CN107937389A - Assembled on array - Google Patents

Abstract

Provided herein is, in addition to other business, a kind of method for being used to produce connection product on the support.In some embodiments, this method can include hybridizing to the first double chain oligonucleotide and the second double chain oligonucleotide into the substrate for tying oligonucleotides comprising surface, and the distal end of the first and second double chain oligonucleotides links together, thus produce its both ends and tie in the first connection product on holder.

Description

Assembled on array

Cross reference to related applications

This application claims the U.S. Provisional Patent Application No.62/407 submitted on October 15th, 2016,748 rights and interests, Entire contents are incorporated herein by reference.

Background

The high throughput synthesis and assembling of DNA construct are thoroughly to change the exploitation of molecule and biological product and manufacture The indispensable part circulated for the synthetic biology and bioengineering of target.In the past few years, it is developed If the method that capable person's synthetic DNA oligonucleotides is assembled into longer construct.Many methods utilize the group of polymerase or ligase Close and connect shorter oligonucleotides (for example, the molecule of length for 50 to 200 nucleotide) to be formed up to 1,000 to 5, The construct of 000 base-pair.These methods are enough the complete genome for building encoding function albumen.

Many high throughput methods are carried out using Autonomous Robotic System in microtiter plate.Although these systems drop Low labor cost, but in view of the quantity and volume of the various reactions needed for assembling, reagent cost (including initializing oligonucleotide Including acid) it is still considerable.

The content of the invention

The disclosure provides, in addition to other business, a kind of method for being used to produce connection product on the support.At some In embodiment, this method can include hybridizing to the first double chain oligonucleotide and the second double chain oligonucleotide comprising surface bolt It is the substrate of (surface-tethered) oligonucleotides, and by the end on the remote surface of the first and second double chain oligonucleotides Link together, so that producing both ends ties the first connection product on the support.

Brief description of the drawings

Technical staff will be understood that, the purpose that drawings discussed below is merely to illustrate.Attached drawing is not intended as in any way Limit the scope of this teaching.

Fig. 1 schematically shows some General Principles of an embodiment of this method.

Fig. 2 schematically shows the one group of double chain oligonucleotide that will be fitted together, and the widow tied comprising surface The substrate of nucleotide.In the embodiment illustrated, the oligonucleotides that surface ties is the form of array.

What Fig. 3 schematically illustrated that double chain oligonucleotide and the miscellaneous intersecting and merging of (excess) substrate wash away any is not associated with or not Product after complete double chain oligonucleotide.

Fig. 4 schematically illustrates two double chain oligonucleotides on linker bottom, is tied in support with producing both ends The product of connection product on thing.In the embodiment illustrated, the oligonucleotides that a chain of connection product is tied with surface It is covalently attached, and another chain is tied in holder by the oligonucleotides base pairing tied with surface.

Fig. 5 shows the connection product of cutting, it has the jag (overhang) of the restriction away from holder.Cracking It can be realized by chemical mode, photochemical way or using restriction enzyme.

Fig. 6 illustrates how that two kinds of different connection products link together to produce bridging by connecting.

Fig. 7 shows the replacement assemble method using single stranded oligonucleotide.One end of oligonucleotides is discharged from surface, and It is denatured by raising temperature.

Fig. 8 is shown by the baseline results of the BioAnalyzer connection products (in 150uL) produced.

Fig. 9 is the figure of the analysis for the product for representing device to hole B.

Figure 10 is the figure of the analysis for the product for representing device to hole A-D.

Figure 11 is the gel format chart in 4 holes of the sample analyzed on Agilent BioAnalyzer.

Figure 12 shows the electrophoretogram in the A holes of Figure 11.

Figure 13 shows the form of the quantitative concentrations measured on BioAnalyzer and products collection efficiency.

Figure 14 schematically shows the design of each construct in complicated OLS storehouses.

Figure 15 shows the composite joint product of the PCR amplification after over cleaning.

Figure 16 shows the presentation (representation) of expected construct in embodiment 3.It specifically show EK499 Gene is presented by correctly matching the construct that read counts.

Figure 17 shows the length dependent of connection product yield.The shorter construct of longer construct is significantly less Ground is presented.

Definition

Before exemplary is more fully described, provides and defined below used with illustrating and defining in specification Term implication and scope.

Digital scope includes limiting the numeral of the scope.Unless otherwise indicated, nucleic acid is with 5' to 3' directions from left to right books Write；Amino acid sequence is from left to right write with the direction of amino to carboxyl.

Unless otherwise defined, all technical and scientific terms used herein has and common skill of the art The normally understood identical implication of art personnel.Singleton et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 2D ED, John Wiley and Sons, New York (1994) and Hale and Markham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) can carry for technical staff For the general sense of many terms used herein.However, in order to understand and be convenient for reference, some terms are defined as follows.

It must be noted that as herein and used in appended claims, singulative " one " and "the" refer to including plural number Show thing, unless the context clearly requires otherwise.For example, term " primer " refers to one or more primers, i.e., single primer and draw more Thing.It shall yet further be noted that the writing mode of claim can exclude any optional element.Therefore, this statement is intended to serve as and right It is required that key element uses " independent " in the lump, the exclusiveness term such as " only ", or the first reference basis for using " negative " to limit.

As used herein, term " array " is intended to the two-dimensional arrangements of description addressable area, the addressable area band There is the oligonucleotides associated with the region.The oligonucleotides of array can along the nucleic acid chains on any point covalently attach to Substrate, but be usually attached in an end (such as 3' or 5' ends).

Any given substrate can carry one be arranged in the front surface of substrate, two, four or more gusts Row.Depending on purposes, all arrays can be same to each other or different to each other, and each array can include multiple points or feature.One A array can be less than 20cm²Region in (such as less than 10cm², less than 5cm², or less than 1cm²Region in) include At least ten, at least 100, at least 1,000, at least 10,000, at least 100,000, or at least 10⁶A or more Feature.In some embodiments, feature can have the width (for circular dot, that is, diameter) in the range of 1 μm to 1.0cm, But it is characterized in what is be contemplated that beyond these sizes.In some embodiments, feature can have at 3.0 μm to 200 μ In the range of m, such as 5.0 μm to 100 μm or 10 μm to 50 μm of width.It there may typically be between the feature for not carrying any polymer Region (interfeature areas).It will be appreciated, however, that between feature region when it is present, can have various sizes and Configuration.

Each array can be covered less than 100cm², it is, for example, less than 50cm², less than 10cm²Or less than 1cm²Area. In some embodiments, carry one or more arrays substrate be generally rectangular in shape or square solids are (although other shapes Shape is possible), its length is more than 4mm and is less than 10cm, is greater than 5mm and is less than 5cm；Width is more than 4mm and is less than 10cm, is greater than 5mm and is less than 5cm.

Array can be manufactured with the droplet deposition of pulsing jet；Wherein pulsing jet manufacture in the original location in the case of be more The jet stream of nucleotide precursor unit (such as monomer), or the jet stream of the polynucleotides previously obtained.Such method is in example The US 6,242,266, US 6,232,072, US 6,180,351, US such as submitted by Caren et al. on April 30th, 1999 6,171,797, US 6,323,043, have in U.S. Patent Application Serial 09/302,898 and references cited therein It is described in detail.These bibliography are incorporated herein by reference.As described earlier in this article, other droplet deposition methods can be used for making Make.Furthermore, it is possible to replace droplet deposition method using photoetching array manufacturing method.When manufacturing array by photolithography method, no Especially need existing characteristics region.

If array has multiple regions for possessing different piece (for example, different polynucleotide sequences) so that region (i.e. " feature " of array, " point " or " region ") is located at the specific precalculated position (i.e. " address ") on array, then array be " can Addressing ".Between each array features in general, but not necessarily, separated by clearance space.

Term " nucleotide " is intended to include such part, it not only contains known purine and pyrimidine bases, also includes The part for the other heterocyclic bases being modified.These modifications include methylated purines or pyrimidine, acylated purines or pyrimidine or its Its heterocycle.In addition, term " nucleotide " is included containing those of haptens or fluorescent marker part, and can not only contain normal The ribose and deoxyribose of rule, can also contain other sugar.The nucleosides or nucleotide of modification further include the modification on sugar moieties, example As wherein one or more hydroxyls are replaced by halogen atom or aliphatic group, or it functionalised as ether, amine etc..

Term " nucleic acid " and " polynucleotides " are used interchangeably herein, and (about 2 are greater than for describing any length A base, greater than about 10 bases, greater than about 100 bases, greater than about 500 bases, more than 1000 bases, Nai Zhiyue 10,000 or more bases) the polymer being made of nucleotide (such as deoxyribonucleotide or ribonucleotide), It can be with enzymatic preparation or synthetically prepared (for example, as described in U.S. Patent number 5,948,902 and references cited therein PNA), and it can be miscellaneous with the sequence-specific fashion similar to two naturally occurring nucleic acid with naturally occurring nucleic acid Hand over, such as Watson-Crick base pairing interaction can be participated in.Naturally occurring nucleotide includes guanine, cytimidine, Adenine, thymidine, uracil (being respectively G, C, A, T and U).DNA and RNA has ribodesose and ribose main chain respectively, And the main chain of PNA is made of N- (2- amino-ethyls)-glycine unit of the repetition by peptide key connection.It is various fast in PNA Purine and pyrimidine bases are connected by methylene carbonyl bond with main chain.Locked nucleic acid (LNA), it is commonly referred to as unreachable (inaccessible) RNA, is a kind of RNA nucleotide of modification.The ribose moieties of LNA nucleotide are modified to have a company Connect the extra bridge of 2' oxygen and 4' carbon.Ribose " locking " is 3' ends (north) configuration by the bridge, and this configuration is usually in A type duplexs Middle discovery.As long as needing, LNA nucleotide can mix in oligonucleotides with DNA or RNA residues.Term " unstructured core Acid " or " UNA " are the nucleic acid containing non-natural nucleotides, these non-natural nucleotides are bonded to each other with the stability reduced.Example Such as, unstructured nucleic acid can contain G' residues and C' residues, these residues are deposited corresponding to the non-natural as described below of G and C In form, i.e. analog：They with the base pairing each other of the stability of reduction, but retain respectively with naturally occurring C and G residues The ability of base pairing.Unstructured nucleic acid is described in US20050233340, it is incorporated herein by reference for UNA Disclosure.

Term " oligonucleotides " used herein represents that length is about 2 to 200 nucleotide, up to 500 nucleotide Nucleotide multimer.In some embodiments, the length of oligonucleotides can be in the range of 30 to 300 nucleotide. Oligonucleotides can contain ribonucleotide acid monomers (can be oligoribonucleotide) and/or deoxyribonucleotide monomers. For example, the length of oligonucleotides can be 10~20,21~30,31~40,41~50,51-60,61~70,71~80,80~ 100th, 100~150 or 150~200 nucleotide.

As it is used herein, term " predefined ", which is intended to indicate, is being manufactured thing known before.

As it is used herein, term " mixture " refers to such solution, wherein each component be to each other without It is spatially separating.

As used herein, term " water-based " refers to such medium, and wherein solvent includes water.

As it is used herein, term " group ", " multiple " and " group " (plurality) refers to comprising at least two member Colony.In some cases, it is multiple to have at least ten, at least 100, at least 1,000, at least 10,000, extremely It is 100,000 few, at least 10⁶It is a, at least 10⁷It is a, at least 10⁸It is a, or at least 10⁹A or more member.

As used herein, term refers to be not associated with or tie in solid substrate in aqueous environments " in solution phase " High-molecular compound.Such high-molecular compound is soluble in aqueous environments.

As used herein, term " contact ", which is intended to indicate, makes contact (placing into contact).Term is " by battle array Row are contacted with solution " it is intended to include the direct contact between array and solution, such as by impregnating or being atomized, and by other Mode deposition solution on the surface of the substrate.

As used herein, " mixture of double chain oligonucleotide " refers to few containing a variety of different double-strands therein are dissolved in The aqueous solution of nucleotide.Mixture can include at least 50, at least 100, at least 500, at least 1,000, at least 5,000, extremely Lack 10,000 or at least 50,000 kinds or more kind oligonucleotides.The mixture of oligonucleotides can pass through fabricated in situ few nucleosides Acid, i.e. original place synthetic oligonucleotide, then the oligonucleotides synthesized is cut off to prepare from the surface of array in an array.Referring to (the Nature Methods 2,004 1 such as such as Cleary:241-248) and LeProust et al. (Nucleic Acids Research 2010 38:2522-2540)。

As used herein, in the context of the composition comprising multigroup oligonucleotides, term " multigroup " refers to multiple Different oligonucleotides colonies, one of which oligonucleotides can include at least two kinds of, at least five, at least ten kinds of, at least 50 kinds, Or at least 100 kinds or more kind (such as 3 to 50 kinds, such as 4 to 30 kinds) oligonucleotides, and said composition can contain at least 5 groups, at least 10 groups, at least 50 groups, at least 100 groups, at least 500 groups, at least 1,000 group or at least 5,000 group or more group is few Nucleotide.

As used herein, term one group of double chain oligonucleotide of synthon " can assemble produce " and its phraseological etc. Jljl refers to one group of oligonucleotides that longer sequence can be assembled into enzymatic, and the longer sequence is referred to herein as " synthesis Son ", it contains the sequence from each oligonucleotides in a defined sequence.It should be appreciated that each double chain oligonucleotide of some group It can include：(i) " index jag " (the indexing overhang) and (ii) with hybridization array assembles sequence, wherein often Each assembling sequence of group oligonucleotides can assemble and produce synthon, and (iii) another " connection jag ", its position In the other end of duplex, be connected to it is another kind of as the double chain oligonucleotide that builds.

It is usually longer to index jag, such as 20-40 nucleotide, and it is usually shorter to connect jag, such as 1-10 a Nucleotide.

As used herein, term " connection in order of index specificity " (index-specific ordered Ligation) refer to wherein double-stranded segment is connected to each other to produce the scheme of synthon, wherein synthon using DNA ligase In the order of each fragment determined by following factors：It is the uniqueness (distinctness) for indexing jag first, which it limits A little oligonucleotides are by as a part for each synthon；It is secondly to be connected a small amount of unique in each array features (distinct) prominent sequence is connected.Within feature, the order of connection depends on prominent terminal sequence and indexes cutting for jag Cut, index the cutting of jag so that each follow-up phase in the connection of long synthon has a new jag to be used.Letter This method singlely is far longer than come the limitation that the connection function that sorts is subject in terms of specificity by jag.By using rope Draw specific connection, and make the available oligonucleotides of each construct not only be subject to their connection jag in order The constraint of (ligating overhang) sequence, is also subject to the index sequence of the probe in array surface to constrain.It is more when existing When walking connection procedure (such as 4 parts, 8 parts or the assembling of 16 parts), connection jag is helpful, because if in feature Different piece connection jag it is different, then they will not interconnection.However, the use of index jag is also to contract significantly The length and complexity of short jag provide possibility.Different synthons can have identical jag without obvious Crosstalk.This is a unexpected income and improvement relative to conventional high throughput method.

As used herein, term " index sequence " (indexer sequence) refers to one in double chain oligonucleotide Exclusive (unique) sequence that jag occurs, wherein each oligonucleotides in every group of oligonucleotides of each synthon has phase Same uniqueness (distinct) index sequence, and every group of oligonucleotides has the index sequence different from every other synthon. Each index sequence is different from each other, and is complementary to sequence difference.For example, the first exclusive sequence has with the second exclusive sequence not With and be complementary to the different nucleotide sequence of sequence.Index sequence does not hybridize each other, i.e., they be designed so that they It is unannealed each other under stringent condition.Such sequence, is known as " sequence token ", for example in some publications US20070259357 and Brenner et al. (Proc.Natl.Acad.Sci.1992 89：It is described in 5381-3), these texts Offer and be incorporated herein by reference.The length of end index sequence can be 8-50 base, such as length is 10-35 base, Or length is 15-40 base.In some cases, the length of end index sequence can be up to 100 bases.

As it is used herein, in the linguistic context of " being spatially separated different groups of double chain oligonucleotide each other ", term " being spatially separated " refers to different groups of oligonucleotides being separated from each other so that the oligonucleotides of difference group is present on array Diverse location.Specifically, the oligonucleotides in first group is associated with the first position on array, the few nucleosides in second group Acid is associated with the second place on array, and the oligonucleotides in the 3rd group is associated with the third place on array, with This analogizes." association " can show as specific group and hybridize at special characteristic, such as the spy in the probe with particular sequence At sign.

As used herein, term " double chain oligonucleotide " refers to the oligonucleotide molecules of substantially double-strand, such as containing There are at least 50 base-pairs, or the double-stranded region of at least 30 base-pairs.

Term " synthon " used herein refer to by several shorter nucleic acid assembled in vitro and Lai nucleic acid.

As used herein, term " surface ties () " refers to the molecule being covalently or non-covalently attached on surface.

Term " surface remote (end) " refer to the oligonucleotides that surface ties farthest away from surface (closest to the Surface end).

Term " surface near (end) " refer to the oligonucleotides that surface ties closest to surface (furthest to the Surface end).

Term " jag " refers to the single stranded zone of double chain oligonucleotide end.Jag can be 5' jags (this In the case of 3' ends it is recessed) or 3' jags (wherein 5' ends are recessed).

Term " connection is compatible " (ligation compatible) refers to two identical protrusions of length complimentary to one another End.Such jag can be linked together by ligase.

It is also possible that other definition of term in specification full text.

Description

Before various embodiments are described, it will be appreciated that the teaching of the disclosure is not limited to described particular, Therefore it is of course possible to change.It is also understood that terms used herein is only used for the purpose of description particular, and unexpectedly Figure is restricted, because the scope of this teaching will be limited only by subsidiary claim.

Sub-section titles used herein are only used for organizational goal, are not necessarily to be construed as limiting the master of description in any way Topic.Although this teaching is described with reference to various embodiments, this teaching is not intended finger and is limited to these embodiments.Phase Instead, as it will appreciated by a person of ordinary skill, this teaching includes various replacements, modification and equivalent.

Unless otherwise defined, the implication of all technical and scientific terms used herein and disclosure fields is common Technical staff institute is normally understood identical.Some illustrative methods and material be described below, but with phase described herein Like or equivalent any method and material can be used in the practice or test of this teaching.

Reference to any publication is to quote its disclosure before the submission date, is not necessarily to be construed as recognizing this The claim of application does not have right formerly to be taken the lead according to invention in these opposite publications of date.Further it is provided that go out The date of version thing may be different from the actual publication date, can investigate one by one.

As those skilled in the art can understand upon reading the present disclosure, each reality described and illustrated herein Each in scheme is applied with discrete component and feature, its can easily with any one in other several embodiments A character separation or the scope or spirit combined without departing from this teaching.Any method set forth herein can be according to being described The order of event carry out, or carried out with any other logically possible order.

Herein by quoting all patents and publications, all sequences being included in disclosed in such patent and publication It is incorporated herein.

The disclosure is in addition to other business, there is provided a kind of by indexing specificity connection (index-specific in order Ordered ligation) on the support assemble synthon method.This method can be utilized, according to being linked in sequence for restriction From two, three, four, or more the sequence of double chain oligonucleotide produce synthon.It will such as retouch in further detail below As stating, this method can with multiplex, be embodied in can be produced in identical substrate multiple and different synthons (for example, At least two, at least ten, at least 100, at least 1,000 or at least 10,000, or at least 100,000 synthon), Wherein each synthon produces in a feature of substrate.The step at first of this method is generally included the first Double stranded oligonucleotide The hybridization of the substrate of acid and the second double chain oligonucleotide and the oligonucleotides that is tied comprising surface, and by first and second double-strand widow's cores The surface distal end of thuja acid links together, and thus generation both ends tie the first connection product in holder.The one of the product End can be cut off from holder, so as to produce another jag, which can be with the bag on holder in same feature Containing the other duplex molecules connection for connecting compatible jag.The process is combined into the production process of son independent one and can weigh Plural time.

With reference to figure 1, some embodiments of this method can include obtaining：(i) substrate 2, it includes holder 4 and bolt The oligonucleotides colony 6 of the holder is lain in, (ii) first double chain oligonucleotide 8, it is respectively provided with jag (jag at both ends 12 and 16), and (iii) second double chain oligonucleotide 10, it is respectively provided with jag (jag 14 and 18) at both ends.Fasten in branch Holding the oligonucleotide of thing can also can be tied by their 5' ends by their 3' ends, can covalently be tied Non-covalent it can tie.In the method, the jag in the first end of the first and second double chain oligonucleotides is (i.e., Jag 12 and be 14) that connection is compatible, and the jag in the second end of the first and second double chain oligonucleotides is (that is, prominent Outlet 16 and the oligonucleotides 6 18) tied respectively with surface are complementary.Jag 16 with 18 sequence can identical also can be different, As long as the complementation of oligonucleotides 6 that they are tied with surface and the hybridization of oligonucleotides 6 that can be tied with surface.In this public affairs In the other parts opened, the sequence of the oligonucleotide hybridization tied with surface is properly termed as " indexing " sequence.

The next step of this method includes tie the first double chain oligonucleotide 8 and the second double chain oligonucleotide 10 with surface Oligonucleotides 6 hybridizes to produce product 20.As shown in Figure 1, the hybridization step causes the second end of the first and second oligonucleotides The oligonucleotide hybridization that end (that is, end of the double chain oligonucleotide 8 and 10 containing jag 16 and 18) is tied from different surfaces, So as to tie the second end of the first and second double chain oligonucleotides in holder.Substrate includes the first and the of double chain form Two double chain oligonucleotides.

Next, this method includes, by the first end of the first and second double chain oligonucleotides, (they are now away from support Thing surface) jag (that is, compatible jag 12 and 14) link together, tied in holder so as to produce both ends First connection product 22.Since the jag of these oligonucleotides has compatible end, so oligonucleotides need not be filled and led up (fill in), scabbles (chew back) or becomes flush end in other ways, and connection function need not be by dividing (split) Mediation.As shown in the figure, two chains of the first double chain oligonucleotide are each connected to the second double chain oligonucleotide to produce the first company Practice midwifery thing 22.

It should be appreciated that double chain oligonucleotide is synthetically prepared molecule, rather than the fragment of genome, cDNA, also absolutely not Derived from live body.Double chain oligonucleotide can be prepared：Two or more complementary single stranded oligonucleotides are hybridized each other, Generation has the duplex of jag comprising double stranded region, in two ends.In any embodiment, double chain oligonucleotide can have There is such double-stranded region：The double-stranded region has at least 30 base-pairs, at least at least 50 base-pairs, 100 bases It is right, at least 150 base-pairs, or at least 200 base-pairs, desirably the length of product and the embodiment of this method and It is fixed.The length of jag can change, and in some embodiments, length can be in the range of 1 to 40 base. In some embodiments, the distal end jag positioned at the first end of the first and second double chain oligonucleotides (that is, is connected to one Rise jag) length can in the range of 1 to 9 base, therefore, can have length be 1,2,3,4, 5,6,7,5' the or 3' jags of 8 or 9 bases.In another proximal end of the first and second double chain oligonucleotides Jag, i.e., the length with " second " end of substrate hybridization can be in the range of 10 to 40 nucleotide, such as length For 12-30 nucleotide.If the 3' ends of the probe on array attach to solid support, as be conventionally synthesized structure that Sample, then index jag in the 5'- ends of double chain oligonucleotide.The embodiment party of solid support is attached in the 5' ends of probe In case, the near-end of double chain oligonucleotide needs 3' jags.As described below, double chain oligonucleotide can (one kind comes from mutS The DNA mismatch associated proteins of thermus aquaticus) handled, with remove it is any without fully-complementary sequence (i.e. containing " grand Rise ") double chain oligonucleotide.It is obvious that any hybridization step is (for example, the first and second double chain oligonucleotide during it Second end jag and holder on the step of tying oligonucleotide hybridization) the first and second double-strands should not made Carried out under conditions of oligonucleotides denaturation.In some embodiments, the length and buffer condition depending on index sequence, hybridization At 45 DEG C to 70 DEG C, or carried out under 55 DEG C to 70 DEG C of temperature or its equivalent condition.Can select temperature and buffer condition with The non-specific hybridization for the oligonucleotides for making to be intended for other different characteristics minimizes, while not substantial reduction oligonucleotides Between specific binding.In view of the T of double-stranded region and jag_mBetween differ greatly, these conditions comparatively be hold Easily find.

In some embodiments, double chain oligonucleotide can be made of the complementary single strand oligonucleotides hybridized together. In other embodiments, double chain oligonucleotide is made of a long single stranded oligonucleotide for having hair clip at one end, this is single-stranded Oligonucleotides is cut in hair clip, forms the oligonucleotides with jag.Hair clip would generally be cut before proceeding, example Cleavage such as is limited by using II types, jag to be connected is left in the end.The later embodiment is in assembly Some regions in synthesis provided with structure with long homologous or even mutually homotactic synthon possible, while avoid few core Thuja acid with hybridization array before wrong crisscrossing in the solution.In some embodiments, the double-strand of double chain oligonucleotide The some parts of area contribution synthon, remainder is filled and led up after the first Connection Step using archaeal dna polymerase, in this way, filling out Flat part is contributed by jag.This to enjoy common constant series between multiple synthons while is avoided or reduced Crisscrossing between each variable single-stranded regions is possibly realized.

In some embodiments, the first double chain oligonucleotide can be so designed that so that the first double chain oligonucleotide The recessed chain of second end can tie oligonucleotides company after the oligonucleotide hybridization to surface ties oligonucleotides with surface Connect.As shown in Figure 1, in some embodiments, the hybridization that oligonucleotides is tied by the first double chain oligonucleotide and surface is produced Raw compound can contain jagged 24, its available ligase sealing.In these embodiments, Connection Step can also be by The second end of one double chain oligonucleotide is connected to oligonucleotides that surface ties to produce connection joining part (ligation junction)26.In these embodiments, the first connection product 22 can include what is covalently coupled：Tied containing surface The chain 28 of the sequence of oligonucleotides, a chain of the first double chain oligonucleotide, and a chain of the second double chain oligonucleotide.At this In a little embodiments, the second end of the second double chain oligonucleotide need not be connected to the oligonucleotides that surface ties.Therefore, exist In first connection product 22, between the oligonucleotides that the end and surface of a chain of connection product 22 tie there may be " Gap " 30, but can also prevent the second end of the second double chain oligonucleotide by other means and surface tie oligonucleotides it Between connection.Be possible to produce long single stranded oligonucleotide using such embodiment, can by high temperature, higher than 90 DEG C, Or harvested by being denatured to the less salt of chain.

In some embodiments, the method can also include the second end of the second oligonucleotides of cutting with by first One end of connection product is discharged from holder, so as to produce product 32.In these embodiments, cutting can cause to connect first The practice midwifery surface distal end (that is, not tying in the end of holder) of thing produces new jag 34.The jag, following article will more As detailed description, it may be connected to which there is another molecule of compatible jag.As shown in the figure, the cutting step can make With restriction endonuclease or by cut it is cleavable connection 36 (its can be can light cut or chemically cut) come Realize.If using cleavable connection, there may be the end comprising 3' hydroxyls or 5' phosphoric acid (which to depend on for cleavage reaction End is tied in substrate) so that the end can participate in another connection in case of need.In some embodiments In, cleavable connection can the end of another chain 1 to 9 nucleotide (for example, 1,2,3,4,5 or 6 or more core Thuja acid) upstream or downstream so that the connection can produce jag after being cut.If cutting step is in the 5' ends of cleavage site Do not leave phosphoric acid, then can be by kinases by the end Enzymatic Phosphorylation.The cutting of this connector can also discharge the from substrate The end of one connection product.As shown in the figure, product 32 is containing the sequence 38 from the first double chain oligonucleotide and from second pair Second sequence 40 of chain oligonucleotides.

If using cleavable connector, connector can chemically be cut (for example, using gaseous ammonia or another kind Decomposition agent) or can light cutting.In some cases, the cutting of cleavable connector can produce 3'- hydroxyls, and in other situations Under, the cutting of cleavable connector can produce 5' phosphoric acid.Under illustrate a kind of can be cut to produce the suitable of end 5'- phosphoric acid Phosphoramidite.This connector, and other suitable connectors for leaving 5'- terminal phosphates, can obtain from commercial source.

In order to produce 3'- hydroxyls, suitable phosphoramidite monomer is known, including withRelevant Asia Phosphamide (US20040152905) and thymidine-succinyl caproamide CED phosphoramidites (Chemgenes).Use thymidine-amber Acyl caproamide CED phosphoramidites connector will produce the T residues with 3' hydroxyls in 3' ends.Replacement connector can be built so that few Nucleotide is terminated by any desired base.

Can also use can light cut connector.Be illustrated below a kind of commercially available (Glen Research) can light cut Cutover head phosphoramidite, it leaves desired phosphoric acid in 5 '-end.

Be illustrated below it is a kind of suitably can light cutting connector, it leaves 3 '-OH.

In the embodiment for wherein producing new jag 38, this method can also include jag being connected to another double On the attachable compatible jag of chain nucleic acid.In some embodiments, another double-strandednucleic acid can be tied in support Thing 4.In these embodiments, which can be the 3rd double chain oligonucleotide for being anchored to holder, or It is the connection product for including the 3rd double chain oligonucleotide, for example, containing the 3rd double-strandednucleic acid and the 4th double-strandednucleic acid Connection product.It is contemplated that the end of another double chain oligonucleotide or the connection product containing the double chain oligonucleotide can The jag compatible with jag 34 is designed to have, connection in solid support is tied so as to produce another both ends Product --- " second " connection product.In these embodiments, this method can also include the end of the second connection product of cutting End (for example, by using chemically, can light cutting connection), so that by one end of the second connection product from holder discharge. The end being released of second connection product can be designed to include other jag, and the jag can be joined to Another double chain oligonucleotide or the connection product containing another double chain oligonucleotide, so that the second connection product can be extended. Therefore, in some embodiments, this method can be used for the synthon for making any length.

In some embodiments, the jag of the first connection product end may be coupled to the 3rd double chain oligonucleotide, Wherein the 3rd double chain oligonucleotide, which has, to be tied in the first end of (for example, hybridize to or be covalently attached to) holder, and tool There is the second end that compatible jag is connected with the jag of the first connection product end.

In other embodiments, the jag of the first connection product end may be coupled to another construct, wherein should Another construct product includes the 3rd double chain oligonucleotide, and wherein another construct have tie in holder (for example, With the holder hybridize or covalently couple) first end, and have be connected with the jag of the first connection product end it is compatible Jag second end.As described in more detail below, can be prepared in a manner of identical with the first connection product other Construct, i.e. double chain oligonucleotide (that is, the third and fourth double-strand by the way that holder and two to be respectively provided with to jag at both ends Oligonucleotides) hybridize, the oligonucleotides tied wherein on the jag and holder of the two double chain oligonucleotide one end is miscellaneous Hand over, and the other end of this two double chain oligonucleotides is that connection is compatible, compatible end is linked together another to produce One construct, then cuts one end of the construct to produce the jag compatible with the jag of the first connection product.

After two Connection Steps, synthon can be produced from four double chain nucleotides.If the process is repeated the 3rd It is secondary, then it can produce synthon from eight double chain nucleotides.Considering the actual yield of continuously coupled step and using independent Cleavable connector or restriction enzyme on the basis of, the process can be repeated several times to produce longer synthon.For example, Different restriction enzymes can be used for cutting the middle synthon of different loci, and draw in the different step of the process Enter.Alternatively, it can use two or more that be cut in different wave length can the connector that cuts of light in different steps.

After connection product is made, connection product can be expanded.In some embodiments, this method can include amplification the Two connection products, such as use PCR or another amplification methods.If using PCR, can be expanded in a certain way, Produce the amplified production being free in solution or tie the amplified production in holder at least one end.In some embodiments In, the second connection product can be cut off from holder, then expands it.

In some embodiments, holder can be plane.In other embodiments, holder can be bead Deng.In a particular embodiment, holder can tie oligonucleotides colony comprising multiple surfaces, wherein each surface ties widow Nucleotide colony occupies the region of spatially unique (the spatially distinct) on holder, such as the shape with array Formula.In a further embodiment, holder can be micropore (microwell), nano-pore (nanowell) or micromicron hole (picowell) array.In these embodiments, the colony of multiple double chain oligonucleotides can be produced, such as mixing Thing, and (i.e., wherein " group " will be by that will connect for the multigroup double chain oligonucleotide of jag permission of the second end of those oligonucleotides The oligonucleotides composition being connected together) it is spatially separated each other in substrate, so that the double chain oligonucleotide for allowing each to organize exists Link together in one limited area, and the interference of the double chain oligonucleotide from other groups.Therefore, in some embodiments In, each double chain oligonucleotide in one group will have the same or similar second jag, and (that is, the second jag can include " index " (indexer) sequence), and the double chain oligonucleotide of different groups has the index few nucleosides for hybridizing to and being combined with substrate The different jags of the different zones of sour (indexing oligonucleotide).In such embodiments, it is various double Part (the spatially separate that chain oligonucleotides can be spatially separated in discrete (discrete) of matrix Parts link together in).Because after Initial hybridization step, all reactions are all attached to substrate comprising (involve) Molecule, so it is any processing (such as washing, enzymatic treatment etc.) can by by it is all reaction at the same time exposed to processing come complete Into, such as by the way that substrate is dipped into the solution containing processing, substrate is flooded with processing, or the top for making processing flow through holder. In other embodiments, keep each reaction to be separated from each other, and carried out in droplet of the various processing in support surface.

In such multiple (multiplex) embodiment, this method can include obtaining multigroup double chain oligonucleotide Mixture, wherein each group corresponds to a different synthon, and the double chain oligonucleotide of different groups is second last at it End has different jags, so as to allow them to be spatially separating on array.Such double chain oligonucleotide can be under State means preparation：On the surface of same substrate the various single stranded oligonucleotides of fabricated in situ (for example, using such as Cleary, Nature Methods 2004,1:241-248, LeProust et al., Nucleic Acids Research 2,010 38: The method of 2522-2540), these oligonucleotides are cut from holder, then in the solution hybridize them together.Can be with Every group of oligonucleotides is assembled to produce synthon, you can every group of oligonucleotidase is assembled into a longer sequence, which presses The sequence from each double chain oligonucleotide is included according to the order of restriction.

As described above, each oligonucleotides in every group can each include identical " index " (indexing) jag, And allow they being grouped on array.In other words, the oligonucleotides in every group contains identical jag, and different groups In oligonucleotides project through end difference each other.In these embodiments, this method can be included Double stranded oligonucleotide The mixture and hybridization array of acid, so that different groups of oligonucleotides be spatially separated from each other.In these embodiments, one group Double chain oligonucleotide be positioned at a feature, another group of double chain oligonucleotide is positioned at another feature.

In other embodiments, two or more sets double chain oligonucleotides combine two or more sequences in same feature Row.For example, this can so be realized：The different zones of feature, or use are utilized to attach to for each double chain oligonucleotide or group The mixture of two or more probes of solid support.

Then synthon can be collected in water phase, and in some cases, uses the position for being attached to synthon end The primer (such as universal primer) of point expands synthon.Alternatively, can will each it be closed by using the stringent elution protocol of high temperature A chain of Cheng Zi is denatured from the Article 2 chain for covalently attaching to solid support.This method can be used for parallel preparation at least 10 It is a, at least 50, at least 100, at least 500, at least 1,000, at least 5,000, at least 10,000, at least 50, 000 or at least 100,000 synthon.In other embodiments, by using the primer in solution phase, in situ can expand Increase synthon, i.e., expanded while they attach to the surface of array,.

Synthon can have any sequence in itself, in some cases, can be with encoding amino acid sequence, you can be Coded sequence.In other embodiments, synthon can be regulatory sequence, such as promoter or enhancer.In particular case Under, synthon, which can encode, adjusts RNA.In some cases, synthon may have biological function or structure function.

Under specific circumstances, synthon can be cloned into the expression vector designed for expression synthon.At these In embodiment, expression vector can include promoter, terminator and other required controlling elements, to realize turning for synthon Record, and in some cases, realizes the translation of synthon, or as single protein or as with another protein Fusions.In these embodiments, this method can also include expression vector being transferred in cell to produce by synthon The expression product (such as protein) of coding.The embodiment of this method can include the activity of screening expression product.

Illustrate an a kind of example of implementation of this method below.In some embodiments, this method can wrap Include：

1. be hybridized in solution phase to complementary oligonucleotide to produce double chain oligonucleotide；

2. optionally handling the double chain oligonucleotide, such as using Mut-S, contain vicious Double stranded oligonucleotide to reduce The number of acid；

3. by the mixture and hybridization array of double chain oligonucleotide, so that by different groups of double chain oligonucleotide space each other Separation, one of them " group " is made of the double chain oligonucleotide to be assemblied together；

4. wash away uncombined oligonucleotides；

Add ligase and double chain oligonucleotide is connected to substrate to linking together, and by some double chain oligonucleotides On oligonucleotides end (an end of an oligonucleotide on the substrate)；

6. cut prominent end (chemical mode, photochemical way pass through restriction enzyme)；

7. optionally handle connection product, such as with T7 endonuclease enzymatic treatments, contain vicious connection product to reduce Quantity；

Connection product is joined together to form the second bridging, and optional 3rd bridging, the 4th bridging or higher The bridging of rank.

9. optionally, the necessary number of any step in repeat step 2 to 8, to form the synthon of desired length, and And each continuous Connection Step doubles synthon length.

Below by each progress to these steps deeper into description.Following description is how to realize this method Example, is not intended to be construed as limiting.

The prehybridization complementary oligonucleotide pair in solution phase

By large scale process (for example, using Cleary et al., Nature Methods 2,004 1:241-248, LeProust et al., Nucleic Acids Research 2010,38:The method of 2522-2540) the multigroup DNA few nucleosides of synthesis Acid, these DNA oligonucleotides groups are designed to that the long double-stranded DNA for being formed in two ends and being respectively provided with single-stranded overhang will be hybridized Chain.There are 5' jags an end, it is the index sequence (10-40nt) of moderate-length, it is therefore an objective to for by the duplex The surface in feature being specifically attached on array ties oligonucleotides.These protrude some in sequence, or even all, It is connected by cleavable joint sequence with double stranded region.Specific ordered fabrication is useful in opposing end portions to form longer double-strand The jag of DNA.The jag can be 3' ends or 5' ends.Fig. 1 depicts these oligonucleotides pair in the solution.It is few The total length of nucleotide can be between 100 to 400 nucleotide.In some embodiments, it is combined with the surface probe Jag on the immobilization part of the oligonucleotides of (surface-bound probe) hybridization is significantly longer.Shorter few nucleosides The 3' ends of acid can then be extended after Connection Step by archaeal dna polymerase.The embodiment has under such a condition Profit：The different oligonucleotides of two or more in complicated DNA mixtures are so similar, so that they may be non-specific Property crisscrossing, but they close to (toward) oligonucleotides connection end (ligating ends) region in contain There is identical sequence.In this case, polymerase can extend shorter oligonucleotides to each end compared with long oligonucleotide. Alternatively, the archaeal dna polymerase of no strand-displacement activity can be used only to fill and lead up the single-stranded regions of synthon, it is allowed after the cutting step It is connected again.

In some embodiments, by with the long single strand oligonucleotide acid construct double chain oligonucleotide for stablizing hair clip.At this In embodiment, II types or IIS limitation cleavage hair clips can be used, leaves attachable jag.Although this structure side Formula seems less efficient for preparing long oligonucleotides, but it is difficult to as complete for structure in complex mixture Match double-stranded duplex annealing oligonucleotides --- either due between different unique oligonucleotides have homology or It is due to the annealing that secondary structure can inhibit complementary double chain oligonucleotide --- provide practical way.IIS types restriction enzyme identifies Asymmetric D NA sequences are simultaneously cut outside its identification sequence.Therefore, IIS types Restriction Enzyme provides a spy relative to II types Other advantage, i.e. their recognition site can be included in stem to be cut and abandon, so as to not form a part for synthon. Its advantage is that synthon can be any sequence, and from include identification sequence constraint.In this embodiment, can relate to And repeatedly sequentially bridge in the different phase of generation and use a variety of restriction enzymes.

Attached at other using 5' ends in the embodiment of the DNA arrays of surface and 3 ' free ends, immobilization is dashed forward Outlet must be positioned at the 3' ends of each double chain oligonucleotide.

In other embodiments, a chain of double chain oligonucleotide to be connected or two chains are made of RNA, and And these oligonucleotides are connected by RNA ligase, such as T4RNA ligases 2.The embodiment does not have RNA/DNA crossbreds, Allow to digest one chain of enzymic digestion by using RNA to build long single strand dna oligonucleotide, without high-temperature denatured.

The mistake of double chain oligonucleotide is reduced by Mut-S in the solution

In some embodiments, reduced by using Mut-S or other similar enzymes removal projection sequences wrong possible It is useful.The property that Mut-S is combined with base matched with mispairing in double-stranded DNA and small single-stranded loop.Referring to：Siying Ma, Ishtiaq Saaem and Jingdong Tian, " Error Correction in Gene Synthesis Technology ", Trends Biotechnol.2012Mar；30(3):147-154.

If it is attached into bead (or other solid supports), or (antibody attaches in itself with antibody binding by it Bead (such as magnetic bead)), and those are removed from solution phase, it can be used to remove the sequence with resultant fault.

The mixture of double chain oligonucleotide is hybridized into index array

After reducing mistake, by the mixture and hybridization array of double chain oligonucleotide.In some cases, by probe oligonucleotide Sour (that is, the oligonucleotides for being connected to array) is attached to substrate in its 3' end.The product of the hybridization step is shown in figure 3. The length of these probe oligonucleotides can be between 10 nucleotide and 100 nucleotide, in some embodiments can be with 20 between 60nt.In some embodiments, dashed forward by all duplexs for giving index feature targeting including common 5'- Outlet index sequence.In other embodiments, for them, there are two different indexes for each target signature It may be advantageous for sequence, and one of subset and the 3' ends of index probe are complementary, and another subset is complementary with 5' ends.The latter is real Apply example figure 3 illustrates.

The present invention method can be in flow cell or on single glass slide flow cell array on or two Implement between a glass slide.If using two glass slides, can be assembled using one or two glass slide.Allow reagent Flow into flow cell, and rinsed out after each step.Flow cell is further equipped with temperature control.Between two glass slides or The distance between top surface and lower surface are minimized, and to minimize reagent volume, while maximize concentration.With array The optimum condition of hybridization be well known to a person skilled in the art.

As an example, flow cell (flow cell) can include two glass slides, they are pressed together to form appearance The sandwich being contained in metal shell.One in two glass slides may have separating device (dividers), such as peace victory Human relations gasket type glass slide (gasket slide) (2 bags, 4 bags or 8 bag forms), to form multiple flowings in each glass slide Pond.Flow cell can include being used for the permanent port that reagent is output and input.Alternatively, gasket can provide between glass slide It is enough the gap (for example, about 400 μm) for being inserted into pin (for example, No. 30 pins, about 310 microns).These pins can be used for injecting reagent In flow cell.For example, two pins are inserted through packing ring in the position of the relative angle in each hole.A piece pin is used to inject or elution reagent, It is used to allow air discrepancy pond positioned at another pin of relative angle, and pressure is held in environmental pressure.Metal shell space is about Beam glass slide, and with the surface directly contacted with a glass slide.The metal surface uses Peltier (Peltier) formula Cooler carries out temperature control, suitable for any temperature between 4 DEG C to 100 DEG C.For example, connection can be in 16 DEG C of progress, product Any temperature denaturation between 50 DEG C to 80 DEG C.Same setting can also be used for the hybridization of oligomer (oligos) and array. It can be automated moreover, reagent flows into and out pond using robot.

Wash away uncombined oligonucleotides

After hybridization, incomplete structure and uncombined few nucleosides are washed off with stringent wash solution and stringent temperature Acid.This stringency ensures only have construct will be in the oligonucleotides of this feature over-assemble on each chemical feature.The step Many incomplete oligonucleotides of synthesis can be removed, because they are typically what is synthesized from its 3' end to its 5' end.

Add ligase and assemble double chain oligonucleotide (connecting some 5'- ends for arriving probe oligomer)

The mixture of ligase and ligase buffer solution (with suitable co-factor, ATP or NAD) is added to flow cell In, the shorter jag of double chain oligonucleotide is connected to each other, as shown in Figure 4.Only those complementary jags are just by enzyme Connection.In addition, the complementarity is used to define the assembling sequence of each several part to generate total length synthon.It is the most useful to the process Ligase is such ligase：It has excellent activity at a temperature of probe oligonucleotides keep annealed condition, and right There is activity more stronger than flat end in protruding terminus.This is compatible with most of non-thermostable enzymes.The good example bag of these enzymes Include T7- ligases and T4- ligases (NEB, Enzymatics or Qiagen).See, for example, Pohl etc. (Eur.J.Biochem, 1982,123：141-52) and Ferretti et al. (Nucleic Acids Research 1981,9:85).

Optionally, for some downstream processes, it is probably useful that some constructs, which are connected to capture probe,.This can lead to Crossing design oligonucleotides makes its recessed end tie the end of oligonucleotides close to the surface on array easily to realize.Will be with The oligonucleotides that this mode connects is the oligonucleotides positioned at the 3' ends of final total length construct.Can in order to become this Can, the oligonucleotides that surface ties can have phosphate group in the 5'- ends of its exposure.Fig. 4 depicts the few nucleosides of assembling Acid tying on array forms bridging between probe, indicates that oligonucleotides is connected to capture probe with point.

Cut jag end (chemical mode, photochemical way pass through restriction enzyme)

One end of the protrusion for the duplex that can be each connected by cutting, and if desired, by raising temperature (but not high to the duplex for melting longer construct) melts prominent fragment, to discharge the one of each bridging construct End.This cutting can be realized by enzymatic, and digestion is carried out using restriction enzyme；It can also be realized by chemical means, Utilize cleavable connector.Cleavable connector (being represented by the small circle in Fig. 4) can light cut or chemically cut, Efficiency depending on available chemical means.The cutting of jag will not leave behind flat end, but leave several (1-10) cores The short jag of thuja acid, to allow the specificity of construct to connect, as shown in Figure 5.After jag is cut, depending on being made The chemical property of cleavable connector, it may be necessary to by add phosphoric acid (using kinases) repair the 5 ' of remaining construct- End.

T7 endonucleases are reduced wrong (optional)

Another wrong reduction method may be used herein, it utilizes T7- endonucleases I.This enzyme identification mismatches DNA, including cross (cruciform), Holliday structures, junction surface and heteroduplex, then in mismatched regions 5' Cutting has vicious double chain oligonucleotide at the phosphate bond of side.If carrying out wrong reduction, can heat flow cell at this time makes It is denatured double stranded, array is strictly washed in the state of heat to remove the fragment of cracking.

Double oligomeric products are connected to form the second bridging, the 3rd bridging or the 4th bridging

As described above, the mixture of ligase and ligase buffer solution is added in flow cell, by double-strand construct Shorter protruding terminus be connected to each other, as shown in Figure 6.Equally, only those complementary jags are just connected by enzyme.At this time, entirely Long construct includes four original synthetic oligonucleotides, almost four times of the total length of original synthesis.It is as shown in fig. 7, complete Into two chains of synthon may be incorporated on holder.Can continue connect oligonucleotide product formed the 3rd bridging, The bridging of 4th bridging and higher order.

At this point it is possible to optionally cut down connexon from array (such as utilize restriction enzyme or orthogonal cleavable Connector) to collect synthon, and (en masse) is expanded in the lump.Alternatively, synthon can be expanded without it is cut from array Cut off, such as use Standard PCR.In these embodiments, PCR can be carried out in batch fashion, and method is entirely to flow Main pre-composition is full of in dynamic pond room and carries out thermal cycle.Alternatively, as described in US20150361422, can be in support surface On droplet on carry out amplified reaction.

Embodiment

According to following embodiments it will be further appreciated that present invention teach that aspect, these embodiments be not necessarily to be construed as with Any mode limits the scope of this teaching.

Several steps of above-described scheme by experimental demonstration.Especially, the first Connection Step is demonstrated, wherein Two double chain oligonucleotides link together on array, and connection yield is up to 80%.

Embodiment 1

In this experiment, two 80nt oligonucleotides and two 50nt oligonucleotides are handled with kinases (makes its 5' end Phosphorylation) and hybridize each other in the solution.By 100 picomole oligonucleotides and microarray at 55 DEG C in 1ml hyb buffer solutions Hybridize 13 it is small when.

Four hole cells are cooled to 3 DEG C on temperature control block, and cooling is kept during sample-adding.With syringe needle and syringe 84,000 unit T7 ligases and the enzymatic mixture of nominal ATP are loaded with one array.The hole quickly elutes, on the surface Leave the droplet of enzyme.Cell is backfilled with fluorinated oil (Novek 7500) to keep drop.30ul 10mM ATP solution is added Into the eluate in the first hole, and it is expelled in the second hole.Identical program is used to the third and fourth hole using T4 ligases. Device is warmed to 20 degree 30 minutes, be then warmed to again 25 DEG C it is 30 minutes other.Remove the oil in each hole.Into each hole 150 μ l water are added, device is heated to 60 DEG C.Product is taken out with pin and syringe.Use High-Sensitivity The PCR product of Bioanalyzer chip analysis each sample and the first hole product.These results are as seen in figs. 8-10.These rails Mark shows peak to following bands：The relatively short strip being made of the original double chain oligonucleotide of about 100bp, and the product one with being connected The longer band about at 200bp of cause.The result shows that reaction yield is about 8%-32%.These conditions are not yet optimized, it is contemplated that Much higher efficiency can be realized after optimization.

Embodiment 2

In this experiment, using being obtained from IDT and by the oligonucleotides of IDT PAGE two 80nt purified and two The oligonucleotides of 50nt demonstrates 2 partly assembled efficiently connections.Synthetic oligonucleotide from third-party vendor is in its 5' End do not have phosphate group, unless otherwise specified modification.In the oligonucleotides that those will be connected in 5' ends in building-up process In in the situation that is not phosphorylated, it is necessary to handle oligonucleotides with kinases to add 5' phosphate groups.In these experiments, this phosphorus Acidifying uses the T4 polynucleotide kinases (PNK) (M0201S) from NEB, and follows Experimental Procedures as defined in manufacturer, sometimes Implement in specified kinase buffer liquid, implement in T4- ligase buffer solutions in the case of other.

Oligonucleotides carries out preannealing in the following manner.By complementary oligonucleotide to mixing, without index sequence Shorter oligonucleotides is excessive relative to its longer spouse's oligonucleotides with index sequence.Concentration is in 10 to 100 μ In the range of M, any buffer solution for being suitable for annealing, including T4 ligase buffer solutions are used.Oligonucleotides is heated to 80 DEG C, so After slowly cool to 4 DEG C.If necessary to phosphorylated oligonucleotide, the two steps are merged and are followed in same reaction, and in heat Run on ring instrument.

For hybridization reaction, all 4 oligonucleotides (two pairs of duplexs) are mixed and are diluted to 8 μM of concentration (duplexs Concentration).The complementary series on 5' ends that relatively long oligonucleotide in each duplex passes through the single-stranded and 60bp probes of 30nt Hybridization, another duplex are combined by a different 30bp sequences, and the 3' ends of the 30bp sequences and same probe on array are mutual Mend.Shorter oligonucleotides is excessively in order to ensure most longer widows for being annealed to array relative to its longer gametophyte Nucleotide will possess the gametophyte of complementation.Each reaction is only carried out with independent one group of oligonucleotides, so as to use BioAnalyzer^TMRead, to measure joint efficiency.By oligonucleotide mixture (25 μ L) with 400 μ L Agilent's CGH hybridization buffers (P/N 5188-5221) and the mixing of 400 μ L water.By the mixture of 520 μ L and full glass slide 244k forms Hybridization array, hybridization using Agilent SureHyb cells, temperature be 50 DEG C, swing circle 10s.Rise for convenience See, the operation of typical hybridized overnight, but in view of the simplicity of mixture and the excess of solution phase oligonucleotides, much shorter it is miscellaneous The time is handed over to be likely to same effective.

Use relatively low washing stringency.By glass slide immerse Agilent CGH Wash-1 solution baths in 1 minute, so Dried up afterwards with nitrogen.

Coupled reaction can be carried out with any array format.In this experiment, using 4 bag forms, to allow four at the same time Reaction, each reaction carry out in a different hole.NEB T4-DNA ligases (M0202L) are prepared in ligase buffer solution In connection solution.Connection enzyme concentration changes to 4 μ L from 0.5 μ L, is separately added into the solution of 150 μ L, to measure performance almost Do not influence.Sandwich of one piece of the assembling comprising 1 piece of Agilent gaskets glass slide (G534-60013) and 1 block array glass slide, And about 100 μ L connection enzyme solutions are full of in every hole.Assembly is maintained at 16 DEG C --- the recommended temperature of T4 ligases.In order to It is convenient, coupled reaction be performed for more than 8 it is small when, although the time that reaction is completed than this much shorter, it is substantially (similar in a few minutes scope Subsequent reactions in experiment carry out 10 minutes, as a result similar).

After connection, solution is eluted out from hole, each hole is refilled with the water without nuclease.In order to harvest, Temperature is risen to 50 DEG C, the product in A holes and B holes is eluted, then refills and elute at 60 DEG C, filled again at 70 DEG C again Expire and elute, and C holes and D holes are eluted at just 70 DEG C.For enriched product, often the solution in hole freezes in the future, then with 5 μ L Water rehydration, analyzes wherein 1 μ L.

Using the high sensitivity DNA kits (5067-4626) of Agilent, to sample on Agilent BioAnalyzer Product are analyzed.The gel format chart in all 4 holes is shown in fig. 11.Except with double stranded oligomer Asia assembly (" only portion Point ") swimming lane 8 outside, black stripe can be clearly seen about at 180bp in all swimming lanes.Swimming lane 4 is represented in micro-pipe The positive control construct of middle connection.Swimming lane 1-3 represents the production eluted at 50 DEG C, 60 DEG C and 70 DEG C from DNA arrays of hole A The content of thing.Similarly, swimming lane 5-6 is hole B.The array included in hole C and hole D is only eluted at 70 DEG C.Four differences Hole there is different amounts of T4 ligases, be 4 μ L in A holes, minimum D holes, 0.5 μ L be decremented to 2 times.Figure 12 shows hole A The array eluted at 50 DEG C, 60 DEG C and 70 DEG C on connection product electrophoretogram.

Add the ratio between concentration summation of product to estimate reaction yield with each component by the concentration for calculating full length product, such as scheme What the table shown in 13 provided.The total yield each reacted is for 74% to 83%.When enzyme concentration is relatively low, yield does not appear to Significantly reduce, show that it is probably feasible further to reduce.In addition, it is found that since connection product is in the joint entropy of the hybridization at both ends Effect, can reach the higher purity of full length product, this is because not by carrying out continuous elution at several incremental temperature The input material of folding has lower slightly melting temperature.

Following sequence is used for the demonstration of 2 parts assembling (5' to 3')：

B1 parts-positive chain：

CATGCTACGTATCGCAGTGATTGCACAACGAGATGACTCAGGCGGACCTCTTATCTGCGATGGCATCTTGCAGGGCA CGA(SEQ ID NO:1)

B1 part-reverse strands：

ATTAGTATAAATGGCAGGTACCCCTGGCTTGCCGCAGGGGACTGGCCCAT(SEQ ID NO:2)

B2 parts-positive chain：

GGGGTGATGGAGCCCCAACCGGAAGCAAGACACTTTGAACCGGGTTTCGG(SEQ ID NO:3)

B2 part-reverse strands：

CTATACGACTCTAGGCGTGTACCATGTGGTCCAGCGTTCTTCATCATCGTATCTTTGATCCAAGAATTAAATTTGAT CAA(SEQ ID NO:4)

A1 parts-positive chain：

CATGCTACGTATCGCAGTGATTGCACAACGGACGTAATGCTTTGTGCTGGCGAAATGGGAGGGGGAAAAGATACGTG TAG(SEQ ID NO:5)

A1 part-reverse strands：

TCATCTCTACACGTATCTTTTCCCCCTCCCATTTCGCCAGCACAAAGCAT(SEQ ID NO:6)

A2 parts-positive chain：

AGATGACTCAGGCGGACCTCTTATCTGCGATGGCATCTTGCAGGGCACGA(SEQ ID NO:7)

A2 part-reverse strands：

CATGCTACGTATCGCAGTGATTGCACAACGGACGTAATGCTTTGTGCTGGCGAAATGGGAGGGGGAAAAGATACGTG TAG(SEQ ID NO:8)

Index array sequence (5' to 3')：

Index1_on_Index2

CGTTGTGCAATCACTGCGATACGTAGCATGACCACATGGTACACGCCTAGAGTCGTATAG(SEQ ID NO:9)

Index2_on_Index1

ACCACATGGTACACGCCTAGAGTCGTATAGCGTTGTGCAATCACTGCGATACGTAGCATG(SEQ ID NO:10)

Index3_on_Index4

ACAGGTTCAGAGTTCTACAGTCCGACGATCCTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:11)

Index4_on_Index3

CTGGAGTTCAGACGTGTGCTCTTCCGATCTACAGGTTCAGAGTTCTACAGTCCGACGATC(SEQ ID NO:12)

Embodiment 3

In this experiment, demonstrate and build connection product using 4 oligonucleotides duplexs.In the experiment and embodiment 2 Two parts assembling of description is closely similar, i.e., bridging is formed between two duplexs, but has two pairs of different duplexs, wherein Short (30 aggressiveness) single-stranded segment area in one of two chains that each duplex passes through each duplex is tied to surface.Difference Place is that one end of each bridging is cut, and leaves index and ties sequence (indexing tether sequence) and (array ) surface combine oligonucleotides combine.In this embodiment, cutting is the index part and goods by cutting oligonucleotides Between thing part (cargo portion) can light cutting connector (Trilink Biotechnologies provide PC- connect Head), and leave the 5' jags with phosphate in the free-end of double-strand intermediate product and realize.Since this is for each spy Two different oligonucleotides constructs in sign can all occur, and each construct has complementary overhangs, so these End can freely be bonded to each other.This is realized by two methods.In first method, connection enzyme solutions are loaded In hole and allow its work 10 minutes, light is cut after elution, and is refilled cell with fresh oligonucleotide solution and reacted 10 points Clock.Light cutting is exposed 10 minutes with the LED infrared lamps of 365nm.In another individually hole, whole process is molten using identical connection Liquid, is exposed under UV lamp in 10 minutes intervals of the coupled reactions of 30 minutes.

In order to designed for complicated 2 partly assembled oligonucleotides, by from full glass slide array (full-slide Array 244,000 feature oligonucleotides (feature oligos)) are cut to produce each oligonucleotide library (OLS). In this case, the structure in each library is to piece one of (tile) three full-length genes together on single-stranded at one of each duplex With 50,80,120 and the oligonucleotides of 170bp, primer (23 or 25bp) and an index sequence (30bp) are read plus one, As shown in figure 14.Said gene includes 58 or 68 sections, and the wherein adjacent section of each pair is designed to form a construct.Though So each construct is adjacent in the gene, and each construct is respectively provided with 5' jags at both ends, but does not have group Directly being intended to for full-length gene is filled, but just for the sake of demonstrating the ability currently measured.Therefore, there are 1800 to 2100 features It is used to each oligonucleotide sequence.

The design of construct is semirandom --- for which oligonucleotide length will be assembled together.Therefore, Some shorter oligonucleotides duplexs are connected with longer oligonucleotides.Each longer few nucleosides of each construct All include common reading primer in sour (index) sequence, but each construct of each gene is prepared by different libraries PCR primer (library prep PCR primers) PCR amplification, there is different readings to index.

The OLS Library Oligonucleotides so built do not have phosphoric acid in its 5'- end, therefore handle them with kinases, swash The independent oligonucleotides of enzymatic treatment as described above equally carries out.Hybridization and connection measure also as discrete oligonucleotides into OK, wherein the approximately half of product (5 picomole) in each OLS libraries is in a different hole.Contain all in 4th hole The mixture in three libraries, but each library only has 1 picomole.Each index array has for each index oligonucleotides 100th, 200 and 400 features, wherein most of index oligonucleotides have 100 features.It is connected at 16 DEG C and carries out, uses Excessive T4 ligases, common 12uL are added in 700uL cumulative volumes, so used for all four holes；Wherein each hole makes With the connection enzyme solutions of 120-150 μ l.

It is every from the elution of each array at 3 temperature (50 °, 60 ° and 70 DEG C) as described in for discrete oligonucleotides A library for having assembled construct, and use 60 ° of eluents in subsequent sequencing measure.Pass through 10 with sequencing adapter The each library of PCR amplification of circulation, uses the Herculase of Agilent Technologies^TMBuffer solution, according to manufacturer Regulation carries out.Library through amplification is purified using SPRI beads to remove small DNA, such as primer.Each independent library is cleaned Amplified production show in fig.15.The 4th hole with library mixture does not show significant production under 10 PCR cycles Thing, but show significant product under 15 circulations.Cleaned amplified production uses 75bp pairing end reading reagent boxes (paired-end read kit) is run on Illumina MiSeq sequenators.

Specific testing standard is：Compared with detecting how many expected constructs, unexpected construct it Between there occurs how many interconnection.This is assessed by using paired end sequencing, wherein by with the sequence of complete genome ratio To positioning all reads.For correct construct, read 1 is alignd with first section of each construct sequence, and Read 2 (in the other end of PCR product) is alignd with second section of identical expection construct sequence.

The total pairing read number to align with gene EK499 is 7,186,818.Wherein, for all 34 constructs, read The number for the read that section 1 is alignd with the Part I of construct and read 2 is alignd with the Part II of same target construct is equal For 7,166,833 countings.And the summation of all reads across different constructs is 3148 countings, it means that only There occurs nonspecific interconnection for 0.04% oligonucleotides.In this group of construct, only a pair of of construct shares one A 5-bp protrudes terminal sequence.For solution is connected --- between wherein all oligonucleotides with common jag Can freely interconnection --- interconnection may be close with targeting connection.But for this process, pass through By the oligonucleotides for attaching to solid phase, specifically space is isolated from each feature, and the interconnection measured is only 353 countings, Far below the 1% of the counting of two expected constructs --- it is respectively 329,734 and counts and 207,704 countings.

Figure 16 is shown to be compared and the presentation of definite expection construct by read 1 and read 2.The structure for presenting at least Body is the 9th construct, only 3108, is about the 1/25 of the median of other constructs.This specific construct is most long One of construct, have 295bp.Figure 17 is shown, compared to shorter construct, the presentation degree of longer construct is small to be obtained It is more.There are several potential presentations for influencing that longer construct may be reduced.Firstly, since the nucleotide coupling during synthesis Yield, compared with shorter oligonucleotides, long full length rna oligonucleotide is less.For 99.2% every base coupling yield, It can cause 300nt 5 constructs fewer than 100nt.If less with the oligonucleotides of index probe hybridization in feature, few nucleosides The density of acid will be relatively low, this make it that forming bridging by connection is more difficult from, and reduces yield.Finally, due to preparing to use Product is all by PCR amplification during the library of sequencing and during sequencing, it is likely that some reductions be due to PCR to compared with The efficiency of long amplicon is less than to caused by the efficiency of shorter amplicon.The combination of these factors usually makes longer construct Production efficiency is well below shorter construct.

For clearness of understanding, by illustrating to have carried out foregoing embodiments in detail with exemplary mode Description, but those of ordinary skill in the art in view of above-mentioned teaching can with it is obvious it is carried out it is some change and modification without departing from The spirit or scope of appended claims.

Exemplary

Provided herein is method include：

The method that embodiment 1. prepares connection product, including：By the first double chain oligonucleotide and the second Double stranded oligonucleotide Substrate of the acid hybridization to the oligonucleotides tied comprising surface；And the surface distal end of the first and second double chain oligonucleotides is connected Together, so as to produce the first connection product tied at both ends in holder.

The method of 2. embodiment 1 of embodiment, wherein：

(i) the first double chain oligonucleotide is respectively provided with jag at both ends；

(ii) the second double chain oligonucleotide is respectively provided with jag at both ends；

(iii) jag of the first end of the first and second double chain oligonucleotides is that connection is compatible；With

(iv) jag of the second end of the first and second double chain oligonucleotides and the oligonucleotides that surface ties are complementary.

The method of 3. embodiment 2 of embodiment, wherein the first end of first and second double chain oligonucleotide Scope of the length of jag in 1 to 9 base.

The method of 4. embodiment 2 of embodiment, wherein the second end of first and second double chain oligonucleotide Scope of the length of jag in 10 to 40 bases.

The method of 5. any foregoing embodiments of embodiment, wherein the connection is also by first double chain oligonucleotide Proximal end surface be connected with the oligonucleotides that surface ties.

The method of 6. any foregoing embodiments of embodiment, further includes the surface for cutting second double chain oligonucleotide Near-end is to discharge an end of first connection product from the holder.

The method of 7. embodiment 6 of embodiment, wherein second double chain oligonucleotide includes cleavable connection, and And described cut through cuts the cleavable connection to realize.

The method of 8. embodiment 7 of embodiment, wherein second double chain oligonucleotide include can light cutting or can change The connection of cutting is learned, described cut through realizes connection product exposed to light or chemicals.

The method of 9. embodiment 6 of embodiment, wherein cutting using restriction enzyme to realize.

Method of the embodiment 10. according to any one of embodiment 6-9, wherein the cutting causes described the The end of one connection product produces jag.

The method of 11. embodiment 10 of embodiment, further includes positioned at the protrusion of the end of the first connection product End, which is connected to, ties the connection product in the 3rd double chain oligonucleotide of holder or containing the 3rd double chain oligonucleotide Compatible jag, so that producing both ends ties the second connection product in solid support.

The method of 12. embodiment 11 of embodiment, wherein the jag quilt positioned at the end of the first connection product The 3rd double chain oligonucleotide is connected to, wherein the 3rd double chain oligonucleotide has the first end and tool tied in holder There is the second end of jag as described below, which is to connect with the jag positioned at the end of the first connection product Connect compatible.

The method of 13. embodiment 11 of embodiment, wherein the jag quilt positioned at the end of the first connection product The 3rd connection product is connected to, wherein the 3rd connection product includes the 3rd double chain oligonucleotide, and wherein the connection is produced Thing is with tying in the first end of holder and the second end with jag as described below, the jag and first The jag of the end of connection product is that connection is compatible.

Method of the embodiment 14. according to any one of embodiment 11-13, further includes cutting second connection The end of product, so as to discharge an end of the connection product from the holder.

The method of any one of 15. embodiment 11-14 of embodiment, further includes amplification second connection product.

The method of 16. any foregoing embodiments of embodiment, wherein the holder is plane (planar).

The method of 17. any foregoing embodiments of embodiment, wherein hybridizing is not causing first and second double-strand Oligonucleotides carries out at a temperature of being denatured.

The method of 18. embodiment 17 of embodiment, wherein the hybridization is tight in the height that temperature is 55 DEG C to 70 DEG C Carried out under lattice or its condition of equivalent.

The method of 19. any foregoing embodiments of embodiment, wherein the substrate ties few nucleosides comprising multiple surfaces Sour colony, wherein each surface, which ties oligonucleotides colony, occupies spatially uniqueness (spatially on the holder Distinct region).

The method of 20. embodiment 19 of embodiment, wherein the substrate includes at least two, at least ten, at least 100 A, at least 1000 or at least 10,000 surface ties oligonucleotides colony, wherein each surface ties oligonucleotides colony Occupy spatially unique region on holder.In these embodiments, the oligonucleotides tied by surface occupies each Region can be the form of array.

The method of any one of 21. embodiment 6-20 of embodiment, is additionally included in elution at least twice described in elution First connection product, wherein the temperature of the first elution is less than the second elution.

Claims (14)

1. a kind of method for producing connection product, including：

First double chain oligonucleotide and the second double chain oligonucleotide are hybridized to the substrate that oligonucleotides is tied comprising surface；With

The surface distal end of first and second double chain oligonucleotides is linked together, is tied in the branch at both ends so as to produce Hold the first double-strand connection product of thing.

2. the method for claim 1 wherein：

(i) the first double chain oligonucleotide is respectively provided with jag at both ends；

(ii) the second double chain oligonucleotide is respectively provided with jag at both ends；

(iii) jag positioned at the first end of the first and second double chain oligonucleotides is that connection is compatible；With

(iv) jag positioned at the second end of the first and second double chain oligonucleotides ties oligonucleotides complementation with surface.

3. the method for claim 2, wherein the jag positioned at the first end of first and second double chain oligonucleotide Scope of the length in 1 to 9 or 10 to 40 base.

4. the method for claim 1 wherein the proximal end surface of the first double chain oligonucleotide is also connected to surface bolt by the connection It is oligonucleotides.

5. the method for claim 1, the proximal end surface of the second double chain oligonucleotide of cutting is further included with from holder release first One end of connection product.

6. the method for claim 5, wherein the cutting causes to produce jag in the end of the first connection product.

7. the method for claim 6, further include will be connected to positioned at the jag of the end of the first connection product tie in The compatible jag of 3rd double chain oligonucleotide of holder or the connection product containing the 3rd double chain oligonucleotide, so that Produce the second connection product tied at both ends in the solid support.

8. the method for claim 7, wherein the jag positioned at the end of the first connection product is connected to the 3rd double-strand Oligonucleotides, wherein the 3rd double chain oligonucleotide are with tying in the first end of holder and with as described below prominent The second end of outlet, the jag are connected compatible with the jag positioned at the end of the first connection product.

9. the method for claim 7, wherein the jag positioned at the end of the first connection product is connected to the 3rd connection Product, wherein the 3rd connection product include the 3rd double chain oligonucleotide, and wherein the connection product have tie in The first end of holder and the second end with jag as described below, the jag is with being located at the first connection product The end jag be connection it is compatible.

10. the method for claim 7, further includes the end of the second connection product of cutting, so as to discharge the company from the holder Practice midwifery an end of thing.

11. the method for claim 7, further includes amplification second connection product.

12. the method for claim 1 wherein the holder is plane.

13. the method for claim 1 wherein the hybridization is not causing the temperature of the first and second Double stranded oligonucleotides Acid denaturation Degree is lower to carry out.

14. the method any one of preceding claims, wherein the substrate ties oligonucleotides group comprising multiple surfaces Body, wherein each surface ties the region for the spatially uniqueness that oligonucleotides colony is occupied on the holder.