CN107904222B - A kind of l-amino acid deaminase mutant and its construction method that thermal stability improves - Google Patents
A kind of l-amino acid deaminase mutant and its construction method that thermal stability improves Download PDFInfo
- Publication number
- CN107904222B CN107904222B CN201711242323.1A CN201711242323A CN107904222B CN 107904222 B CN107904222 B CN 107904222B CN 201711242323 A CN201711242323 A CN 201711242323A CN 107904222 B CN107904222 B CN 107904222B
- Authority
- CN
- China
- Prior art keywords
- amino acid
- gly
- val
- leu
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
- C12N15/1031—Mutagenizing nucleic acids mutagenesis by gene assembly, e.g. assembly by oligonucleotide extension PCR
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y403/00—Carbon-nitrogen lyases (4.3)
- C12Y403/01—Ammonia-lyases (4.3.1)
Abstract
The invention discloses l-amino acid deaminase mutants and its construction method that a kind of thermal stability improves, belong to field of biotechnology.The Vmax and t of mutant D340N, L363N of l-amino acid deaminase provided by the invention1/2All it is improved.L-amino acid deaminase has a wide range of applications in multiple fields at present, such as in field of medicaments, can be used as the amino acid of chiral resolution and its catalyst of derivative, realize D l-amino acid Chiral Separation.L-amino acid deamination can also be catalyzed and synthesize corresponding 2-ketoacid.These substances can have important purposes in fields such as forecast of biotechnology in food chemistry.The l-amino acid deaminase mutant that the present invention improves can preferably be applied in field as above.
Description
Technical field
The present invention relates to l-amino acid deaminase mutants and its construction method that a kind of thermal stability improves, belong to biology
Technical field.
Background technique
L-amino acid deaminase is one kind using FAD as the flavoprotein of coenzyme, can be catalyzed l-amino acid deamination and form phase
Answer 2-ketoacid and ammonia.The l-amino acid deaminase substrate specificity sex differernce of separate sources is huge, a part of l-amino acid deaminase
A variety of l-amino acids and amino acid derivativges can be utilized, however have the substrate spectrum of some l-amino acid deaminases smaller, very
It can only be extremely catalyzed a kind of amino acid, at this moment most amino acid deaminases can name (such as glycine deamination with the deamination of substrate
Enzyme).It is substrate, general main oxidation that l-amino acid deaminase from Proteus vulgaris, which can use a variety of amino acid,
With long aliphatic lateral chain or aromatic amino acid.
L-amino acid deaminase is widely used, and can be catalyzed l-amino acid deamination, is formed corresponding 2-ketoacid, is not only produced
Amount is high, and the substrate transformation rate is high, and conversion process is easy to control, has been used for the production of a variety of 2-ketoacids at present.L-amino acid deamination
Enzyme can be used for from D in l-amino acid mixture, specific catalytic l-amino acid, realize D l-amino acid Chiral Separation.Cause
This, the thermal stability that l-amino acid deaminase is improved by molecular modification is more suitable for industrial applications to improve zymologic property
Mutant enzyme is current research hotspot.
Summary of the invention
The invention aims to provide a kind of l-amino acid deaminase mutant that enzyme activity improves simultaneously with thermal stability
And its construction method, the thermal stability of l-amino acid deaminase is improved, application range is extended.
The l-amino acid deaminase mutant that the enzyme activity and thermal stability improve simultaneously has shown in SEQ IDNO.2
Amino acid sequence.
The construction method for the l-amino acid deaminase mutant that the enzyme activity and thermal stability improve simultaneously, including walk as follows
It is rapid:
(1) mutational site of the l-amino acid deaminase from proteus vulgaris determines: by l-amino acid deaminase from N
340 aspartic acids at end are as saturation mutation site.
(2) foundation in l-amino acid deaminase mutant library and mutant screening: to carry, coding is described to be become from common
The recombinant plasmid of the gene of the l-amino acid deaminase of shape bacillus is template, is substituted in the 340th codon with NNK, is designed
Degenerate primer carries out full plasmid PCR reaction, building fixed point saturated mutant library, and Dpn I digests template, and product after purification is direct
Escherichia coli are transferred to, the Escherichia coli after conversion are coated on the card containing 50 μ g/mL and are received on antibiotic plate, 37 DEG C of cultures
16h obtains saturated mutant library.
(3) take the colony inoculation of 2 saturated mutant libraries into 96 orifice plates of the LB culture medium containing Ka Na, in 37 DEG C of mistakes
Night culture, obtains the seed liquor of mutant library, is transferred to 2 pieces of 96 hole deep holes containing 600 μ L TB culture mediums with 2% inoculum concentration
In plate, in cultivating 1.5h on 37 DEG C and 900rpm of porous plate shaking table, final concentration of 0.4mmolL is added-1IPTG, 37 DEG C
Thalline were collected by centrifugation after induction 4h.
(4) by step (3) culture obtain thallus, be inoculated in received containing card antibiotic LB liquid medium in, 37 DEG C
It is incubated overnight, is inoculated into TB culture medium with 2% inoculum concentration, OD is arrived in culture600When being 0.6~0.8,0.4mM IPTG is added to lure
It leads, thalline were collected by centrifugation, and after phosphate buffer suspension thalline, ultrasonication is assembled using 1% triton x-100
Pure l-amino acid deaminase can be obtained by the affine column purification of Ni-NTA, dialysis removal imidazoles in memebrane protein, supernatant.
Further, Escherichia coli are E.coli BL21 (DE3) in step (2).
Further, recombinant plasmid described in step (2) is pET28a-lad.
Further, in step (2) full plasmid PCR condition are as follows: 98 DEG C of 2min；Then 98 DEG C of 10s, 55 DEG C of 5s, 72 DEG C
90s amounts to 25 circulations；Last 72 DEG C of 10min.
Compared with wild type l-amino acid deaminase, the thermal stability of l-amino acid deaminase mutant of the invention is obtained
It improves, with 37 DEG C of Vmax and half-life period t1/2Indicate that thermal stability improves, the zymology of l-amino acid deaminase of the invention
Matter is as shown in table 1:
The zymologic property of 1 l-amino acid deaminase mutant of table
The method that the present invention uses half design and rational carries out more wheels to the l-amino acid deaminase from proteus vulgaris
Saturation mutation is pinpointed, the mutant of l-amino acid deaminase, the Vmax and t of mutant D340N, L363N are obtained1/2All it is improved.
L-amino acid deaminase has a wide range of applications in multiple fields at present, such as in field of medicaments, can be used as the ammonia of chiral resolution
Base acid and its derivative catalyst, realize D l-amino acid Chiral Separation.L-amino acid deamination synthesis phase can also be catalyzed
The 2-ketoacid answered.These substances can have important purposes in fields such as forecast of biotechnology in food chemistry.The L- ammonia that the present invention improves
Base acid deaminase mutant can preferably be applied in field as above.
Detailed description of the invention
Molecular dynamics simulation result in Fig. 1 embodiment of the present invention 1
The selection result in Fig. 2 embodiment of the present invention 2
Deactivation kinetics figure in Fig. 3 embodiment of the present invention 3
Specific embodiment
Materials and methods
The determination in 1 saturation mutation site of embodiment
Molecular dynamics simulation is carried out to (such as Fig. 1) of l-amino acid deaminase, integrated structure information determines following 2
Point is saturation mutation site.Wherein, the amino acid sequence of wild type L-AAD is as shown in SEQ ID NO.1.
Mutational site select detailed process for, by the LAD-Leu composite structure after docking be initial configuration, substrate and
After the structure of FAD is using Sybyl optimization, the charge file of FAD is generated with Gaussian09, the force field parameter file of albumen uses
The built-in force field parameter file of Amber16.Then protein-ligand complex is placed in water box of TIP3P, the sub- radius of water box
It is 12.0, adds Na+Ionic equilibrium system charge number carries out molecular dynamics simulation.Molecule under 10ns is simulated using Amber16
Motion conditions, on the basis of the structure before simulating, calculate albumen RMSD value in simulations.Choose the biggish D340 of RMSF value
With the site L363, for be transformed thermal stability critical sites.
The foundation in embodiment 2L- amino acid deaminase mutant library and mutant screening
By embodiment 1, the site D340 and L363 is determined, for the critical sites that thermal stability is transformed.Structure with the following method
The mutant library of l-amino acid deaminase is built, specific construction method is as follows:
(1) recombinant plasmid of the gene of the l-amino acid deaminase from proteus vulgaris is encoded with carrying
PET28a-lad is template, using following primer as primer, carries out full plasmid PCR, the condition of full plasmid PCR respectively are as follows: 98 DEG C
2min；Then 98 DEG C of 10s, 55 DEG C of 5s, 72 DEG C of 90s amount to 25 circulations；Last 72 DEG C of 10min.
D340-F:AGCATTACCTNNKTTCCCTGTGCATATTTCT
D340-D:AATAATGGCAGATATTTATAGCCATAAGTGAAGGATTC
L363-F:NNKGATGAAGTTTCTCCGTTTGAGCAATTCAGAAATATG
L363-D:GTTCCAATGCGTTGATTGCATAAATGAATTGA
By the product after PCR after DpnI digests, Escherichia coli are transferred to, and the Escherichia coli after conversion are coated on and are contained
There is the card of 50 μ g/mL to receive on antibiotic plate, 37 DEG C of culture 16h obtain saturated mutant library.
(2) the screening artificial sequence of mutant
Mutant after conversion is randomly selected 88 into the 96 hole deep-well plates containing 600 μ L LB culture mediums, picking 4
A wild mushroom into same 96 orifice plate as control bacterium, do not choose bacterium and be used as negative control by remaining 4 holes.Turn after 37 DEG C of culture 10h
It connects 2 times, guarantees that the cell concentration of seed liquor is consistent.Seed liquor is transferred to 2 pieces with 2% inoculum concentration and contains 600 μ L TB culture mediums
96 hole deep-well plates in, in cultivating 1.5h on the porous plate shaking table of 37 DEG C and 900rpm, final concentration of 0.4mmolL is added-1's
Thalline were collected by centrifugation after IPTG, 37 DEG C of induction 4h.30% glycerol of remaining seed liquor addition equal volume, -80 DEG C of preservations.
The screening of initial catalyst vigor: in order to screen the mutant for obtaining high catalysis activity, by the thallus after collection, add
1mL is added to contain 100mmolL-1The buffer of L-Leu, suspension thalline shake bed reaction in 37 DEG C, 900rpm high throughput
30min is centrifuged 10min in 4 DEG C, 4000rpm, takes supernatant, contained by 2,4-dinitrophenylhydrazine determination of color α-ketoisocaproic acid
Amount.It is 0 point of relative catalytic vigor for calculating other bacterium with the catalysis activity of wild-type bacteria.
The screening of high thermal stability mutant: buffering of the 1mL without containing substrate will be added in the thallus of another piece of 96 orifice plates
Liquid after suspension thalline, cultivates 8h, then thalline were collected by centrifugation under 37 DEG C, 900rpm.Addition 1mL contains 100mmolL-1L- is bright
The buffer of propylhomoserin, suspension thalline react 30min under 37 DEG C, 900rpm, are centrifuged 10min in 4 DEG C, 4000rpm, take supernatant,
Pass through determination of color α-ketoisocaproic acid content.It is lived using the relative catalytic that the catalysis activity of wild-type bacteria calculates other bacterium as origin
Power.
The measurement of the catalytic property of 3 enzyme of embodiment
The mutant of acquisition will be screened in embodiment 2, be inoculated in received containing card antibiotic LB liquid medium in, 37 DEG C
It is incubated overnight, is inoculated into TB culture medium with 2% inoculum concentration, OD is arrived in culture600When being 0.6~0.8,0.4mM IPTG is added to lure
It leads, thalline were collected by centrifugation, and after phosphate buffer suspension thalline, ultrasonic disruption is filled using 1% triton x-100
With memebrane protein, pure l-amino acid deaminase is can be obtained by the affine column purification of Ni-NTA, dialysis removal imidazoles in supernatant.
The recombinant plasmid pET28a- for encoding the gene of the l-amino acid deaminase from proteus vulgaris will be carried
Lad is transferred to Escherichia coli after DpnI digests, and the Escherichia coli after conversion are coated on the Ka Na containing 50 μ g/mL and are resisted
On raw element plate, 37 DEG C of culture 16h, be inoculated in received containing card antibiotic LB liquid medium in, 37 DEG C are incubated overnight, with
2% inoculum concentration is inoculated into TB culture medium, and OD is arrived in culture600When being 0.6~0.8, adds 0.4mM IPTG to induce, be collected by centrifugation
Thallus, after phosphate buffer suspension thalline, ultrasonic disruption assembles memebrane protein using 1% triton x-100, on
Wild type l-amino acid deaminase can be obtained by the affine column purification of Ni-NTA, dialysis removal imidazoles in clear liquid.
Enzyme activity determination method: in the reaction system of 1mL, with 100mmolL-1L-Leu is substrate, is separately added into
0.1mg·mL-1Wild type l-amino acid deaminase or l-amino acid deaminase mutant D340N or l-amino acid deaminase it is prominent
The enzyme solution of variant L363N, 37 DEG C of concussion reaction half an hour detect α-ketoisocaproic acid concentration by HPLC.Enzyme activity calculation method is
Shown in formula (1), ν is specific enzyme activity (μm olmin-1·mg-1), C1It is α-ketoisocaproic acid concentration (μm olL-1), C2It is that enzyme is dense
Spend (mgL-1), reaction time T is 30min.
The method of HPLC measurement α-ketoisocaproic acid: 1200 liquid chromatograph of Agilent is utilized, using ZORBAX SB-Aq
(4.6 × 250mm, 5 μm) chromatographic column, mobile phase 0.01molL-1Ammonium dibasic phosphate solution (pH 2.50)-methanol solution
(90:10, v/v), flow velocity 0.6mLmin-1, column temperature is 35 DEG C, is detected at ultraviolet detection wavelength 203nm.
Deactivation kinetics measuring method, under the conditions of 37 DEG C, every 4h sampling is primary, using 100mM L-Leu as substrate,
50 μ L wild type l-amino acid deaminases or l-amino acid deaminase mutant D340N or l-amino acid deaminase mutant is added
L363N measures catalytic efficiency in 37 DEG C of reaction 30min.As a result as shown in figure 3, the thermal stability of mutant D340N is best,
At 37 DEG C, half-life period is 1.42 times (wild mushroom 8h, D340N 11.4h) of wild mushroom.It secondly is L363N, the half of mutant
The phase of declining is 1.12 times (mutant L363N is 8.9h) of wild mushroom.
Although the present invention has been described by way of example and in terms of the preferred embodiments, it is not intended to limit the invention, any to be familiar with this skill
The people of art can do various change and modification, therefore protection model of the invention without departing from the spirit and scope of the present invention
Enclosing subject to the definition of the claims.
SEQUENCE LISTING
<110>Southern Yangtze University
<120>l-amino acid deaminase mutant and its construction method that a kind of thermal stability improves
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 471
<212> PRT
<213>proteus vulgaris
<400> 1
Met Ala Ile Ser Arg Arg Lys Phe Ile Ile Gly Gly Thr Val Val Ala
1 5 10 15
Val Ala Ala Gly Ala Gly Ile Leu Thr Pro Met Leu Thr Arg Glu Gly
20 25 30
Arg Phe Val Pro Gly Thr Pro Arg His Gly Phe Val Glu Gly Thr Glu
35 40 45
Gly Ala Leu Pro Lys Gln Ala Asp Val Val Val Val Gly Ala Gly Ile
50 55 60
Leu Gly Ile Met Thr Ala Ile Asn Leu Val Glu Arg Gly Leu Ser Val
65 70 75 80
Val Ile Val Glu Lys Gly Asn Ile Ala Gly Glu Gln Ser Ser Arg Phe
85 90 95
Tyr Gly Gln Ala Ile Ser Tyr Lys Met Pro Asp Glu Thr Phe Leu Leu
100 105 110
His His Leu Gly Lys His Arg Trp Arg Glu Met Asn Ala Lys Val Gly
115 120 125
Ile Asp Thr Thr Tyr Arg Thr Gln Gly Arg Val Glu Val Pro Leu Asp
130 135 140
Glu Glu Asp Leu Val Asn Val Arg Lys Trp Ile Asp Glu Arg Ser Lys
145 150 155 160
Asn Val Gly Ser Asp Ile Pro Phe Lys Thr Arg Ile Ile Glu Gly Ala
165 170 175
Glu Leu Asn Gln Arg Leu Arg Gly Ala Thr Thr Asp Trp Lys Ile Ala
180 185 190
Gly Phe Glu Glu Asp Ser Gly Ser Phe Asp Pro Glu Val Ala Thr Phe
195 200 205
Val Met Ala Glu Tyr Ala Lys Lys Met Gly Val Arg Ile Tyr Thr Gln
210 215 220
Cys Ala Ala Arg Gly Leu Glu Thr Gln Ala Gly Val Ile Ser Asp Val
225 230 235 240
Val Thr Glu Lys Gly Ala Ile Lys Thr Ser Gln Val Val Val Ala Gly
245 250 255
Gly Val Trp Ser Arg Leu Phe Met Gln Asn Leu Asn Val Asp Val Pro
260 265 270
Thr Leu Pro Ala Tyr Gln Ser Gln Gln Leu Ile Ser Gly Ser Pro Thr
275 280 285
Ala Pro Gly Gly Asn Val Ala Leu Pro Gly Gly Ile Phe Phe Arg Glu
290 295 300
Gln Ala Asp Gly Thr Tyr Ala Thr Ser Pro Arg Val Ile Val Ala Pro
305 310 315 320
Val Val Lys Glu Ser Phe Thr Tyr Gly Tyr Lys Tyr Leu Pro Leu Leu
325 330 335
Ala Leu Pro Asp Phe Pro Val His Ile Ser Leu Asn Glu Gln Leu Ile
340 345 350
Asn Ser Phe Met Gln Ser Thr His Trp Asn Leu Asp Glu Val Ser Pro
355 360 365
Phe Glu Gln Phe Arg Asn Met Thr Ala Leu Pro Asp Leu Pro Glu Leu
370 375 380
Asn Ala Ser Leu Glu Lys Leu Lys Ala Glu Phe Pro Ala Phe Lys Glu
385 390 395 400
Ser Lys Leu Ile Asp Gln Trp Ser Gly Ala Met Ala Ile Ala Pro Asp
405 410 415
Glu Asn Pro Ile Ile Ser Glu Val Lys Glu Tyr Pro Gly Leu Val Ile
420 425 430
Asn Thr Ala Thr Gly Trp Gly Met Thr Glu Ser Pro Val Ser Ala Glu
435 440 445
Leu Thr Ala Asp Leu Leu Leu Gly Lys Lys Pro Val Leu Asp Pro Lys
450 455 460
Pro Phe Ser Leu Tyr Arg Phe
465 470
<210> 2
<211> 471
<212> PRT
<213>artificial sequence
<400> 2
Met Ala Ile Ser Arg Arg Lys Phe Ile Ile Gly Gly Thr Val Val Ala
1 5 10 15
Val Ala Ala Gly Ala Gly Ile Leu Thr Pro Met Leu Thr Arg Glu Gly
20 25 30
Arg Phe Val Pro Gly Thr Pro Arg His Gly Phe Val Glu Gly Thr Glu
35 40 45
Gly Ala Leu Pro Lys Gln Ala Asp Val Val Val Val Gly Ala Gly Ile
50 55 60
Leu Gly Ile Met Thr Ala Ile Asn Leu Val Glu Arg Gly Leu Ser Val
65 70 75 80
Val Ile Val Glu Lys Gly Asn Ile Ala Gly Glu Gln Ser Ser Arg Phe
85 90 95
Tyr Gly Gln Ala Ile Ser Tyr Lys Met Pro Asp Glu Thr Phe Leu Leu
100 105 110
His His Leu Gly Lys His Arg Trp Arg Glu Met Asn Ala Lys Val Gly
115 120 125
Ile Asp Thr Thr Tyr Arg Thr Gln Gly Arg Val Glu Val Pro Leu Asp
130 135 140
Glu Glu Asp Leu Val Asn Val Arg Lys Trp Ile Asp Glu Arg Ser Lys
145 150 155 160
Asn Val Gly Ser Asp Ile Pro Phe Lys Thr Arg Ile Ile Glu Gly Ala
165 170 175
Glu Leu Asn Gln Arg Leu Arg Gly Ala Thr Thr Asp Trp Lys Ile Ala
180 185 190
Gly Phe Glu Glu Asp Ser Gly Ser Phe Asp Pro Glu Val Ala Thr Phe
195 200 205
Val Met Ala Glu Tyr Ala Lys Lys Met Gly Val Arg Ile Tyr Thr Gln
210 215 220
Cys Ala Ala Arg Gly Leu Glu Thr Gln Ala Gly Val Ile Ser Asp Val
225 230 235 240
Val Thr Glu Lys Gly Ala Ile Lys Thr Ser Gln Val Val Val Ala Gly
245 250 255
Gly Val Trp Ser Arg Leu Phe Met Gln Asn Leu Asn Val Asp Val Pro
260 265 270
Thr Leu Pro Ala Tyr Gln Ser Gln Gln Leu Ile Ser Gly Ser Pro Thr
275 280 285
Ala Pro Gly Gly Asn Val Ala Leu Pro Gly Gly Ile Phe Phe Arg Glu
290 295 300
Gln Ala Asp Gly Thr Tyr Ala Thr Ser Pro Arg Val Ile Val Ala Pro
305 310 315 320
Val Val Lys Glu Ser Phe Thr Tyr Gly Tyr Lys Tyr Leu Pro Leu Leu
325 330 335
Ala Leu Pro Asn Phe Pro Val His Ile Ser Leu Asn Glu Gln Leu Ile
340 345 350
Asn Ser Phe Met Gln Ser Thr His Trp Asn Leu Asp Glu Val Ser Pro
355 360 365
Phe Glu Gln Phe Arg Asn Met Thr Ala Leu Pro Asp Leu Pro Glu Leu
370 375 380
Asn Ala Ser Leu Glu Lys Leu Lys Ala Glu Phe Pro Ala Phe Lys Glu
385 390 395 400
Ser Lys Leu Ile Asp Gln Trp Ser Gly Ala Met Ala Ile Ala Pro Asp
405 410 415
Glu Asn Pro Ile Ile Ser Glu Val Lys Glu Tyr Pro Gly Leu Val Ile
420 425 430
Asn Thr Ala Thr Gly Trp Gly Met Thr Glu Ser Pro Val Ser Ala Glu
435 440 445
Leu Thr Ala Asp Leu Leu Leu Gly Lys Lys Pro Val Leu Asp Pro Lys
450 455 460
Pro Phe Ser Leu Tyr Arg Phe
465 470
<210> 3
<211> 471
<212> PRT
<213>artificial sequence
<400> 3
Met Ala Ile Ser Arg Arg Lys Phe Ile Ile Gly Gly Thr Val Val Ala
1 5 10 15
Val Ala Ala Gly Ala Gly Ile Leu Thr Pro Met Leu Thr Arg Glu Gly
20 25 30
Arg Phe Val Pro Gly Thr Pro Arg His Gly Phe Val Glu Gly Thr Glu
35 40 45
Gly Ala Leu Pro Lys Gln Ala Asp Val Val Val Val Gly Ala Gly Ile
50 55 60
Leu Gly Ile Met Thr Ala Ile Asn Leu Val Glu Arg Gly Leu Ser Val
65 70 75 80
Val Ile Val Glu Lys Gly Asn Ile Ala Gly Glu Gln Ser Ser Arg Phe
85 90 95
Tyr Gly Gln Ala Ile Ser Tyr Lys Met Pro Asp Glu Thr Phe Leu Leu
100 105 110
His His Leu Gly Lys His Arg Trp Arg Glu Met Asn Ala Lys Val Gly
115 120 125
Ile Asp Thr Thr Tyr Arg Thr Gln Gly Arg Val Glu Val Pro Leu Asp
130 135 140
Glu Glu Asp Leu Val Asn Val Arg Lys Trp Ile Asp Glu Arg Ser Lys
145 150 155 160
Asn Val Gly Ser Asp Ile Pro Phe Lys Thr Arg Ile Ile Glu Gly Ala
165 170 175
Glu Leu Asn Gln Arg Leu Arg Gly Ala Thr Thr Asp Trp Lys Ile Ala
180 185 190
Gly Phe Glu Glu Asp Ser Gly Ser Phe Asp Pro Glu Val Ala Thr Phe
195 200 205
Val Met Ala Glu Tyr Ala Lys Lys Met Gly Val Arg Ile Tyr Thr Gln
210 215 220
Cys Ala Ala Arg Gly Leu Glu Thr Gln Ala Gly Val Ile Ser Asp Val
225 230 235 240
Val Thr Glu Lys Gly Ala Ile Lys Thr Ser Gln Val Val Val Ala Gly
245 250 255
Gly Val Trp Ser Arg Leu Phe Met Gln Asn Leu Asn Val Asp Val Pro
260 265 270
Thr Leu Pro Ala Tyr Gln Ser Gln Gln Leu Ile Ser Gly Ser Pro Thr
275 280 285
Ala Pro Gly Gly Asn Val Ala Leu Pro Gly Gly Ile Phe Phe Arg Glu
290 295 300
Gln Ala Asp Gly Thr Tyr Ala Thr Ser Pro Arg Val Ile Val Ala Pro
305 310 315 320
Val Val Lys Glu Ser Phe Thr Tyr Gly Tyr Lys Tyr Leu Pro Leu Leu
325 330 335
Ala Leu Pro Asp Phe Pro Val His Ile Ser Leu Asn Glu Gln Leu Ile
340 345 350
Asn Ser Phe Met Gln Ser Thr His Trp Asn Asn Asp Glu Val Ser Pro
355 360 365
Phe Glu Gln Phe Arg Asn Met Thr Ala Leu Pro Asp Leu Pro Glu Leu
370 375 380
Asn Ala Ser Leu Glu Lys Leu Lys Ala Glu Phe Pro Ala Phe Lys Glu
385 390 395 400
Ser Lys Leu Ile Asp Gln Trp Ser Gly Ala Met Ala Ile Ala Pro Asp
405 410 415
Glu Asn Pro Ile Ile Ser Glu Val Lys Glu Tyr Pro Gly Leu Val Ile
420 425 430
Asn Thr Ala Thr Gly Trp Gly Met Thr Glu Ser Pro Val Ser Ala Glu
435 440 445
Leu Thr Ala Asp Leu Leu Leu Gly Lys Lys Pro Val Leu Asp Pro Lys
450 455 460
Pro Phe Ser Leu Tyr Arg Phe
465 470
<210> 4
<211> 31
<212> DNA
<213>artificial sequence
<220>
<221> misc_feature
<222> (11)..(12)
<223> n is a, c, g, t or u
<400> 4
agcattacct nnkttccctg tgcatatttc t 31
<210> 5
<211> 38
<212> DNA
<213>artificial sequence
<400> 5
aataatggca gatatttata gccataagtg aaggattc 38
<210> 6
<211> 39
<212> DNA
<213>artificial sequence
<220>
<221> misc_feature
<222> (1)..(2)
<223> n is a, c, g, t or u
<400> 6
nnkgatgaag tttctccgtt tgagcaattc agaaatatg 39
<210> 7
<211> 32
<212> DNA
<213>artificial sequence
<400> 7
gttccaatgc gttgattgca taaatgaatt ga 32
Claims (9)
1. a kind of l-amino acid deaminase mutant, which is characterized in that its amino acid sequence is as shown in SEQ ID NO.2.
2. encoding the gene of l-amino acid deaminase mutant described in claim 1.
3. carrying the cell of gene described in claim 2.
4. cell according to claim 3, which is characterized in that be Escherichia coli.
5. carrying the plasmid of gene described in claim 2.
6. a kind of method for constructing l-amino acid deaminase mutant described in claim 1, which is characterized in that including walking as follows
It is rapid:
(1) mutational site of the l-amino acid deaminase from proteus vulgaris determines: by amino acid sequence such as SEQ ID
L-amino acid deaminase shown in NO.1 is from 340 aspartic acids of N-terminal as saturation mutation site；
(2) foundation in l-amino acid deaminase mutant library and mutant screening: to carry, coding is described to come from common variation bar
The recombinant plasmid of the gene of the l-amino acid deaminase of bacterium is template, designs degenerate primer, carries out full plasmid PCR reaction, is constructed
Saturated mutant library is pinpointed, Escherichia coli is transferred to, obtains saturated mutant library；
(3) screening obtains target L-amino acid deaminase mutant from mutant library.
7. application of the l-amino acid deaminase mutant described in claim 1 in food, pharmacy, feed.
8. application of the l-amino acid deaminase mutant described in claim 1 in health care product.
9. l-amino acid deaminase mutant described in claim 1 is formed in corresponding 2-ketoacid in catalysis l-amino acid deamination
Application.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711242323.1A CN107904222B (en) | 2017-11-30 | 2017-11-30 | A kind of l-amino acid deaminase mutant and its construction method that thermal stability improves |
| PCT/CN2017/116184 WO2019104759A1 (en) | 2017-11-30 | 2017-12-14 | L-amino acid deaminase mutants having increased thermal stability and construction method therefor |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711242323.1A CN107904222B (en) | 2017-11-30 | 2017-11-30 | A kind of l-amino acid deaminase mutant and its construction method that thermal stability improves |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107904222A CN107904222A (en) | 2018-04-13 |
| CN107904222B true CN107904222B (en) | 2019-10-08 |
Family
ID=61848345
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711242323.1A Active CN107904222B (en) | 2017-11-30 | 2017-11-30 | A kind of l-amino acid deaminase mutant and its construction method that thermal stability improves |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN107904222B (en) |
| WO (1) | WO2019104759A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109097383A (en) * | 2018-08-10 | 2018-12-28 | 浙江正硕生物科技有限公司 | A kind of method of high flux screening l-amino acid deamination enzyme mutant recombinant bacterial strain |
| CN109136205B (en) * | 2018-08-10 | 2021-08-27 | 浙江正硕生物科技有限公司 | L-amino acid deaminase mutant with improved heat resistance and preparation method thereof |
| CN110643585B (en) * | 2019-11-08 | 2021-09-03 | 江南大学 | Method for producing alpha-ketone-beta-methyl n-pentanoic acid by using amino acid deaminase |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789247A (en) * | 2014-02-14 | 2014-05-14 | 江南大学 | Method for producing alpha-ketoisocaproate by whole-cell transformation |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103911400B (en) * | 2014-04-02 | 2016-04-27 | 江南大学 | A kind of method adopting resting cell to produce α-ketoglutaric acid |
| CN103937842B (en) * | 2014-04-11 | 2017-01-18 | 江南大学 | Method for increasing yield of alpha-oxoglutarate produced through whole-cell transformation |
| AU2016262569B9 (en) * | 2015-05-13 | 2021-09-16 | Synlogic Operating Company, Inc. | Bacteria engineered to reduce hyperphenylalaninemia |
| CN104830815B (en) * | 2015-06-02 | 2018-02-23 | 江南大学 | A kind of method that α phenylpyruvic acids are efficiently produced using resting cell |
-
2017
- 2017-11-30 CN CN201711242323.1A patent/CN107904222B/en active Active
- 2017-12-14 WO PCT/CN2017/116184 patent/WO2019104759A1/en active Application Filing
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103789247A (en) * | 2014-02-14 | 2014-05-14 | 江南大学 | Method for producing alpha-ketoisocaproate by whole-cell transformation |
Non-Patent Citations (1)
| Title |
|---|
| Proteus vulgaris LAD gene for L-amino acid deaminase, complete cds;NCBI;《GenBank》;20000218;参见"FEATURES"、"ORIGIN"的序列 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107904222A (en) | 2018-04-13 |
| WO2019104759A1 (en) | 2019-06-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2647785T3 (en) | Production of alkenes by enzymatic decarboxylation of 3-hydroxy-alkanoic acids | |
| De Las Rivas et al. | Analysis of the structure of the PsbO protein and its implications | |
| CN107904222B (en) | A kind of l-amino acid deaminase mutant and its construction method that thermal stability improves | |
| CN106497895B (en) | Leucine dehydrogenase mutant, encoding gene, carrier, engineering bacteria and its application | |
| CN109055327A (en) | Aldehyde Ketoreductase mutant and its application | |
| CN109251882A (en) | The Escherichia coli recombinant strain and its application of one plant of heat-resisting nitrile hydratase of heterogenous expression | |
| CN109055346A (en) | A kind of L-Aspartic acid-α-decarboxylase that thermal stability improves | |
| CN108251396A (en) | 5-aminolevulinate synthetase mutant and its host cell and application | |
| CN109251881A (en) | The Escherichia coli recombinant strain and its application of one plant of heterogenous expression nitrile hydratase | |
| Cario et al. | High hydrostatic pressure increases amino acid requirements in the piezo-hyperthermophilic archaeon Thermococcus barophilus | |
| CN104694524A (en) | Method for preparing glutamic acid decarboxylase mutant by utilizing ramachandran map information and mutant thereof | |
| CN109370998A (en) | A kind of ω-transaminase mutant I215F that catalytic efficiency improves | |
| CN107988176B (en) | Tyrosinase mutant with improved enzyme activity and stability and construction method thereof | |
| CN109486780A (en) | A kind of ω-transaminase mutant that catalytic efficiency improves | |
| CN103667165B (en) | The production bacterial strain of high yield L lysines and its application | |
| WO2022111058A1 (en) | Sip1aa soluble pesticidal protein mutants | |
| CN110331173A (en) | Application of the phenylpyruvate decarboxylase mutant M538A in biofermentation production benzyl carbinol | |
| CN105838690B (en) | A kind of N-acetylglutamat kinase mutants that thermal stability significantly improves | |
| CN105907735B (en) | A kind of N-acetylglutamat kinase mutants of catalytic efficiency and thermal stability raising | |
| CN107653257A (en) | A kind of encoding gene, recombinant expression carrier and the application of nicotinamide mononucleotide adenylyl transferase | |
| CN114277020B (en) | Nitrilase mutant, engineering bacterium and application thereof | |
| CN105969755B (en) | A kind of tyrosine decarboxylation enzyme mutant and its gene and application | |
| CN114426976A (en) | Preparation method of gamma-PGA (poly-glycolic acid) coupling ATP (adenosine triphosphate) regeneration enzyme and polyglutamic acid synthetase | |
| CN108004225A (en) | A kind of mutant of the Phenylalanine aminomutase in pantoea agglomerans source | |
| CN108277216A (en) | High activity S- cyanalcohols lyases and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |