanol, invert several times to homogenize, and centrifuge at 15,000 rpm for 10 min;

(6) Discard the supernatant, add 1 mL of 75% ethanol, invert several times, and then centrifuge at 15000rmp for 2min;

(7) Put the tube upside down on the filter paper to drain the liquid as much as possible, and dry it at room temperature for 30 minutes;

(8) Add 30 μL of sterilized ddH ₂ O to dissolve the precipitate, measure the concentration, and record OD ₂₆₀ /OD ₂₈₀ .

Table 6 Reaction system for PCR analysis of recombinant plasmids

Note: The total volume is 10 μL, and the reaction conditions are 98°C preheating for 4 minutes, 40 cycles (98°C for 45 s, 55°C for 10 s, 72°C for 30 s), and 72°C for heat preservation.

4.7 Recombinant plasmid sample delivery and sequencing

The plasmids identified as positive by plasmid PCR were sent to Sangon Guangzhou Branch for sequencing verification. The sequencing primer was M626-IDF.

5 Construction of Homologous Recombination Repair Expression Vector PHDE-ASgRNA-AS

The PHDE-ASgRNA-AS recombinant plasmid is based on the PHDE-ASgRNA-mCh recombinant plasmid, and is loaded with a homology arm homologous to the AS1 gene knockout sequence but missing part of the base sequence at a specific site (EcoR1 site insertion) , as a template for homologous recombination repair, to achieve the purpose of site-specific introduction of reverted mutant genes.

5.1 PCR amplification of homology arm fragments

See Table 7 for the PCR reaction system (PrimeSTAR Max DNAPoLymerase). The total volume is 100 μL, and after mixing, divide evenly into 2 small PCR tubes. The whole operation process needs to be operated on ice and completed quickly.

The PCR reaction conditions (PrimeSTAR Max DNAPoLymerase) were preheated at 98°C for 4 minutes, 40 cycles (98°C for 45s, 55°C for 10s, 72°C for 30s), and 72°C for incubation.

Table 7 Homologous arm EcoR1PCR amplification reaction system

5.2 Agarose gel electrophoresis purification and target fragment recovery

(1) Preparation of agarose gel (big comb): Weigh 0.42g of agarose and dissolve it in 28mL of 1×TAE buffer, namely 1.5% agarose gel;

(2) Electrophoresis Add all PCR products into one gel well, 100bp marker for comparison, voltage 100V, current 50mA, power 50W, time 1h, electrophoresis solution 1×TAE;

(3) Take photos and record on the gel imaging system, and then cut out the target band on the UV transillumination platform;

(4) Put the target band into a 1.5mL EP tube, freeze at -4°C for 20 minutes, centrifuge at 15,000 rpm for 20 minutes, draw the supernatant into a small PCR tube, measure the concentration, record OD ₂₆₀ /OD ₂₈₀ , and store at -20°C.

5.3 Digestion (linearization) and identification of PHDE-ASgRNA-mCh plasmid

The enzyme digestion system is shown in Table 8, with a total volume of 20 μL and a constant temperature reaction at 37°C for 15 minutes;

Electrophoresis analysis: using the PHDE-ASgRNA-mCh plasmid before digestion as a control, prepare 0.5% agarose gel for electrophoresis analysis.

Table 8 PHDE-ASgRNA-mCh vector digestion system

5.4 Target fragment and vector recombination

Take a small PCR tube and add 0.3 μL linearized PHDE-ASgRNA-mCh vector, 3 μL recombinase and 1.2 μL recovered homology arm fragments successively. The assembly condition was constant temperature reaction at 50°C for 1 h.

5.5 Recombinant Transformation and Identification

The recombination product of the homology arm fragment and the linearized PHDE-ASgRNA-mCh vector was transformed into DH5a competent Escherichia coli by heat shock method, revived and cultured for 12 hours, single colonies were cultured on a shaker for 3-4 hours, and the bacterial liquid PCR was used for identification. 0.5% agarose gel electrophoresis analysis. The PCR reaction system is shown in Table 9. The PCR reaction conditions are: 94°C for 3 minutes, 30 cycles (94°C for 30S, 55°C for 30S, 72°C for 45S), and 72°C for 2min.

Table 9 Bacterial solution PCR system

5.6 Extraction and identification of recombinant plasmids

Prepare several sterilized 10mL centrifuge tubes, add 3mL liquid YEP medium containing 50mg/L kanamycin to each tube, select 100μL of positive clones and add them to each tube, culture overnight at 37°C and 200rpm on a shaker. The plasmid was extracted the next day (see 3.3.6 Plasmid Extraction for operation), the concentration was measured, and the OD ₂₆₀ /OD ₂₈₀ was recorded. The plasmid was used as a template for PCR analysis. See Table 10 for the system. The PCR product was electrophoresed with 1.2% agarose gel, and the extracted recombinant plasmid was electrophoresed with 0.5% agarose gel.

Table 10 Reaction system for PCR analysis of recombinant plasmids

Note: The total volume is 10 μL, and the reaction conditions are 98°C preheating for 4 minutes, 40 cycles (98°C for 45 s, 55°C for 10 s, 72°C for 30 s), and 72°C.

5.7 Recombinant plasmid sample delivery and sequencing

The plasmid identified as positive by plasmid PCR was sent to Sangon Guangzhou Branch for sequencing, and the sequencing primer was ECOR1-F.

sequence listing

<110> Guangdong Petrochemical Institute

<120> A method for constructing homologous repair vector based on CRISPR/Cas9 system

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2400

<212>DNA

<213> Unknown (Unknown)

<400> 1

ttctgtcttc tacttgaatt tacacatgta aagatataaa tcgattttat ttataaacca 60

aagtgttgca gctgactaaa tcaacatcaa gcttgagaaa acaaagccat ggataaactg 120

aagtgataaa tggaacacaa aggtaaaaga aacaaataca aagctgaggt aaggaaccca 180

aaagtctaag taaacattgg agacacccaa atgatcaaag acaaaaaaaa acaaaaaaaa 240

acaaaaaaaa aaccttacat tacattacaa gttacaacaa agagtttagg agacggtggg 300

gcggtctaat ctgcaaccca tttgttgttc aagaaacttg gtgagtctga tatgcctaga 360

ggtccattga tcagccagtt tctggtcttt ggcctctgcg tctcgcctca aaccaacgag 420

ctgttctctg tactctcctt cgatcttctc cattgcgttc ttctgctctt ccctaagagc 480

tttcatcttt gcctcaatct cctccatctt ctccctttgt ctacacgtct tctctgactc 540

tagctgcagc tccagccttc ttagcctcca tgcagcctct ttcttatggt ctgcccaagc 600

tcggtgccct tcctccaact ctctacaaca ctccacaagc tctgacaaga acacactctc 660

gctactccca ctacaagacg gcatcatact ccctaacaca agtccccctg gaccgttctc 720

tgctctctca ggctgttgct gctgcagcca cgggattggc ggttgaggcg cagctgcagc 780

cactgtggaa ggcgataatg tcaaagttac cgagggaggc cttgcaacaa cattgttccc 840

attgttagaa gtagctaacc aaggcgggat cactgggtta ggaggctgaa cttgttgttc 900

agaatgtaaa aaccctccat tcgaattagc catcacaacc gttgcagcag cggcagcagc 960

agggacaacg ttagaccgct ctttgacaag cttctcagcg aaactctcga gaatccgatc 1020

gtacttactc tcgtcaatag gctcaactct cttgttactc tctttctctt ctctctgttg 1080

cttctcctta aacacttccc accacttccc taaccgcttt gccgtcctcc cgggaacctc 1140

agcagcaatc ttcttccact tgttgccgtg tttctcctga agacggatca caagcctctg 1200

ctcttcctct gtcaaagacc ctttcttgat ccctggctta agataattct tccatctctc 1260

taaacaagac ttggcgtcac ggttcaaagg tttgttcata cgctcagaca caagatgcca 1320

ttctctcgga ccgaactgtc taacgtaagc acgtaacaat gcatcttctt caccactcca 1380

acgttgtctc tctttcatct cctactcctc ctgacatcac ttcttcccat ctcaccatcc 1440

ttcttcatct gtaccaaatt caaaatcaac ccgtttcata aatctctcca attcaaaact 1500

ctaaaagatc gaaacaaatc tacaagatct gtcgaatttt cgaattagaa attacaaagt 1560

ctgaaaaatt tccgtttcaa gaaatgaaaa tgacaaaaac tttgacaatg tttgaagcaa 1620

aacttggaat aatttgttat tatcacacta tacaacctat attctggaaa ccaaacaggg 1680

gaaattaatg ctgaccccaa aacactatta agcaaagact tattaagaag ataagagagt 1740

taaaattatt actataaaac aaaataaaaa tgcttaccaa atgatattga aaagataaat 1800

aatcccaaac tcaagagcaa cttccatcac acagatttgc tctctctctc actttttttt 1860

ttttatatag ttggagaaaa tggaagagag aaaacgaaaa gaccaaagtg agagaggctt 1920

ttaaaaccag acgacgtaca cgattagacc acagagacgg cataattaaa ataaaatctt 1980

taaaaaaaaa aagagagaaa aagtttaccg actgagacac agacgttttc ccctttttac 2040

atcacaagtg gggaaaaaaa aaactctgac agaggcgcgt ggaggtgaaa agttgaaatt 2100

ccataagttc gttgtttgtc attgacaata ttaaaccttt ttttatatat atttactaca 2160

ttgggatctc aaaattcatt tttctataac attatgagaa ataaaatgac aatctaatgt 2220

aggggatgct ttaaatttaa atgaaaaagt gttgtacttt agtggctgaa aagtcattta 2280

cttgtcaaaa tgatagaaga aaaactaacc attcaagaaa ataatgctcc atttataaac 2340

aactccttca ctcaaacaat agaattttat gtccaatttg agtaacatta atttccactt 2400

<210> 2

<211> 60

<212>DNA

<213> Unknown (Unknown)

<400> 2

ctagagtcga agtagtgatt ggcgggatca ctgggttagg gttttagagc tagaaatagc 60

<210> 3

<211> 60

<212>DNA

<213> Unknown (Unknown)

<400> 3

tgctatttct agctctaaaa ctctcaccat ccttcttcat caatctctta gtcgactcta 60

<210> 4

<211> 40

<212>DNA

<213> Unknown (Unknown)

<400> 4

taattgattg acaacgaatt gcgcagctgc agccactgtg 40

<210> 5

<211> 40

<212>DNA

<213> Unknown (Unknown)

<400> 5

acagctatga catgattacg gggaagaagt gatgtcagga 40

<210> 6

<211> 25

<212>DNA

<213> Unknown (Unknown)

<400> 6

tgtcccagga ttagaatgat taggc 25

Claims (1)

1. A kind of 1. homologous repair vector construction method based on CRISPR/Cas9 systems, it is characterised in that：Include the following steps：

   (1) target site designs

   The selection of sgRNA target sites uses CRISPR Photographing On-line instruments, with arabidopsis AS genes：Sequence 1 is target gene, selection Close to the G-N19-NGG 23bp sequences of 5' ends highest scoring, wherein first G is the initial signal site of tiny RNA transcription, NGG It is the PAM sequences of the Cas9 assignments of genes gene mapping, it is necessary to be inserted into gRNA carriers is the common 20bp sequences of G-N19, designs two target practice positions altogether The Target of point, realizes that large fragment knocks out；Load the homologous reparation fragment of AS genes on the targeting vector of AS genes at the same time, it is real Existing AS genes do template with the homology arm of the AS genes on carrier and are repaired while CAS9 is knocked out；

   (2) design of primers is carried out

   As-gRNA-F sequences 2：

   CTAGAGTCGAAGTAGTGATTGGCGGGATCACTGGGTTAGGGTTTTAGAGCTAGAAATAGC

   As-gRNA-R sequences 3：

   TGCTATTTCTAGCTCTAAAACTCTCACCATCCTTCTTCATC

   AATCTCTTAGTCGACTCTA

   EcoR1-F sequences 4：

   TAATTGATTGACAACGAATTGCGCAGCTGCAGCCACTGTG

   EcoR1-R sequences 5：

   ACAGCTATGACATGATTACGGGGAAGAAGTGATGTCAGGA

   μ 626-IDF sequences 6：

   TGTCCCAGGATTAGAATGATTAGGC

   (3) structure of targeting vector PHDE-ASgRNA

   1. PCR amplification purpose fragment：Totally 100 μ L, average mark are filled to 2 PCR tubules to PCR reactions cumulative volume；PCR reaction conditions are 98 DEG C of preheatings 4min, 40 circulations 98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C of 30s, 72 DEG C of insulations；

   Recycled 2. agarose gel electrophoresis is purified with purpose fragment：1.5% agarose gel electrophoresis PCR product, in ultraviolet transillumination Purpose band is cut on platform, purpose band is loaded into 1.5mL EP pipes, -4 DEG C of freezing 20min, 15000rpm low-temperature centrifugations 20min, Aspirate supernatant is in PCR tubules, measured concentration, records OD₂₆₀/OD₂₈₀, -20 DEG C of preservations；

   3. the digestion and identification of PHDE plasmids：20 μ L of digestion system cumulative volume, 50 DEG C of constant temperature are stayed overnight, then with the PHDE before digestion Plasmid compares, and the Ago-Gel for preparing 0.5% carries out electrophoretic analysis；

   4. purpose fragment is recombinated with carrier：A PCR tubule is taken, successively adds 0.3 μ L linearisation PHDE carriers, 3 μ L recombinases And 1.2 μ L recycling AS genetic fragments, using restructuring zymotechnic, by the AS genetic fragments after recovery purifying and BsaI digestion lines Property carrier restructuring connection, assembling condition is 50 DEG C of isothermal reaction 1h；

   5. recon converts and identification：Recombinant products are utilized into thermal shock method conversion DH5a competence Escherichia coli, recovery culture 12h, chooses single bacterium colony 3~4h of shaking table culture, does bacterium solution PCR identifications, is analyzed with 0.5% agarose gel electrophoresis, PCR reaction conditions For：94 DEG C of 3min, 30 circulations 94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S, 72 DEG C of 2min；

   6. the extraction and identification of recombinant plasmid：Alkaline lysis method of extracting plasmid, measured concentration, note are used after positive colony is incubated overnight Record OD₂₆₀/OD₂₈₀, PCR analyses are carried out by template of the plasmid, with the agarose gel electrophoresis PCR product of 1.2% concentration, The recombinant plasmid of the agarose gel electrophoresis extraction of 0.5% concentration；

   7. recombinant plasmid sample presentation is sequenced：The plasmid that plasmid PCR is accredited as to the positive is sent to raw work Guangzhou Branch sequence verification, is surveyed Sequence primer is Μ 626-IDF；

   (4) structure of homologous recombination repair template vector PHDE-ASgRNA-AS

   1. PCR amplification AS DNA homolog arm pieces sections：As hereinbefore, cumulative volume totally 100 μ L are average after mixing for PCR reaction systems To 2 PCR tubules, PCR reaction conditions are 98 DEG C of preheatings 4min, 40 circulations 98 DEG C of 45s, 55 DEG C of 10s, 72 DEG C of 30s, 72 for packing DEG C insulation；

   Recycled 2. agarose gel electrophoresis is purified with purpose fragment：By gel extraction purpose bar after 1.5% agarose gel electrophoresis Band, surveys concentration, records OD₂₆₀/OD₂₈₀, -20 DEG C of preservations；

   3. the digestion and identification of PHDE-ASgRNA plasmids：Digestion system cumulative volume 20 μ L, 37 DEG C of isothermal reaction 15min, are used 0.5% Ago-Gel carries out electrophoretic analysis；

   4. purpose fragment is recombinated with carrier：PCR tubules are taken, successively add 0.3 μ L linearisation PHDE-ASgRNA carriers, 3 μ L restructuring Enzyme and the homology arm fragment of 1.2 μ L recycling, assembling condition is 50 DEG C of isothermal reaction 1h；

   5. recon converts and identification：Recombinant products are utilized into thermal shock method conversion DH5a competence Escherichia coli, recovery culture 12h, chooses single bacterium colony 3~4h of shaking table culture, does bacterium solution PCR identifications, is analyzed with 0.5% agarose gel electrophoresis；PCR reaction conditions For：94 DEG C of 3min, 30 circulations 94 DEG C of 30S, 55 DEG C of 30S, 72 DEG C of 45S, 72 DEG C of 2min；

   6. the extraction and identification of recombinant plasmid：Plasmid is extracted after positive colony is incubated overnight, measured concentration, records OD₂₆₀/ OD₂₈₀, PCR analyses, with the agarose gel electrophoresis PCR product of 1.2% concentration, 0.5% concentration are carried out by template of the plasmid The recombinant plasmid of agarose gel electrophoresis extraction；

   7. recombinant plasmid sample presentation is sequenced：The plasmid sample presentation that plasmid PCR is accredited as the positive is sequenced to raw work Guangzhou Branch sequencing Primer is EcoR1-F.