CN107937376B

CN107937376B - Pantoea amidase mutant, gene, engineering bacterium and application thereof

Info

Publication number: CN107937376B
Application number: CN201710974605.4A
Authority: CN
Inventors: 郑仁朝; 郑裕国; 金建强; 吴哲明; 汤晓玲
Original assignee: Zhejiang University of Technology ZJUT
Current assignee: Zhejiang University of Technology ZJUT
Priority date: 2017-10-19
Filing date: 2017-10-19
Publication date: 2020-10-02
Anticipated expiration: 2037-10-19
Also published as: CN107937376A

Abstract

The invention discloses a pansheng bacteria amidase mutant, a gene, an engineering bacterium and application thereof, wherein the amidase mutant is obtained by carrying out single mutation or multiple mutation on 105 th, 175 th, 301 th, 305 th or 309 th position of a pansheng bacteria amidase amino acid sequence shown in SEQ ID No. 2. Compared with the parent activity, the activity of the pantoea amidase mutant provided by the invention is improved by 2-3 times, the tolerance capacity to a substrate of 2-chloronicotinamide is over 200mM, even over 1M is realized through feeding, and the conversion rate can still be kept above 95%. The feeding method can effectively reduce the product inhibition effect of the 2-chloronicotinic acid on amidase or thalli, ensures higher catalytic efficiency, simultaneously enables the product 2-chloronicotinic acid to be separated out as far as possible, and facilitates the extraction and purification of the product. Therefore, the amidase mutant provided by the invention can be used for the industrial production of 2-chloronicotinic acid by an enzyme method.

Description

Pantoea amidase mutant, gene, engineering bacterium and application thereof

(I) technical field

The invention relates to a preparation method of 2-chloronicotinic acid, in particular to a pansheng bacterium amidase mutant, a coding gene and application thereof in preparing pesticide and medicine intermediate 2-chloronicotinic acid by hydrolyzing 2-chloronicotinamide.

(II) background of the invention

2-Chloronicotinic Acid (2-Chloronicotinic Acid, 2-CA for short), also known as 2-chloro-3-picolinic Acid, belongs to a 2-chloro compound of nicotinic Acid. 2-chloronicotinic acid is an important fine chemical intermediate and is widely applied to pesticide and pharmaceutical industries. In the field of pesticides, 2-chloronicotinic acid can be used for synthesizing bactericides, insecticides, herbicides and the like, such as nicosulfuron, diflufenican and the like (pesticides, 2003,42, 5-8; pesticides, 2013, 565-; in the field of medicine, the method can be used for synthesizing various antibiotics, cardiovascular disease treatment medicines and the like, such as an anti-AIDS medicine nevirapine, an antidepressant medicine mirtazapine, a non-steroidal anti-inflammatory analgesic niflumic acid, pranoprofen, nicotinmefenamic acid and the like (chemical and biological engineering, 2008,25, 5-8; pharmaceutical research, 2009,28, 485-one 487; US5,569,760; fine chemical intermediates, 2009,39, 37-39). In 2016, the domestic 2-chloronicotinic acid demand reaches 3350 tons (synthetic chemistry, 2016, 620-.

At present, the industrial production of 2-chloronicotinic acid mainly adopts a chemical method which can be divided into two methods (synthetic chemistry, 2011,19, 285-): based on the existing pyridine ring parent (CN 101817781; CN 104513198; CN103848783), directly chloridizing or introducing corresponding functional groups; secondly, the compound is synthesized by grafting and ring-closing reaction by using proper active straight-chain compounds (CN 102993092; CN 103193705; CN 104592104). However, the two chemical methods have the problems of long process steps, harsh conditions, low yield, more byproducts, heavy environmental burden and the like. In recent years, biocatalysis has rapidly developed into an important method for manufacturing bulk and fine chemicals due to its advantages of environmental friendliness, high selectivity, low energy consumption, degradable catalyst, and the like. Therefore, the development of a biocatalyst capable of efficiently producing 2-chloronicotinic acid is of great significance.

Currently, few studies on the biological preparation of 2-chloronicotinic acid are carried out, mainly by using amidase to hydrolyze 2-chloronicotinamide to prepare 2-chloronicotinic acid (CN 101857889; New Biotechnol.,2011,28, 610-615; Catal. Commun.,2013,38, 6-9; Protein Express. Purif.,2016,126, 16-25; Enzyme Microb. Technol.,2016,86, 93-102). Amidases (Amidase, EC 3.5.1.x) are a class of hydrolases that can catalyze the cleavage of amide bonds to produce corresponding carboxylic acids, have a broad substrate spectrum, and can efficiently catalyze the hydrolysis of various aliphatic, aromatic and heterocyclic amides. Amidase has great potential in the preparation of medicine and pesticide intermediates due to its good chemical and stereoselectivity, and is increasingly regarded by the industry. However, there have been reports of generally low catalytic efficiency of amidase hydrolysis of 2-chloronicotinamide. Therefore, it is necessary to improve the hydrolysis efficiency of amidase to catalyze 2-chloronicotinamide for industrial application.

Disclosure of the invention

The invention aims to modify the amidase (Pa-Ami) from pantoea through a protein site-directed saturation mutagenesis technology, provide a mutant protein, and improve the hydrolysis activity of the mutant protein on 2-chloronicotinamide, thereby being beneficial to the application of the amidase in the synthesis of 2-chloronicotinic acid.

The technical scheme adopted by the invention is as follows:

the invention constructs a mutation library by cloning and expressing the pansheng bacterium amidase gene from Pantoea sp (GenBank No. WP008109374) and performing site-specific saturation mutation on an expression vector containing the pansheng bacterium amidase gene by using a whole plasmid PCR technology. A96-well plate high-throughput screening model based on a real substrate is used for screening to obtain a series of amidase mutants with obviously improved activity on 2-chloronicotinamide, and 2-chloronicotinic acid is efficiently synthesized. Finally, the invention provides an amidase mutant from pantoea, which is obtained by carrying out single mutation or multiple mutation on 105 th, 175 th, 301 th, 305 th or 309 th position of an amino acid sequence of pantoea shown in SEQ ID No. 2.

Further, it is preferable that the pantoea amidase mutant is obtained by subjecting the amino acid sequence shown in SEQ ID No.2 to the following point mutations: (1) a mutation of glycine at position 175 to alanine; (2) threonine at position 301 is mutated to leucine; (3) alanine at position 305 is mutated to threonine; (4) serine at position 309 is mutated to tyrosine; (5) mutating the glycine at position 175 to alanine and the threonine at position 301 to leucine; (6) mutating the glycine at position 175 to alanine and the alanine at position 305 to threonine; (7) mutating glycine at position 175 to alanine and serine at position 309 to tyrosine; (8) the threonine at the 301 th position is mutated into leucine, and the alanine at the 305 th position is mutated into threonine at the same time; (9) the threonine at the 301 position is mutated into leucine, and simultaneously the serine at the 309 position is mutated into tyrosine; (10) alanine 305 to threonine while serine 309 to tyrosine; (11) mutating glycine at position 175 to alanine and threonine at position 301 to leucine, and simultaneously mutating alanine at position 305 to threonine; (12) mutating glycine at position 175 to alanine and threonine at position 301 to leucine while mutating serine at position 309 to tyrosine; (13) mutating glycine at position 175 to alanine and alanine at position 305 to threonine while mutating serine at position 309 to tyrosine; (14) the threonine at position 301 is mutated to leucine and the alanine at position 305 is mutated to threonine while the serine at position 309 is mutated to tyrosine; (15) the glycine at position 175 is mutated to alanine and the threonine at position 301 is mutated to leucine and the alanine at position 305 is mutated to threonine while the serine at position 309 is mutated to tyrosine.

Further, the amidase mutant is preferably that the 175 th glycine of the amino acid sequence of the pantoea amidase shown in SEQ ID No.2 is mutated into alanine, the amino acid sequence is SEQ ID No.4, and the nucleotide sequence is SEQ ID No. 3.

Furthermore, the amidase mutant is preferably that the 175 th glycine of the amino acid sequence of the pantoea amidase shown in SEQ ID No.2 is mutated into alanine, the 305 th alanine is mutated into threonine, the amino acid sequence is SEQ ID No.6, and the nucleotide sequence is SEQ ID No. 5.

The invention also provides a coding gene of the pansheng bacterium amidase mutant and a recombinant gene engineering bacterium constructed by the coding gene.

The invention also relates to an application of the pantoea amidase mutant in catalyzing 2-chloronicotinamide to prepare 2-chloronicotinic acid, and specifically the application takes wet thalli obtained by fermentation culture of engineering bacteria containing a pantoea amidase mutant coding gene as a catalyst, 2-chloronicotinamide as a substrate, and a buffer solution (preferably Tris-HCl buffer solution) with the pH of 7.5-8.5 (preferably the pH value of 8.0) as a reaction medium to form a reaction system, the reaction system is subjected to conversion reaction under the conditions of 30-60 ℃ and 150-500 r/min (preferably 40 ℃ and 200r/min), and reaction liquid is separated and purified after the reaction is finished, so that the 2-chloronicotinic acid is obtained. In the reaction system, the initial concentration of the substrate is 50-300 mM (preferably 200mM), the dosage of the catalyst is calculated by the weight of wet bacteria, and the final concentration is 1-10 g/L (preferably 10g/L) of the reaction system.

Further, the substrate is fed in a fed-batch manner, and when the residual concentration of the substrate in the reaction system is less than 20% of the last (i.e., the total amount added before feeding) (i.e., every 10 to 60min (preferably 15min)), the substrate is fed at a final concentration of 50 to 200mM (preferably 100 mM).

The wet thallus of the invention is prepared by the following method: inoculating the engineering bacteria containing the gene coding the panoxanil amidase mutant into LB liquid culture medium containing 50mg/L kanamycin at the final concentration, culturing for 12h at 37 ℃ at 150r/min, then transferring the engineering bacteria into fresh LB liquid culture medium containing 50mg/L kanamycin at the final concentration by the inoculum size of 1 percent in volume concentration, and culturing at 37 ℃ at 150r/min until the thallus concentration OD₆₀₀0.4-0.8, adding IPTG (preferably 0.1mM) with the final concentration of 0.1-1 mM into the culture medium, performing induced culture at 28 ℃ and 150r/min for 12h, centrifuging the culture, and collecting the precipitate to obtain wet thalli. The LB liquid medium consists of (g/L): peptone 10, yeast extract 5, NaCl 10 and a solvent of deionized water, wherein the pH value is 7.0; LB plate medium composition (g/L): peptone 10, yeast extract 5, NaCl 10, agar 15, solvent deionized water, pH 7.0.

The pansheng bacteria amidase mutant can be used in the form of engineering bacteria whole cells, can also be used in the form of crude enzyme without purification, and can also be used in the form of enzyme protein which is partially purified or completely purified. If necessary, the amidase mutant of the present invention can also be used in the form of immobilized enzyme or immobilized cell using an immobilization technique known in the art.

Compared with parent strain, the amidase mutant of the invention has greatly improved activity, and the reaction rate is still kept in a higher state when crude extract of the amidase or whole cells of engineering bacteria are used for catalysis. In addition, the amidase mutant provided by the invention can adapt to the catalytic temperature of 30-55 ℃.

Compared with the prior art, the invention has the following beneficial effects: compared with the parent activity, the activity of the pantoea amidase mutant provided by the invention is improved by 2-3 times, the tolerance capacity to a substrate of 2-chloronicotinamide is over 200mM, even over 1M is realized through feeding, and the conversion rate can still be kept above 95%. The feeding method can effectively reduce the product inhibition effect of the 2-chloronicotinic acid on amidase or thalli, ensures higher catalytic efficiency, simultaneously enables the product 2-chloronicotinic acid to be separated out as far as possible, and facilitates the extraction and purification of the product. Therefore, the amidase mutant provided by the invention can be used for the industrial production of 2-chloronicotinic acid by an enzyme method.

(IV) description of the drawings

FIG. 1 shows the comparison of the reaction progress of whole-cell catalysis of 2-chloronicotinamide (200mM) to prepare 2-chloronicotinic acid by amidase mutant G175A and amidase mutant G175A/A305T and parent amidase.

FIG. 2 shows the progress of the whole-cell feeding reaction of amidase mutant G175A in catalyzing 2-chloronicotinamide (initial concentration 200mM) to prepare 2-chloronicotinic acid, and the arrow indicates the feeding time point.

FIG. 3 shows the progress of the feeding reaction of amidase mutant G175A/A305T in whole cell catalysis of 2-chloronicotinamide (initial concentration 200mM) to prepare 2-chloronicotinic acid, with the arrow indicating the feeding time point.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1: site-directed saturation mutagenesis and screening of amidases

The site-directed saturation mutagenesis technology reference (appl. Microbiol. Biotechnol.,2014,98,2473-2483), and the high-throughput screening model reference for positive mutants (CN 100370034; appl. Microbiol. Biotechnol.,2007,74, 256-262). The specific process is as follows:

for pansheng bacterium amidase Pa-Ami (amino acid sequence) from Pantoea sp (GenBank No. WP008109374)The nucleotide sequence is shown as SEQ ID No.2, the nucleotide sequence is shown as SEQ ID No. 1) glycine (Gly, G) at 175 th site, threonine (Thr, T) at 301 st site, alanine (Ala, A) at 305 st site and serine (Ser, S) at 309 st site in the amino acid sequence are respectively subjected to saturation mutation, each mutation primer (see Table 1) is designed, plasmid pET28-Pa-Ami with a gene coding for pantoprazole amidase Pa-Ami cloned is taken as a template to carry out whole plasmid amplification, and the PCR system comprises 2 × Phanta Max buffer25 muL, 0.75 muL dNTP mix (10mM), 1 muL of each mutation upstream primer (50 muM) and downstream primer (50 muM), 0.5 muL of plasmid pET28-Pa-Ami, 0.5 muL of Max DNA polymerase, and H-ddd DNA polymerase₂And O is supplemented to 50 mu L. The PCR condition is pre-denaturation at 95 ℃ for 2 min; denaturation at 95 deg.C for 15s, annealing at 55-65 deg.C for 15s, extension at 72 deg.C for 6.5min, and performing 30 cycles; finally, extension is carried out for 10min at 72 ℃. After the PCR product is analyzed to be positive by 0.9% agarose gel electrophoresis, 20 mu L of the PCR product is taken, 1 mu L of Dpn I is added, enzyme digestion is carried out at 37 ℃ for 2-3h to remove template plasmid DNA, inactivation is carried out at 65 ℃ for 10min, competent cells E.coli BL21(DE3) are transformed, LB plate containing kanamycin (50mg/L) is coated, and culture is carried out overnight at 37 ℃ to obtain a mutant library of more than 300 clones. Single colonies were picked and inoculated into 96-well plates (containing 1mL of LB medium containing 50mg/L kanamycin), and cultured at 37 ℃ and 150rpm to OD₆₀₀About 0.5, then IPTG was added to a final concentration of 0.1mM and induced at 28 ℃ for 12 h. Taking a new 96-well culture plate, respectively adding 100 μ L of cultured bacteria liquid one by one, taking 2-chloronicotinamide (50mM) and hydroxylamine hydrochloride (100mM) as substrates, and reacting at 50 deg.C for 30 min. After completion of the reaction, 100. mu.L of the reaction solution was added to 200. mu.L of a color-developing solution (355mM FeCl)₃Dissolved in 0.65MHCl), and the engineering bacteria cells before mutation are taken as reference, the judgment is carried out according to the color change speed (yellow green → dark red) of a color development system, and the bacterial strains with the color change speed higher than that of a control group are selected as primary screening positive bacteria. After the positive clones obtained by screening are verified by activity determination, plasmids are extracted from the positive clones, and the point mutations introduced by each positive clone are determined by DNA sequencing to be respectively that glycine at the 175 th site is mutated into alanine (G175A), threonine at the 301 st site is mutated into leucine (T301L), alanine at the 305 th site is mutated into threonine (A305T) and serine at the 309 th site is mutated into tyrosine (S309Y), and the positive clones have the advantages ofThe body is shown in table 2. Among them, G175A has the highest activity, thus obtaining the amidase mutant engineering bacteria E.coli BL21(DE3)/pET 28-G175A.

Table 1: primer and method for producing the same

Note: n ═ a/G/C/T, K ═ G/T, M ═ a/C, B ═ G/C/T, H ═ a/C/T, Y ═ C/T, R ═ a/G, D ═ a/G/T, V ═ a/G/C, W ═ a/T, S ═ G/C.

Example 2: multi-site superposition saturation mutation of amidase mutant G175A

The saturation mutation technique and the high-throughput screening method for positive mutants are the same as in example 1. The specific process is as follows:

based on amidase mutant G175A, site-directed saturation mutagenesis was performed on alleles including threonine 301 (Thr, T), alanine 305 (Ala, A) and serine 309 (Ser, S), and whole plasmid amplification was performed using plasmid pET28-G175A of amidase mutant G175A as a template, and PCR systems of 2 × Phanta Maxbuffer 25. mu.L, dNTPmix (10mM) 0.75. mu.L, mutation upstream primer (50. mu.M) and downstream primer (50. mu.M) (primer sequences shown in Table 1) each 1. mu.L, plasmid pET28-G175A 0.5. mu.L, Phanta DNA Max polymerase 0.5. mu.L, ddH₂And O is supplemented to 50 mu L. The PCR condition is pre-denaturation at 95 ℃ for 2 min; denaturation at 95 deg.C for 15s, annealing at 55-65 deg.C for 15s, extension at 72 deg.C for 6.5min, and performing 30 cycles; finally, extension is carried out for 10min at 72 ℃. After the PCR product is analyzed to be positive by 0.9% agarose gel electrophoresis, 20 mu L of the PCR product is taken, 1 mu L of Dpn I is added, enzyme digestion is carried out at 37 ℃ for 2-3h to remove template plasmid DNA, inactivation is carried out at 65 ℃ for 10min, competent cells E.coli BL21(DE3) are transformed, LB plate containing kanamycin (50mg/L) is coated, and culture is carried out overnight at 37 ℃ to obtain a mutant library of more than 300 clones. The saturated mutant pools were screened as in example 1, except that the control was increased by a set of G175A mutant cells obtained in example 1. Positive clones obtained by screening are verified by activity determination (Table 2), plasmids are extracted, and introduced point mutations are determined by DNA sequencing, wherein the DNA sequencing of the positive clone with the highest activity shows that Ala at the 305 th position is mutated into Thr (A305T), so as to obtainAmidase mutant engineering bacteria E.coli BL21(DE3)/pET 28-G175A/A305T.

Example 3: parent amidase and amidase mutant engineering bacteria induced expression and purification

(1) Inducible expression

Positive mutant strains including a starting strain E.coli BL21(DE3)/pET28-Pa-Ami and a mutant strain E.coli BL21(DE3)/pET28-G175A (example 1), E.coli BL21(DE3)/pET28-G175A/A305T (example 2) were inoculated into LB liquid medium containing 50mg/L kanamycin, respectively, cultured at 37 ℃ and 150r/min for 12 hours, then inoculated at 1% (v/v) into fresh LB liquid medium containing 50mg/L kanamycin, cultured at 37 ℃ and 150r/min to a cell density OD₆₀₀0.4-0.8, adding IPTG with the final concentration of 0.1mM into the culture medium, carrying out induction culture at 28 ℃ and 150r/min for 12h, taking the culture, centrifuging at 8000rpm for 15min, collecting wet thalli, and using the wet thalli for enzyme activity determination and biological catalysis preparation of 2-chloronicotinic acid.

(2) Protein purification and concentration determination

Each 5g of wet cells was suspended in 50mL of Tris-HCl buffer (20mM, pH8.0), shaken well, and then disrupted for 20min using an ultrasonic cell disrupter. The cell disruption solution was centrifuged at 12,000rpm at 4 ℃ for 20min to remove cell debris, and the supernatant (crude enzyme solution) was collected for subsequent separation and purification. Purifying with a BioLogic LP low pressure chromatography system by Ni-NTA column, and collecting target protein when an absorption peak (AUFS value is greater than 0.1) appears until the peak appearance is finished. The eluted enzyme solution was then filled into dialysis bags (cut-off molecular weight 14kD) and dialyzed against 20mM Tris-HCl buffer (pH8.0) for desalting for 24 h. Protein content of the dialyzed enzyme solution was determined by Coomassie blue staining using Bovine Serum Albumin (BSA) as a standard protein (anal. biochem.,1976,25, 248-256.).

Example 4: activity assay of parent amidases and amidase mutants

The activities of the purified parent amidase and amidase mutants obtained in example 3 on 2-chloronicotinamide were determined separately. According to the enzyme protein concentration measured in example 3, the corresponding enzyme protein was diluted to 0.5mg/mL with 20mM Tris-HCl buffer (pH 8.0). The reaction system composition (1mL) was: 20mM Tris-HCl (pH8.0), 50mM 2-chloronicotinamide and 10. mu.L, 0.5mg/mL diluted enzyme protein were reacted at 50 ℃ for 10min, followed by sampling 100. mu.L, adding 20. mu.L of 1M HCl solution to terminate the reaction, supplementing to 1mL ultrapure water, filtering through a 0.22 μ M pore size microfiltration membrane, and then performing liquid chromatography. The liquid chromatograph is Hitachi Primaide; type of column: c18 column, 5 μm × 250mm × 4.6 mm; mobile phase: acetonitrile: water: phosphoric acid 250: 750: 1 (v/v/v); chromatographic conditions are as follows: the column temperature is 40 ℃, the detection wavelength is 270nm, and the flow rate is 1 mL/min. Definition of enzyme activity unit (U): the amount of enzyme required to catalyze the production of 1 micromole of 2-chloronicotinic acid from 2-chloronicotinamide per minute at 50 ℃ and pH8.0 is taken as one activity unit (U). The parent amidase Pa-Ami and partial mutant activity are shown in Table 2, the mutant activity is obviously improved compared with the parent, wherein the activity of the double mutant G175A/A305T is 3.7 times of that of the parent.

Table 2: comparison of the Activities of the amidase mutant and the parent amidase

Example 5: preparation of 2-chloronicotinic acid (I) by whole-cell catalysis of amidase mutant from 2-chloronicotinamide

2-Chloronicotinic acid was prepared using wet cells of amidase mutant E.coli BL21(DE3)/pET28-G175A obtained in example 3 as a catalyst and 2-chloronicotinamide as a substrate. 10mL of the reaction system was: 200mM Tris-HCl buffer (pH8.0), 200mM 2-chloronicotinamide, and 10g/L wet cells were reacted at 40 ℃ at 200 r/min. Samples (100. mu.L) were taken during the reaction and the progress of the reaction was followed by liquid chromatography (see FIG. 1) under the same conditions as in example 4. As shown in FIG. 1, the amidase mutant G175A wet cell with the final concentration of 10G/L can rapidly catalyze the hydrolysis of 200mM 2-chloronicotinamide, and the conversion rate is over 98% only about 20 min.

Example 6: preparation of 2-chloronicotinic acid (II) by whole-cell catalysis of amidase mutant with 2-chloronicotinamide

The amidase double mutant strain E.coli BL21(DE3)/pET28-G175A/A305T obtained in example 3 was used as a catalyst, and 2-chloronicotinamide was used as a substrate to prepare 2-chloronicotinic acid, and the starting strain E.coli BL21(DE3)/pET28-Pa-Ami and the amidase mutant strain E.coli BL21(DE3)/pET28-G175A were used as controls under the same conditions. The reaction conditions were the same as in example 5, and the detection conditions were the same as in example 4. As can be seen from FIG. 1, the parent amidase Pa-Ami has low catalytic efficiency, the conversion rate still does not exceed 98% when the reaction reaches 120min, and under the same substrate concentration, the double mutant G175A/A305T only needs to catalyze for 15min, and the conversion rate reaches 98.6%. In addition, the double mutant G175A/A305T has better hydrolysis capability on 2-chloronicotinamide than the single mutant G175A.

Example 7: preparation of 2-chloronicotinic acid (III) by whole-cell catalysis of amidase mutant from 2-chloronicotinamide

2-Chloronicotinib was prepared using the amidase starting strain E.coli BL21(DE3)/pET28-Pa-Ami (control) and the mutant E.coli BL21(DE3)/pET28-G175A wet cells obtained in example 3 as catalysts and 2-chloronicotinamide as a substrate. 10mL of the reaction system was: 200mM Tris-HCl buffer (pH8.0), 2-chloronicotinamide at an initial concentration of 200mM, and 10g/L wet cells were reacted at 40 ℃ at 200 r/min. When the substrate residual concentration was 20% lower than the last addition, 2-chloronicotinamide was added at a final concentration of 100 mM. Finally, the control group was fed 2 times, and the final cumulative total amount of 2-chloronicotinamide in the system was 400 mM; whereas mutant G175A was fed a total of 9 feeds, the final cumulative total amount of 2-chloronicotinamide in the system was 1100 mM. Samples (100. mu.L) were taken during the reaction and the progress of the reaction was followed by liquid chromatography (see FIG. 2) under the same conditions as in example 4. As can be seen from FIG. 2, mutant G175A catalyzed the final cumulative yield of 2-chloronicotinic acid to be up to 1055mM, and the total conversion rate to reach 95.9%; in contrast, in the control group, Pa-Ami catalyzed the final cumulative yield of 2-chloronicotinic acid of only 370mM, with an overall conversion of 94.2%.

Example 8: preparation of 2-chloronicotinic acid (IV) by whole-cell catalysis of amidase mutant from 2-chloronicotinamide

2-Chloronicotinib was prepared using wet cells of amidase double mutant strain E.coli BL21(DE3)/pET28-G175A/A305T obtained in example 3 as a catalyst and 2-chloronicotinamide as a substrate. 10mL of the reaction system was: 200mM Tris-HCl buffer (pH8.0), 2-chloronicotinamide at an initial concentration of 200mM, and 10g/L wet cells were reacted at 40 ℃ at 200 r/min. When the residual concentration of the substrate was 20% lower than the last addition, 2-chloronicotinamide was added to the system at a final concentration of 100mM, and 11 feeding operations were carried out in total, and the final cumulative total amount of 2-chloronicotinamide in the system was 1300 mM. Samples (100. mu.L) were taken during the reaction and the progress of the reaction was checked by liquid chromatography (see FIG. 3) under the same conditions as in example 4. As can be seen from FIG. 3, the final cumulative yield of 2-chloronicotinic acid was up to 1250mM, and the total conversion rate reached 96.1%.

The invention is not limited by the foregoing detailed description, and various modifications can be made within the scope of the invention as outlined by the claims.

Sequence listing

<110> Zhejiang industrial university

Pantoea amidase mutant, gene, engineering bacterium and application thereof

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>1416

<212>DNA

<213> Pantoea (Pantoea sp.)

<400>1

atgaataacc tgcattacaa atctctgctg gaaatcggtc gcctgatcca atctggtgaa 60

atctcctctg ttgaagtgac gcaaaccctg ctgacgcgta ttgataccct ggatcgcgac 120

ctgcatagct atttttacgt gatgcgtgat tctgcactgc agcaagcggc cgaagcagac 180

gctgaaatcg ctcagggcaa aatgcgtggt ccgctgcacg gcgttccgat tgcactgaaa 240

gatctgatct ggaccaaaga cgctccgacg tcacatggta tgattatcca caaagatcgt 300

tatccgaccg aagactcgac ggtggttgaa cgttttcgcg cagctggtgc ggtgattctg 360

ggcaaactga cccagacgga aagtgcgttt gcggatcatc acccggacat cgcacgtccg 420

aacaatccgt ggggtagcgc cctgtggacc ggtgccagct ctagtggctc tggtgttgcc 480

accgccgcgg gtctgtgctt tggcagcatt ggcaccgata cgggcggtag tatccgtttc 540

ccgtccaacg cgaatggcct gaccggtatt aaaccgacgt ggagtcgtgt cacccgtcat 600

ggcgcctgtg aactggcagc ttccctggat cacattggcc cgatggcacg taatgccgcg 660

gatgcagctg cgatgctgca ggcaatcgct ggtcgcgatg acaaagatcc gaccagcagc 720

agcgaaccgg ttccggacta tctggcgctg atgacccgtg gtattagtaa aatgcgcatc 780

ggcgtcgata aatcctgggc cctggaaaaa gtggacgaag aaacccgtgc cgcactgcag 840

agcgcgattg cgaccctgag ctctctgggt gccaccctgg tggatattac cctgccggac 900

acggaaaaag ctgcggccga atggtctgca ctgtgcgctg tcgaaacggc actggctcat 960

gaagatacct atccggcgca gaaagaccaa tatggtccgg gtctggcggg tctgctggat 1020

ctgggccact ccattaccgc actggaatac cagcgcctgc tgctgtcacg tgcagctctg 1080

cgcggtgata tttcggccct gtttacccaa gttgacctga ttctggcccc ggcaaccgcg 1140

tatgcgggtc tgacctggga taccatgacg cgttttggta cggaccaggc gctgttcaat 1200

ggcgtgctgc gctacacctc agcgttcgat gcctcgggtc atccgaccat tacgctgccg 1260

tgtggcaaaa ccgcatctgg tgctccgatc ggctttcaac tggtggcggc ccacttcgcg 1320

gaaaccacga tgatccaggg tgcgtgggcc ttccaacagg tcaccgattg gcataaacag 1380

catccggcac tgcatcatca tcaccatcat cactga 1416

<210>2

<211>471

<212>PRT

<213> Pantoea (Pantoea sp.)

<400>2

Met Asn Asn Leu His Tyr Lys Ser Leu Leu Glu Ile Gly Arg Leu Ile

1 5 10 15

Gln Ser Gly Glu Ile Ser Ser Val Glu Val Thr Gln Thr Leu Leu Thr

20 25 30

Arg Ile Asp Thr Leu Asp Arg Asp Leu His Ser Tyr Phe Tyr Val Met

35 40 45

Arg Asp Ser Ala Leu Gln Gln Ala Ala Glu Ala Asp Ala Glu Ile Ala

50 55 60

Gln Gly Lys Met Arg Gly Pro Leu His Gly Val Pro Ile Ala Leu Lys

65 70 75 80

Asp Leu Ile Trp Thr Lys Asp Ala Pro Thr Ser His Gly Met Ile Ile

85 90 95

His Lys Asp Arg Tyr Pro Thr Glu Asp Ser Thr Val Val Glu Arg Phe

100 105 110

Arg Ala Ala Gly Ala Val Ile Leu Gly Lys Leu Thr Gln Thr Glu Ser

115 120 125

Ala Phe Ala Asp His His Pro Asp Ile Ala Arg Pro Asn Asn Pro Trp

130 135 140

Gly Ser Ala Leu Trp Thr Gly Ala Ser Ser Ser Gly Ser Gly Val Ala

145 150155 160

Thr Ala Ala Gly Leu Cys Phe Gly Ser Ile Gly Thr Asp Thr Gly Gly

165 170 175

Ser Ile Arg Phe Pro Ser Asn Ala Asn Gly Leu Thr Gly Ile Lys Pro

180 185 190

Thr Trp Ser Arg Val Thr Arg His Gly Ala Cys Glu Leu Ala Ala Ser

195 200 205

Leu Asp His Ile Gly Pro Met Ala Arg Asn Ala Ala Asp Ala Ala Ala

210 215 220

Met Leu Gln Ala Ile Ala Gly Arg Asp Asp Lys Asp Pro Thr Ser Ser

225 230 235 240

Ser Glu Pro Val Pro Asp Tyr Leu Ala Leu Met Thr Arg Gly Ile Ser

245 250 255

Lys Met Arg Ile Gly Val Asp Lys Ser Trp Ala Leu Glu Lys Val Asp

260 265 270

Glu Glu Thr Arg Ala Ala Leu Gln Ser Ala Ile Ala Thr Leu Ser Ser

275 280 285

Leu Gly Ala Thr Leu Val Asp Ile Thr Leu Pro Asp Thr Glu Lys Ala

290 295 300

Ala Ala Glu Trp Ser Ala Leu Cys Ala Val Glu Thr Ala Leu Ala His

305 310 315320

Glu Asp Thr Tyr Pro Ala Gln Lys Asp Gln Tyr Gly Pro Gly Leu Ala

325 330 335

Gly Leu Leu Asp Leu Gly His Ser Ile Thr Ala Leu Glu Tyr Gln Arg

340 345 350

Leu Leu Leu Ser Arg Ala Ala Leu Arg Gly Asp Ile Ser Ala Leu Phe

355 360 365

Thr Gln Val Asp Leu Ile Leu Ala Pro Ala Thr Ala Tyr Ala Gly Leu

370 375 380

Thr Trp Asp Thr Met Thr Arg Phe Gly Thr Asp Gln Ala Leu Phe Asn

385 390 395 400

Gly Val Leu Arg Tyr Thr Ser Ala Phe Asp Ala Ser Gly His Pro Thr

405 410 415

Ile Thr Leu Pro Cys Gly Lys Thr Ala Ser Gly Ala Pro Ile Gly Phe

420 425 430

Gln Leu Val Ala Ala His Phe Ala Glu Thr Thr Met Ile Gln Gly Ala

435 440 445

Trp Ala Phe Gln Gln Val Thr Asp Trp His Lys Gln His Pro Ala Leu

450 455 460

His His His His His His His

465 470

<210>3

<211>1416

<212>DNA

<213> Pantoea (Pantoea sp.)

<400>3

atgaataacc tgcattacaa atctctgctg gaaatcggtc gcctgatcca atctggtgaa 60

atctcctctg ttgaagtgac gcaaaccctg ctgacgcgta ttgataccct ggatcgcgac 120

ctgcatagct atttttacgt gatgcgtgat tctgcactgc agcaagcggc cgaagcagac 180

gctgaaatcg ctcagggcaa aatgcgtggt ccgctgcacg gcgttccgat tgcactgaaa 240

gatctgatct ggaccaaaga cgctccgacg tcacatggta tgattatcca caaagatcgt 300

tatccgaccg aagactcgac ggtggttgaa cgttttcgcg cagctggtgc ggtgattctg 360

ggcaaactga cccagacgga aagtgcgttt gcggatcatc acccggacat cgcacgtccg 420

aacaatccgt ggggtagcgc cctgtggacc ggtgccagct ctagtggctc tggtgttgcc 480

accgccgcgg gtctgtgctt tggcagcatt ggcaccgata cggcgggtag tatccgtttc 540

ccgtccaacg cgaatggcct gaccggtatt aaaccgacgt ggagtcgtgt cacccgtcat 600

ggcgcctgtg aactggcagc ttccctggat cacattggcc cgatggcacg taatgccgcg 660

gatgcagctg cgatgctgca ggcaatcgct ggtcgcgatg acaaagatcc gaccagcagc 720

agcgaaccgg ttccggacta tctggcgctg atgacccgtg gtattagtaa aatgcgcatc 780

ggcgtcgata aatcctgggc cctggaaaaa gtggacgaag aaacccgtgc cgcactgcag 840

agcgcgattg cgaccctgag ctctctgggt gccaccctgg tggatattac cctgccggac 900

acggaaaaag ctgcggccga atggtctgca ctgtgcgctg tcgaaacggc actggctcat 960

gaagatacct atccggcgca gaaagaccaa tatggtccgg gtctggcggg tctgctggat 1020

ctgggccact ccattaccgc actggaatac cagcgcctgc tgctgtcacg tgcagctctg 1080

cgcggtgata tttcggccct gtttacccaa gttgacctga ttctggcccc ggcaaccgcg 1140

tatgcgggtc tgacctggga taccatgacg cgttttggta cggaccaggc gctgttcaat 1200

ggcgtgctgc gctacacctc agcgttcgat gcctcgggtc atccgaccat tacgctgccg 1260

tgtggcaaaa ccgcatctgg tgctccgatc ggctttcaac tggtggcggc ccacttcgcg 1320

gaaaccacga tgatccaggg tgcgtgggcc ttccaacagg tcaccgattg gcataaacag 1380

catccggcac tgcatcatca tcaccatcat cactga 1416

<210>4

<211>471

<212>PRT

<213> Pantoea (Pantoea sp.)

<400>4

Met Asn Asn Leu His Tyr Lys Ser Leu Leu Glu Ile Gly Arg Leu Ile

1 5 10 15

Gln Ser Gly Glu Ile Ser Ser Val Glu Val Thr Gln Thr Leu Leu Thr

20 25 30

Arg Ile Asp Thr Leu Asp Arg Asp Leu His Ser Tyr Phe Tyr Val Met

35 40 45

Arg Asp Ser Ala Leu Gln Gln Ala Ala Glu Ala Asp Ala Glu Ile Ala

50 55 60

Gln Gly Lys Met Arg Gly Pro Leu His Gly Val Pro Ile Ala Leu Lys

65 70 75 80

Asp Leu Ile Trp Thr Lys Asp Ala Pro Thr Ser His Gly Met Ile Ile

85 90 95

His Lys Asp Arg Tyr Pro Thr Glu Asp Ser Thr Val Val Glu Arg Phe

100 105 110

Arg Ala Ala Gly Ala Val Ile Leu Gly Lys Leu Thr Gln Thr Glu Ser

115 120 125

Ala Phe Ala Asp His His Pro Asp Ile Ala Arg Pro Asn Asn Pro Trp

130 135 140

Gly Ser Ala Leu Trp Thr Gly Ala Ser Ser Ser Gly Ser Gly Val Ala

145 150 155 160

Thr Ala Ala Gly Leu Cys Phe Gly Ser Ile Gly Thr Asp Thr Ala Gly

165 170 175

Ser Ile Arg Phe Pro Ser Asn Ala Asn Gly Leu Thr Gly Ile Lys Pro

180 185 190

Thr Trp Ser Arg Val Thr Arg His Gly Ala Cys Glu Leu Ala Ala Ser

195 200 205

Leu Asp His Ile Gly Pro Met Ala Arg Asn Ala Ala Asp Ala Ala Ala

210 215 220

Met Leu Gln Ala IleAla Gly Arg Asp Asp Lys Asp Pro Thr Ser Ser

225 230 235 240

Ser Glu Pro Val Pro Asp Tyr Leu Ala Leu Met Thr Arg Gly Ile Ser

245 250 255

Lys Met Arg Ile Gly Val Asp Lys Ser Trp Ala Leu Glu Lys Val Asp

260 265 270

Glu Glu Thr Arg Ala Ala Leu Gln Ser Ala Ile Ala Thr Leu Ser Ser

275 280 285

Leu Gly Ala Thr Leu Val Asp Ile Thr Leu Pro Asp Thr Glu Lys Ala

290 295 300

Ala Ala Glu Trp Ser Ala Leu Cys Ala Val Glu Thr Ala Leu Ala His

305 310 315 320

Glu Asp Thr Tyr Pro Ala Gln Lys Asp Gln Tyr Gly Pro Gly Leu Ala

325 330 335

Gly Leu Leu Asp Leu Gly His Ser Ile Thr Ala Leu Glu Tyr Gln Arg

340 345 350

Leu Leu Leu Ser Arg Ala Ala Leu Arg Gly Asp Ile Ser Ala Leu Phe

355 360 365

Thr Gln Val Asp Leu Ile Leu Ala Pro Ala Thr Ala Tyr Ala Gly Leu

370 375 380

Thr Trp Asp Thr Met Thr ArgPhe Gly Thr Asp Gln Ala Leu Phe Asn

385 390 395 400

Gly Val Leu Arg Tyr Thr Ser Ala Phe Asp Ala Ser Gly His Pro Thr

405 410 415

Ile Thr Leu Pro Cys Gly Lys Thr Ala Ser Gly Ala Pro Ile Gly Phe

420 425 430

Gln Leu Val Ala Ala His Phe Ala Glu Thr Thr Met Ile Gln Gly Ala

435 440 445

Trp Ala Phe Gln Gln Val Thr Asp Trp His Lys Gln His Pro Ala Leu

450 455 460

His His His His His His His

465 470

<210>5

<211>1416

<212>DNA

<213> Pantoea (Pantoea sp.)

<400>5

atgaataacc tgcattacaa atctctgctg gaaatcggtc gcctgatcca atctggtgaa 60

atctcctctg ttgaagtgac gcaaaccctg ctgacgcgta ttgataccct ggatcgcgac 120

ctgcatagct atttttacgt gatgcgtgat tctgcactgc agcaagcggc cgaagcagac 180

gctgaaatcg ctcagggcaa aatgcgtggt ccgctgcacg gcgttccgat tgcactgaaa 240

gatctgatct ggaccaaaga cgctccgacg tcacatggta tgattatcca caaagatcgt 300

tatccgaccg aagactcgac ggtggttgaa cgttttcgcg cagctggtgcggtgattctg 360

ggcaaactga cccagacgga aagtgcgttt gcggatcatc acccggacat cgcacgtccg 420

aacaatccgt ggggtagcgc cctgtggacc ggtgccagct ctagtggctc tggtgttgcc 480

accgccgcgg gtctgtgctt tggcagcatt ggcaccgata cggcgggtag tatccgtttc 540

ccgtccaacg cgaatggcct gaccggtatt aaaccgacgt ggagtcgtgt cacccgtcat 600

ggcgcctgtg aactggcagc ttccctggat cacattggcc cgatggcacg taatgccgcg 660

gatgcagctg cgatgctgca ggcaatcgct ggtcgcgatg acaaagatcc gaccagcagc 720

agcgaaccgg ttccggacta tctggcgctg atgacccgtg gtattagtaa aatgcgcatc 780

ggcgtcgata aatcctgggc cctggaaaaa gtggacgaag aaacccgtgc cgcactgcag 840

agcgcgattg cgaccctgag ctctctgggt gccaccctgg tggatattac cctgccggac 900

acggaaaaag ctaccgccga atggtctgca ctgtgcgctg tcgaaacggc actggctcat 960

gaagatacct atccggcgca gaaagaccaa tatggtccgg gtctggcggg tctgctggat 1020

ctgggccact ccattaccgc actggaatac cagcgcctgc tgctgtcacg tgcagctctg 1080

cgcggtgata tttcggccct gtttacccaa gttgacctga ttctggcccc ggcaaccgcg 1140

tatgcgggtc tgacctggga taccatgacg cgttttggta cggaccaggc gctgttcaat 1200

ggcgtgctgc gctacacctc agcgttcgat gcctcgggtc atccgaccat tacgctgccg 1260

tgtggcaaaa ccgcatctgg tgctccgatc ggctttcaac tggtggcggc ccacttcgcg 1320

gaaaccacga tgatccaggg tgcgtgggcc ttccaacagg tcaccgattg gcataaacag 1380

catccggcac tgcatcatca tcaccatcat cactga 1416

<210>6

<211>471

<212>PRT

<213> Pantoea (Pantoea sp.)

<400>6

Met Asn Asn Leu His Tyr Lys Ser Leu Leu Glu Ile Gly Arg Leu Ile

1 5 10 15

Gln Ser Gly Glu Ile Ser Ser Val Glu Val Thr Gln Thr Leu Leu Thr

20 25 30

Arg Ile Asp Thr Leu Asp Arg Asp Leu His Ser Tyr Phe Tyr Val Met

35 40 45

Arg Asp Ser Ala Leu Gln Gln Ala Ala Glu Ala Asp Ala Glu Ile Ala

50 55 60

Gln Gly Lys Met Arg Gly Pro Leu His Gly Val Pro Ile Ala Leu Lys

65 70 75 80

Asp Leu Ile Trp Thr Lys Asp Ala Pro Thr Ser His Gly Met Ile Ile

85 90 95

His Lys Asp Arg Tyr Pro Thr Glu Asp Ser Thr Val Val Glu Arg Phe

100 105 110

Arg Ala Ala Gly Ala Val Ile Leu Gly Lys Leu Thr Gln Thr Glu Ser

115 120 125

Ala Phe Ala Asp His His Pro Asp Ile Ala Arg Pro Asn Asn Pro Trp

130 135 140

Gly Ser Ala Leu Trp Thr Gly Ala Ser Ser Ser Gly Ser Gly Val Ala

145 150 155 160

Thr Ala Ala Gly Leu Cys Phe Gly Ser Ile Gly Thr Asp Thr Ala Gly

165 170 175

Ser Ile Arg Phe Pro Ser Asn Ala Asn Gly Leu Thr Gly Ile Lys Pro

180 185 190

Thr Trp Ser Arg Val Thr Arg His Gly Ala Cys Glu Leu Ala Ala Ser

195 200 205

Leu Asp His Ile Gly Pro Met Ala Arg Asn Ala Ala Asp Ala Ala Ala

210 215 220

Met Leu Gln Ala Ile Ala Gly Arg Asp Asp Lys Asp Pro Thr Ser Ser

225 230 235 240

Ser Glu Pro Val Pro Asp Tyr Leu Ala Leu Met Thr Arg Gly Ile Ser

245 250 255

Lys Met Arg Ile Gly Val Asp Lys Ser Trp Ala Leu Glu Lys Val Asp

260 265 270

Glu Glu Thr Arg Ala Ala Leu Gln Ser Ala Ile Ala Thr Leu Ser Ser

275 280 285

Leu Gly Ala Thr Leu Val Asp Ile Thr Leu Pro Asp Thr Glu Lys Ala

290 295 300

Thr Ala Glu Trp Ser Ala Leu Cys Ala Val Glu Thr Ala Leu Ala His

305 310 315 320

Glu Asp Thr Tyr Pro Ala Gln Lys Asp Gln Tyr Gly Pro Gly Leu Ala

325 330 335

Gly Leu Leu Asp Leu Gly His Ser Ile Thr Ala Leu Glu Tyr Gln Arg

340 345 350

Leu Leu Leu Ser Arg Ala Ala Leu Arg Gly Asp Ile Ser Ala Leu Phe

355 360 365

Thr Gln Val Asp Leu Ile Leu Ala Pro Ala Thr Ala Tyr Ala Gly Leu

370 375 380

Thr Trp Asp Thr Met Thr Arg Phe Gly Thr Asp Gln Ala Leu Phe Asn

385 390 395 400

Gly Val Leu Arg Tyr Thr Ser Ala Phe Asp Ala Ser Gly His Pro Thr

405 410 415

Ile Thr Leu Pro Cys Gly Lys Thr Ala Ser Gly Ala Pro Ile Gly Phe

420 425 430

Gln Leu Val Ala Ala His Phe Ala Glu Thr Thr Met Ile Gln Gly Ala

435 440 445

Trp Ala Phe Gln Gln Val Thr Asp Trp His Lys Gln His Pro Ala Leu

450 455 460

His His His His His His His

465 470

Claims

1. An amidase mutant of Pantoea, which is characterized in that the amidase mutant is obtained by carrying out the following point mutation on an amino acid sequence shown in SEQ ID No. 2: (1) a mutation of glycine at position 175 to alanine; (2) threonine at position 301 is mutated to leucine; (3) alanine at position 305 is mutated to threonine; (4) serine at position 309 is mutated to tyrosine; (5) mutating the glycine at position 175 to alanine and the threonine at position 301 to leucine; (6) mutating the glycine at position 175 to alanine and the alanine at position 305 to threonine; (7) mutating glycine at position 175 to alanine and serine at position 309 to tyrosine; (8) mutating glycine at position 175 to alanine and threonine at position 301 to leucine, and simultaneously mutating alanine at position 305 to threonine; (9) glycine at position 175 is mutated to alanine and alanine at position 305 is mutated to threonine while serine at position 309 is mutated to tyrosine.

2. A gene encoding the pantoea amidase mutant of claim 1.

3. A recombinant genetically engineered bacterium constructed from the gene encoding the pantoea amidase mutant of claim 2.

4. An application of the pantoea amidase mutant in catalyzing 2-chloronicotinamide to prepare 2-chloronicotinic acid according to claim 1.

5. The application of claim 4, wherein the application comprises the steps of taking wet thalli obtained by fermentation culture of engineering bacteria containing a gene encoding a pantoea amidase mutant as a catalyst, taking 2-chloronicotinamide as a substrate, taking a buffer solution with the pH of 7.5-8.5 as a reaction medium to form a reaction system, carrying out conversion reaction at the temperature of 30-60 ℃ and at the speed of 150-500 r/min, and taking reaction liquid for separation and purification after the reaction is finished to obtain the 2-chloronicotinic acid.

6. The use according to claim 5, wherein the initial concentration of the substrate in the reaction system is 50 to 300mM, and the amount of the catalyst is 1 to 10g/L based on the weight of wet cells.

7. The use according to claim 6, wherein the substrate is fed in the form of a feed and the substrate is fed to the reaction system at a final concentration of 50 to 200mM when the residual concentration of the substrate in the reaction system is less than 20% of the amount of the substrate fed.

8. The use according to claim 5, wherein the catalyst is prepared by the following process: inoculating the engineering bacteria containing the gene coding the panoxanil amidase mutant into LB liquid culture medium containing 50mg/L kanamycin at the final concentration, culturing for 12h at 37 ℃ at 150r/min, then transferring the engineering bacteria into fresh LB liquid culture medium containing 50mg/L kanamycin at the final concentration by the inoculum size of 1 percent in volume concentration, and culturing at 37 ℃ at 150r/min until the thallus concentration OD₆₀₀0.4-0.8, adding IPTG with the final concentration of 0.1-1 mM into the culture medium, carrying out induced culture at 28 ℃ for 12h at 150r/min, centrifuging the culture, and collecting the precipitate to obtain wet thalli; the LB liquid culture medium comprises: 10g/L of peptone, 5g/L of yeast extract, 10g/L of NaCl, deionized water as a solvent and 7.0 of pH value.