CN107880127B - Fully human anti-PDL-1 single-chain antibody B129 and application thereof - Google Patents
Fully human anti-PDL-1 single-chain antibody B129 and application thereof Download PDFInfo
- Publication number
- CN107880127B CN107880127B CN201711292207.0A CN201711292207A CN107880127B CN 107880127 B CN107880127 B CN 107880127B CN 201711292207 A CN201711292207 A CN 201711292207A CN 107880127 B CN107880127 B CN 107880127B
- Authority
- CN
- China
- Prior art keywords
- pdl
- chain antibody
- variable region
- antibody
- fully human
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
- C07K16/2827—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
Landscapes
- Health & Medical Sciences (AREA)
- Immunology (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Life Sciences & Earth Sciences (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a fully human anti-PDL-1 single-chain antibody B129, the DNA sequence of which is shown in SEQ ID No.1, and the amino acid sequence of which is shown in SEQ ID No. 2. The single-chain antibody B129 provided by the invention is a single-chain antibody which is screened from a constructed fully human leukemia phage single-chain antibody library and can be specifically combined with extracellular domain PDL-1 protein. It has simple structure and is antibody heavy chain variable region VHAnd light chain variable region VLIs formed by connecting peptide, MW is 30-34kD, and contains complete antigen combining part; the growth inhibition effect is generated on PDL-1 positive tumor cells; the single-chain antibody has small molecular weight, strong penetrability and low immunogenicity, is an ideal drug transport carrier, can be used as a drug or a drug carrier to transport drugs, isotopes or toxin proteins, and provides an effective means for treating PDL-1 positive cancers.
Description
Technical Field
The invention belongs to genetic engineering, and relates to screening, identification and prokaryotic expression of a fully human anti-PDL-1 single-chain antibody B129 and application thereof in preparation of targeted drugs.
Background
The phage display antibody technology can prepare fully human antibody, and is characterized by that the gene of protein molecule or peptide fragment is cloned into the genomic DNA of filamentous phage, and forms fusion protein with coat protein of phage so as to make the heterologous molecule be displayed on the surface of phage. The main characteristic is that the specific molecular gene type and expression type are presented in a phage particle at the same time, and the sequence information of the specific display protein can be obtained by DNA sequencing.
The phage antibody library technology simulates the differentiation and maturation process of human B cells, firstly, the heavy chain and light chain variable region genes of human antibodies are connected by means of molecular biology to form Single-chain antibodies (scFv), the scFv is inserted into a phage vector to display the scFv on the surface of phage, then specific antigens are used to screen out specific phage antibodies, and Escherichia coli is used for expression to express a large amount of Single-chain antibodies.
The phage may express an antibody binding Fragment (Fab), a single chain antibody (scFv), a Diabody (Diabody), a Bispecific antibody (BsAb), and the like. The single-chain antibody scFv is a small molecule antibody which is most reported at present and consists of a variable region Fv section for recognizing an antigen by an antibody. Fv variable region from heavy chain VHAnd light chain variable region VLThe scFv is constructed by linking with a linker. The linker added is important, must not affect the conformation of Fv, and the sequence repeated 3 times (GGGGS) composed of four glycines and one serine is most commonly used at present3. Cloning scFv gene between the leader sequence of the pIII gene of the filamentous phage vector and the pIII gene, introducing the pIII gene into the bacterial membrane gap in the form of fusion protein, assembling the pIII gene into scFv, and after adding the helper phage M13K07, expressing the scFv on the surface of the phage in the form of fusion protein. The pCANTAB-5E vector is characterized in that a sequence for coding a Tag tail peptide (E-Tag) is contained behind the scFv gene, an Amber (Amber) stop codon is arranged behind the E-Tag and is positioned between the scFv gene and the pIII gene, and in a suppressor bacterium TG1, the Amber codon is only 20 percent effective, so that the Amber codon can be read through to form scFv-pIII fusion protein in the protein translation process; in the non-inhibitory strains, such as HB2151, this terminator is recognized, while the scFv gene is terminated before the pIII gene, forming an independent antibody protein, which is retained in the cell membrane space and released into the culture medium after a long period of culture to form soluble expression.
The single-chain antibody scFv has the advantages of simple structure, small relative molecular weight, strong penetrability, low immunogenicity and the like, and is an ideal carrier. The aim of constructing a fully human antibody library is to find a single-chain antibody scFv which can be specifically combined with a specific leukemia related antigen (such as PDL-1 and the like), and the single-chain antibody or a variable region sequence thereof which can specifically identify tumor cells can be developed as an anti-tumor drug after being transformed into other antibody forms through genetic engineering; and secondly, the compound can be used as a drug carrier, such as a coupling drug, toxin or radioactive isotope, for tumor targeted therapy.
Disclosure of Invention
One of the purposes of the present invention is to provide a gene recombinant fully human anti-PDL-1 single-chain antibody B129. Screening out single-chain antibodies capable of specifically binding to extracellular domain PDL-1 protein from a constructed fully human leukemia phage single-chain antibody library.
The fully human anti-PDL-1 single-chain antibody B129 provided by the invention has the advantages of simple structure, relative molecular weight of 32.6kDa, strong penetrability, low immunogenicity and the like, and is an ideal drug transport carrier.
The DNA sequence of the fully human anti-PDL-1 single-chain antibody B129 is shown in SEQ ID No. 1:
ATGGCCCAGGTCCAGCTTGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGGATAGCATCAAATGCCTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGTGGTGGAGGATCTGGCGGCGGCGGCTCCGGTGGTGGTGGATCTGACATCCGGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCCACTGCAAGTCTAGCCAGAGTCCTTTCTACAGCTCCAATAACAAGAACTACTTAGCTTGGTACCAACAGAAGCCGGGACAGCCTCCTAAACTCCTCATTTACTGGGCAACTTCCCGGGAATTCGGGGTCCCTGCCCGATTCAGTGGCGACGGGTCTGGGACAGATTTCACTCTCACCATCGACAGCCTGCAGGCTGAAGATGTGGGGGTTTATTTCTGTCAGCAATATTTGAGTCTCCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAA。
the amino acid sequence of the fully human anti-PDL-1 single-chain antibody B129 is shown as SEQ ID No.2
MAQVQLVQSGAEVKKPGESLKISCKGSGYSFTSYWIGWVRQMPGKGLEWMGIIYPGDSDTRYSPSFQGQVTISADKSISTAYLQWSSLKASDTAMYYCARIASNAFDIWGQGTMVTVSSGGGGSGGGGSGGGGSDIRMTQSPDSLAVSLGERATIHCKSSQSPFYSSNNKNYLAWYQQKPGQPPKLLIYWATSREFGVPARFSGDGSGTDFTLTIDSLQAEDVGVYFCQQYLSLPITFGQGTRLEIK。
The fully human anti-PDL-1 single-chain antibody B129 contains a complete antibody heavy chain variable region VHAnd light chain variable region VLIts heavy chain variable region VHThe amino acid sequence of CDR1 is: GYSFTSYW, heavy chain variable region VHThe amino acid sequence of CDR2 is IYPGDSDT, and the variable region of heavy chain VHThe amino acid sequence of CDR3 is: ARIASNAFDI, respectively; its light chain variable region VLThe amino acid sequence of CDR1 is: QSPFYSSNNKNY light chain variable region VLThe amino acid sequence of CDR2 is: WAT, light chain variable region VLThe amino acid sequence of CDR3 is: QQYLSLPIT are provided.
The invention also aims to provide the application of the fully human anti-PDL-1 single-chain antibody B129 and the variable region sequence thereof in preparing targeted therapeutic drugs and drug carriers for leukemia.
The invention has the advantages that: (1) the fully human single-chain antibody has simple structure and is the heavy chain variable region V of the antibodyHAnd light chain variable region VLComposed of connecting peptide (GGGGS)3Formed by connection, MW is 30-34kD, and contains complete antigen binding site; (2) the single-chain antibody can generate growth inhibition effect on PDL-1 positive tumor cells, such as A549 cells; (3) the single-chain antibody has small molecular weight, strong penetrability and low immunogenicity, can be used as a medicament or a medicament carrier to transport medicaments, isotopes or toxin protein, and can treat PDL-1 positive cancers.
Drawings
FIG. 1 is a schematic diagram of the enrichment screening process of phage antibody libraries.
FIG. 2 is an ELISA assay for binding activity of phage scFv to PDL-1-ECD protein.
FIG. 3 is a B129 positive strain gene sequence map, in which FIG. 3A is VHFragment sequences (including linker) and FIG. 3B is VLFragment sequence diagram.
FIG. 4 shows the inhibition of the cell lines by B129 positive phage monoclonals.
FIG. 5 is an SDS-PAGE electrophoresis of scFv proteins.
FIG. 6 is a diagram of immunoblot analysis of scFv proteins.
Detailed Description
The present invention is further described with reference to the following examples and accompanying drawings.
Example 1: screening of phage antibody libraries
The experimental method comprises the following steps: the cell-associated antigen extracellular domain (PDL-1-ECD) expressed by the laboratory is used for screening a fully human leukemia antibody library established by the laboratory. With Na2CO3/NaHCO3After dilution of the antigen, 96-well ELISA plates were added and coated overnight at 4 ℃. The next day, blocking with blocking solution for 1h, adding phage antibody library, and incubating at 37 deg.C for 2 h. TBS wash (5 passes for the first run, 10 passes for the second run, 10 passes for the third and fourth runs). The phages were eluted with glycine-hydrochloric acid (pH 2.2) and collected, neutralized to pH 7.0 with Tris-HCl, and the log phase of infection E.coli TG1 was left to stand at 37 ℃ for 20min, 10. mu.l of which was used for titer determination. Transferring the rest to 20ml2 XYT-A-G, and culturing at 37 deg.C with shaking to OD600nmWhen the temperature reaches 0.5, the helper phage is added, the mixture is shaken for 1h at 37 ℃, centrifuged, and the precipitate is resuspended in 200ml of 2 XYT-AK, shaken overnight at 30 ℃, and the phage is collected the next day. FIG. 1 is a diagram illustrating steps.
The experimental results are as follows: the phage antibody library is screened by target antigen PDL-1-ECD through four rounds of 'adsorption, elution and amplification', and the recovery rate (Yield) is measured at the same time, which shows that the recovery rate of the phage is increased continuously, and the results are shown in Table 1.
TABLE 1 enrichment screening results of phage antibody libraries
The results show that: recovery of phage bound to the target antigen PDL-1-ECD after three rounds of screening (2.23X 10)-4) Is the first round of screening recovery (5.92x 10)-9) 265470-fold, indicating that phage specifically bound to the target antigen have been effectively enriched.
Example 2: antibody library diversity analysis
The experimental method comprises the following steps: randomly selecting 400 single clones, and sending the selected clones to Nanjing Kingsry Biotech Co., Ltd for DNA sequence sequencing of the inserted region. The monoclonal DNA sequence encoding the amino acid sequence correctly was translated into amino acids and analyzed by sequence alignment using ClustaIX software (http:// www.ncbi.nlm.nih.gov/igblast /).
The experimental results are as follows: the results of sequence analysis showed that the DNA of the insertion region of 8 phage clones correctly encoded amino acids, and the results of amino acid sequence alignment are shown in Table 2, in which the DNA sequences of the insertion regions of two phage strains, No. 10 and No. 38, No. 36 and No. 46, were identical.
TABLE 2 ClustaIW sequence alignment analysis results
The results show that: in 8 selected monoclonal phages, the DNA sequences of the phage insert regions were identical except for the four phage insert regions of No. 10 and No. 38 and No. 36 and No. 46, and the sequences of the remaining 6 phage insert regions were different from each other.
Example 3: ELISA for identifying antibody specificity
The experimental method comprises the following steps: phage monoclonals obtained after three rounds of screening are selected and sequenced. And (3) preparing the monoclonal recombinant phage from the monoclonal containing the sequence which can be sequenced and read through. The antigen was diluted with PBS, added to a 96-well plate, and coated overnight at 4 ℃. After being taken out, the monoclonal recombinant phage to be detected is sealed for 1h at 37 ℃, added into a 96-well plate and incubated for 2h at 37 ℃. PBS is used as a negative control, HRP/anti-M13 antibody is added, the mixture is incubated for 1H at 37 ℃, a substrate TMB-H2O2 is added for color development, and an enzyme-linked immunosorbent assay is used for measuring the A450nm value.
The experimental results are as follows: ELSIA validation with monoclonal phage antibodies was performed and the results are shown in FIG. 2, where B10-A200 is the selected read-through sequence of 15 strains, PBS and phage LIB are negative controls, and the A450nm value is < 0.2. The phage sequences No. B10/B38/B36/B46 are completely identical, and the values of B30, B31, B84 and B129A450nm are between 0.1 and 0.6.
The results show that: among 15 selected phages, B129 was strongly positive. Among them, B10, B38, B36 and B46 (with identical sequences) have very good binding activity with target antigen.
Example 4: gene sequence analysis of Single chain antibody displayed by Positive Strain
The experimental method comprises the following steps: DNA sequence map of Single-chain antibody FIG. 3, according to the DNA sequence map, reading frame sequence is imported into VBASE2 database (http://www.vbase2.org/) And analyzing to obtain a single-chain antibody structure analysis chart.
The experimental results are as follows: the analysis result is shown in FIG. 3A as VHFragment sequences (including linker) and FIG. 3B is VLFragment sequence diagram, the heavy and light chains are seen to have the FR1, FR2, FR3, FR4, CDR1, CDR2 and CDR3 domains, respectively.
The results show that: the scFv displayed by the positive strain has a complete antigen binding region and has a correct single-chain antibody structure.
Example 5: determination of specific inhibition of phage single-chain antibody on tumor cells
The experimental method comprises the following steps: selecting PDL-1 positive tumor cell strain A549 and PDL-1 negative tumor cell strain MDA453 at 37 deg.C and 5% CO2Culturing to log phase; centrifuging the cell culture suspension, removing the supernatant, and collecting cells; suspending the cells in cell culture medium at 5.0X 103-1.0×104cells/well density seeded in 96-well cell culture plates at 37 ℃ and 5% CO2Culturing for 24h under the condition of (1); amplifying the phage 3 identified to be positive by ELISA, adding scFv with different concentrations, incubating for 48-72h, setting 4 multiple wells in each well, and taking M13 phage diluted by PBS and PBS as negative control; adding cck-8 solution, and incubating for 1h at 37 ℃; the absorbance values were measured at 470nm wavelength and the inhibition of cell growth by different concentrations of scFv was calculated.
The experimental results are as follows: as shown in FIG. 4, the monoclonal phage scFv can inhibit A549 cells, and the inhibition effect on A549 cells can reach more than 50% at most. MDA453 cells were used as negative control, which showed only slight inhibition, and significant differences from PDL-1 positive cells (P < 0.05).
The results show that: the screened fully human anti-PDL-1 single-chain antibody B129 can generate obvious growth inhibition effect on PDL-1 positive A549 cells, and has no obvious inhibition effect on PDL-1 negative MDA453 cells; the inhibition effect has obvious specificity.
Example 6: soluble expression of single chain antibody scFv
The experimental method comprises the following steps: taking the positive cloned recombinant phage to infect E.coli BL21 in logarithmic growth phase, inoculating the E.coli BL21 on an SOBAG-pyrimidineic acid plate, and incubating overnight at 30 ℃; selecting a clone, and culturing in 2 XYT-AG at 30 deg.C overnight; the next day overnight, inoculum 1: 10 adding into 50ml 2 XYT-AG, culturing at 30 ℃ for lh, centrifuging, discarding the supernatant, resuspending the precipitate in 50ml 2 XYT-Amp-IPTG, culturing at 30 ℃ for 6-7 h, centrifuging, resuspending the precipitate in 2.5ml 25mM Tris-HCl (pH 7.3) containing 20% sucrose, fully suspending, and ice-cooling for 30 min; centrifuging again to collect thalli, adding 5ml of double distilled water for resuspension, carrying out ice bath for 30min, and centrifuging to obtain supernatant, namely periplasmic protein; the obtained protein was analyzed by 12% SDS-PAGE electrophoresis.
The experimental results are as follows: IPTG induction, SDS-PAGE electrophoresis detection, see FIG. 5, M: is a protein molecular weight standard; B30/B36/B129 are expression inclusion bodies after dialysis, and a band with the molecular weight of about 33kD can be seen.
The results show that: expression in single chain antibody scFv cells induced by IPTG; the single-chain antibody can be expressed and prepared in a prokaryotic system by a genetic engineering method.
Example 7: identification of scFv protein by Western blot
The experimental method comprises the following steps: preparing a protein sample by the same method as the embodiment 6, carrying out 12% SDS-PAGE electrophoresis, taking down the acrylamide gel after electrophoresis, transferring the acrylamide gel to a PVDF membrane, and rotating the PVDF membrane at a constant voltage of 100V for 90 min; taking down the PVDF membrane, sealing the PVDF membrane with a sealing solution (TBST-5% skimmed milk powder), and slowly shaking for 1 h; diluting Anti-Rabbit Anti-6 × His tag antibody, taking out the PVDF membrane, placing the PVDF membrane in a confining liquid, slowly shaking for 1h, and washing for 5min × 5 times by using TBST; diluting the secondary antibody Goat anti-rabbit IgG-FIFC conjugate with the blocking solution, slowly shaking for 1h, and washing with TBST for 5min × 5 times; chemiluminescence ECL color development, and photographing to record results.
The experimental results are as follows: western blot detection shows that the molecular weight of the DNA fragment is MW 33kD in all the bands shown in FIG. 6, B30, B36 and B129.
The results show that: the Western blot method further proves that the single-chain antibody scFv can be expressed in the periplasm of cells and whole cells, and also has a small amount of expression in culture supernatant.
In summary, we screened a single-chain antibody which can be specifically combined with PDL-1 molecule from the fully human antibody library, and proved that the structure is correct by DNA sequence determination, ELISA analysis and electrophoresis identification, and the single-chain antibody can be expressed by escherichia coli; the single-chain antibody or the variable region sequence thereof can be modified into other antibody forms by genetic engineering and other methods, and can be used as an anti-tumor drug or drug carrier, such as a coupling drug, a toxin or a radioactive isotope, for PDL-1 positive targeted therapy.
Without further elaboration, it is believed that one skilled in the art can, using the preceding disclosure, utilize the present invention to its fullest extent. The foregoing preferred embodiments are, therefore, to be construed as merely illustrative and not limitative of the remainder of the disclosure in any way whatsoever.
Sequence listing
<110> Zhejiang university
<120> fully human anti-PDL-1 single-chain antibody B129 and application thereof
<160>2
<170>SIPOSequenceListing 1.0
<210>1
<211>741
<212>DNA
<213> Artificial sequence (Unknown)
<400>1
atggcccagg tccagcttgt gcagtctgga gcagaggtga aaaagcccgg ggagtctctg 60
aagatctcct gtaagggttc tggatacagc tttaccagct actggatcgg ctgggtgcgc 120
cagatgcccg ggaaaggcct ggagtggatg gggatcatct atcctggtga ctctgatacc 180
agatacagcc cgtccttcca aggccaggtc accatctcag ccgacaagtc catcagcacc 240
gcctacctgc agtggagcag cctgaaggcc tcggacaccg ccatgtatta ctgtgcgagg 300
atagcatcaa atgcctttga tatctggggc caagggacaa tggtcaccgt ctcttcaggt 360
ggtggaggat ctggcggcgg cggctccggt ggtggtggat ctgacatccg gatgacccag 420
tctccagact ccctggctgt gtctctgggc gagagggcca ccatccactg caagtctagc 480
cagagtcctt tctacagctc caataacaag aactacttag cttggtacca acagaagccg 540
ggacagcctc ctaaactcct catttactgg gcaacttccc gggaattcgg ggtccctgcc 600
cgattcagtg gcgacgggtc tgggacagat ttcactctca ccatcgacag cctgcaggct 660
gaagatgtgg gggtttattt ctgtcagcaa tatttgagtc tcccgatcac cttcggccaa 720
gggacacgac tggagattaa a 741
<210>2
<211>247
<212>PRT
<213> Artificial sequence (Unknown)
<400>2
Met Ala Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro
1 5 10 15
Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Ser Phe Thr
20 25 30
Ser Tyr Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu
35 40 45
Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro
50 55 60
Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Asp Lys Ser Ile Ser Thr
65 70 75 80
Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr
85 90 95
Tyr Cys Ala Arg Ile Ala Ser Asn Ala Phe Asp Ile Trp Gly Gln Gly
100105 110
Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly
115 120 125
Ser Gly Gly Gly Gly Ser Asp Ile Arg Met Thr Gln Ser Pro Asp Ser
130 135 140
Leu Ala Val Ser Leu Gly Glu Arg Ala Thr Ile His Cys Lys Ser Ser
145 150 155 160
Gln Ser Pro Phe Tyr Ser Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr
165 170 175
Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile Tyr Trp Ala Thr
180 185 190
Ser Arg Glu Phe Gly Val Pro Ala Arg Phe Ser Gly Asp Gly Ser Gly
195 200 205
Thr Asp Phe Thr Leu Thr Ile Asp Ser Leu Gln Ala Glu Asp Val Gly
210 215 220
Val Tyr Phe Cys Gln Gln Tyr Leu Ser Leu Pro Ile Thr Phe Gly Gln
225 230 235 240
Gly Thr Arg Leu Glu Ile Lys
245
Claims (2)
1. The fully human anti-PDL-1 single-chain antibody B129 is characterized in that the DNA sequence of the fully human anti-PDL-1 single-chain antibody B129 is shown as SEQ ID No. 1:
ATGGCCCAGGTCCAGCTTGTGCAGTCTGGAGCAGAGGTGAAAAAGCCCGGGGAGTCTCTGAAGATCTCCTGTAAGGGTTCTGGATACAGCTTTACCAGCTACTGGATCGGCTGGGTGCGCCAGATGCCCGGGAAAGGCCTGGAGTGGATGGGGATCATCTATCCTGGTGACTCTGATACCAGATACAGCCCGTCCTTCCAAGGCCAGGTCACCATCTCAGCCGACAAGTCCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCTCGGACACCGCCATGTATTACTGTGCGAGGATAGCATCAAATGCCTTTGATATCTGGGGCCAAGGGACAATGGTCACCGTCTCTTCAGGTGGTGGAGGATCTGGCGGCGGCGGCTCCGGTGGTGGTGGATCTGACATCCGGATGACCCAGTCTCCAGACTCCCTGGCTGTGTCTCTGGGCGAGAGGGCCACCATCCACTGCAAGTCTAGCCAGAGTCCTTTCTACAGCTCCAATAACAAGAACTACTTAGCTTGGTACCAACAGAAGCCGGGACAGCCTCCTAAACTCCTCATTTACTGGGCAACTTCCCGGGAATTCGGGGTCCCTGCCCGATTCAGTGGCGACGGGTCTGGGACAGATTTCACTCTCACCATCGACAGCCTGCAGGCTGAAGATGTGGGGGTTTATTTCTGTCAGCAATATTTGAGTCTCCCGATCACCTTCGGCCAAGGGACACGACTGGAGATTAAA；
the amino acid sequence of the fully human anti-PDL-1 single-chain antibody B129 is shown in SEQ ID No. 2:
MAQVQLVQSGAEVKKPGESLKISCKGSGYSFTSYWIGWVRQMPGKGLEWMGIIYPGDSDTRYSPSFQGQVTISADKSISTAYLQWSSLKASDTAMYYCARIASNAFDIWGQGTMVTVSSGGGGSGGGGSGGGGSDIRMTQSPDSLAVSLGERATIHCKSSQSPFYSSNNKNYLAWYQQKPGQPPKLLIYWATSREFGVPARFSGDGSGTDFTLTIDSLQAEDVGVYFCQQYLSLPITFGQGTRLEIK；
the fully human anti-PDL-1 single-chain antibody B129 contains a complete antibody heavy chain variable region VHAnd light chain variable region VLIts heavy chain variable region VHThe amino acid sequence of CDR1 is: GYSFTSYW, heavy chain variable region VHThe amino acid sequence of CDR2 is IYPGDSDT, and the variable region of heavy chain VHThe amino acid sequence of CDR3 is: ARIASNAFDI, respectively; its light chain variable region VLThe amino acid sequence of CDR1 is: QSPFYSSNNKNY light chain variable region VLThe amino acid sequence of CDR2 is: WAT, light chain variable region VLThe amino acid sequence of CDR3 is: QQYLSLPIT are provided.
2. The application of the fully human anti-PDL-1 single-chain antibody B129 in the preparation of drugs and drug carriers for targeted therapy of leukemia according to claim 1, wherein the application refers to the application of the single-chain antibody per se or the light chain variable region sequence and the heavy chain variable region sequence in the preparation of drugs and drug carriers for targeted therapy of leukemia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711292207.0A CN107880127B (en) | 2017-12-08 | 2017-12-08 | Fully human anti-PDL-1 single-chain antibody B129 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711292207.0A CN107880127B (en) | 2017-12-08 | 2017-12-08 | Fully human anti-PDL-1 single-chain antibody B129 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107880127A CN107880127A (en) | 2018-04-06 |
| CN107880127B true CN107880127B (en) | 2020-05-22 |
Family
ID=61773174
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711292207.0A Active CN107880127B (en) | 2017-12-08 | 2017-12-08 | Fully human anti-PDL-1 single-chain antibody B129 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107880127B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4032908A4 (en) * | 2019-10-21 | 2023-11-08 | HC Biopharma (Shanghai) Co., Ltd | Anti-pd-l1 antibody and pharmaceutical use thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106573052A (en) * | 2014-07-22 | 2017-04-19 | 中美冠科生物技术（太仓）有限公司 | Anti-PD-1 antibodies |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015195163A1 (en) * | 2014-06-20 | 2015-12-23 | R-Pharm Overseas, Inc. | Pd-l1 antagonist fully human antibody |
-
2017
- 2017-12-08 CN CN201711292207.0A patent/CN107880127B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106573052A (en) * | 2014-07-22 | 2017-04-19 | 中美冠科生物技术（太仓）有限公司 | Anti-PD-1 antibodies |
Non-Patent Citations (2)
| Title |
|---|
| PDL1 Regulation by p53 via miR-34;Maria Angelica,Cortez等;《Journal of the National Cancer Institute》;20151117;第108卷(第1期);第1-9页 * |
| 鼠抗人PD-L1单克隆抗体的制备及鉴定;陈娇等;《四川大学学报（医学版）》;20111231;第42卷(第1期);第5-9页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107880127A (en) | 2018-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210002370A1 (en) | Pd-l1 nanobodies, preparation methods and uses thereof | |
| Singh et al. | Construction of a single-chain variable-fragment antibody against the superantigen staphylococcal enterotoxin B | |
| CN102952191B (en) | Fully human CD33 single-chain antibody ZJL101 and applications thereof | |
| CN112028997B (en) | anti-CEACAM 5 nano antibody | |
| CN111138537B (en) | Anti-human serum albumin antibody fragment, preparation method and application | |
| CN113150152B (en) | Specific nano antibody of human T cell surface inhibitory molecule and application thereof | |
| Wang et al. | Screening for a single-chain variable-fragment antibody that can effectively neutralize the cytotoxicity of the Vibrio parahaemolyticus thermolabile hemolysin | |
| CN108484771A (en) | Epcam single domain antibodies g7 | |
| CN114106187B (en) | Specific shark single-domain antibody targeting OGT (one glass solution) and preparation method and application thereof | |
| CN111138536B (en) | Preparation and application of anti-human serum albumin single-domain antibody | |
| CN107880127B (en) | Fully human anti-PDL-1 single-chain antibody B129 and application thereof | |
| CN109503711B (en) | Difunctional nanobody for detecting PCV2 virus by hemagglutination method, coding gene and application thereof | |
| CN110396128B (en) | Preparation of anti-CD 19 nano antibody | |
| CN108059677B (en) | Fully human anti-PDL-1 single-chain antibody B36 and application thereof | |
| CN108059678B (en) | Fully human anti-PDL-1 single-chain antibody B30 and application thereof | |
| CN114805559B (en) | Fully human anti-novel coronavirus receptor binding domain single-chain antibody No4 and application thereof | |
| US20240150460A1 (en) | Anti-nkp30 antibody and application thereof | |
| Leow et al. | The development of single domain antibodies for diagnostic and therapeutic applications | |
| CN110804096B (en) | CD123 single domain antibody, nucleotide sequence, expression vector and kit | |
| CN115975015A (en) | Peste des petits ruminants virus (PPRV) F protein nano antibody and preparation, purification and neutralization test method thereof | |
| Krishnaswamy et al. | Different buffer effects in selecting HM-1 killer toxin single-chain fragment variable anti-idiotypic antibodies | |
| Zhang et al. | A combined phage display ScFv library against Myxobolus rotundus infecting crucian carp, Carassius auratus auratus (L.), in China | |
| CN114409792B (en) | anti-EphB 4 nano antibody | |
| US20150240230A1 (en) | Method for producing and obtaining variable domains of anti-digoxin monoclonal antibody fab fragment using the molecular biology cloning technique | |
| CN114957469B (en) | anti-NKp 30 antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |