CN107868839B

CN107868839B - SNP (Single nucleotide polymorphism) marker for analyzing rice genetic diversity and identifying variety, primer and application

Info

Publication number: CN107868839B
Application number: CN201711160239.5A
Authority: CN
Inventors: 秦瑞英; 许学; 马卉; 倪金龙; 李莉; 汪秀峰; 李�浩; 杨亚春; 宋风顺; 王钰; 杨剑波
Original assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Current assignee: Rice Research Institute of Anhui Academy of Agricultural Sciences
Priority date: 2017-11-20
Filing date: 2017-11-20
Publication date: 2021-04-30
Anticipated expiration: 2037-11-20
Also published as: CN107868839A

Abstract

The invention belongs to the technical field of molecular biology, and particularly discloses an SNP marker for analyzing genetic diversity of rice and identifying varieties, a site of the SNP marker in rice, a primer for obtaining the SNP marker, and related applications. The SNP marker has good universality and does not need large-scale equipment and instruments; the SNP marker can accurately distinguish the genotype of a variety to be detected and the genetic difference among the varieties, and the difference of loci with close genetic distances can also be distinguished; after the primer of a certain site is designed, a plurality of individuals can be researched aiming at the site, and the cost can be well controlled.

Description

SNP (Single nucleotide polymorphism) marker for analyzing rice genetic diversity and identifying variety, primer and application

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to an SNP marker for analyzing rice genetic diversity and identifying varieties and application thereof.

Background

The rice is an important grain crop in China, and the hybrid rice makes great contribution to the grain safety of China and even the world with the remarkable yield advantage. The popularization and the use of the new variety play an extremely important role in guaranteeing the food supply of China and meeting the diversified demands of people. During the year of 2001 + 2015, 6310 rice varieties approved by provincial level or higher all over the country are reached. The method effectively discriminates the variety materials, and has important practical significance on variety breeding, test, quality and market management of rice and property protection.

The morphological difference and the characteristic difference of the varieties are essentially caused by the difference of genes. The method for identifying the genotype difference of different varieties of rice by using DNA molecular markers is an effective and rapid method for identifying varieties at present. The SSR marker has the characteristics of simple and rapid operation, high polymorphism, good stability and the like, can accurately reveal SSR polymorphism of the same site among different varieties, and is widely applied to construction of genetic maps, genetic diversity analysis and identification of purity and authenticity of the varieties. However, since the SSR markers have poor or poor association with the agronomic traits of varieties, it is difficult to distinguish between near isogenic lines or functional replacement lines, and for such varieties, SNP markers (functional markers) of functional genes with related characteristics are required to distinguish between the varieties and the original varieties.

Single Nucleotide Polymorphism (SNP) mainly refers to a DNA sequence polymorphism caused by variation of a single nucleotide at the genome level. SNPs exhibit polymorphisms that involve only single base variations, which can be caused by single base transitions or transversions, or by base insertions or deletions. SNPs are widely distributed in genomes of organisms, and SNPs occurring at coding region positions are called csnps (coding regions SNPs), and in addition, occur in non-coding regions at 5', 3' ends of genes, and introns. The SNP markers are more in quantity and widely distributed, for example, in a corn genome, the average density of the SNP markers is about 1 SNP/57 bp; in the soybean genome, the average density of SNP markers is about 1 SNP/272 bp; in the rice genome, the average density of SNP markers is about 1 SNP/170 bp. Therefore, it is necessary to develop a functional SNP marker which is closely related to the agronomic shape of rice and can analyze the genetic diversity of rice and identify varieties by utilizing the intra-and inter-species polymorphism and versatility of the SNP marker.

Disclosure of Invention

The SNP marker for analyzing the genetic diversity of the rice and identifying the variety and the application thereof provided by the invention develop the functional SNP marker which is closely related to the agronomic shape of the rice, can analyze the genetic diversity of the rice and identify the variety.

The first object of the present invention is to provide a SNP marker for analyzing genetic diversity of rice cultivars, wherein the positions of the SNP marker in rice cultivars are shown in Table 1:

TABLE 1 different SNP marker sites, corresponding primer sequences

The second purpose of the invention is to provide a primer for obtaining the SNP marker of the variety identified by analyzing the genetic diversity of the rice, and a primer sequence table 1 corresponding to the SNP marker is obtained.

The third purpose of the invention is to provide the application of the SNP marker for analyzing the genetic diversity and identifying varieties of rice in the rice molecular marker-assisted breeding.

The fourth purpose of the invention is to provide the application of the primer of the SNP marker for rice genetic diversity and variety identification in rice molecular marker-assisted breeding.

Compared with the prior art, the SNP marker for analyzing the genetic diversity and identifying the varieties of the rice and the application thereof have the following beneficial effects:

(1) the SNP marker has good universality and does not need large-scale equipment and instruments; the SNP marker of the invention can accurately distinguish the genotype of the variety to be detected and the genetic difference among the varieties, and the difference of the loci with close genetic distance can also be distinguished. (2) After the primer of a certain site is designed, a plurality of individuals can be researched aiming at the site, and the cost can be well controlled. When the SNP marker is used for fingerprint spectrum identification of different germplasm materials, the purpose of identifying a specific germplasm material by using 1 SNP marker can be realized by screening characteristic SNP markers identified aiming at different germplasm materials.

Drawings

FIG. 1 is a diagram of cluster analysis of the application of SNP markers in genetic diversity analysis of rice;

FIG. 2 shows the amplification and restriction enzyme digestion results of SNP markers in CAPs marker analysis of rice genetic diversity;

in FIG. 2, lane M shows a 50bp Marker; lanes 1-4 represent the sample male parent; lanes 5-8 represent the maternal sample; lanes 9-28 represent 20 progeny;

FIG. 3 is an electrophoresis diagram of the identification of a target gene based on an SNP marker in rice molecular marker-assisted selective breeding;

in FIG. 3, lane M represents 50 bpmarker; lanes 1-4 represent the sample male parent; lanes 5-8 represent the maternal sample; lanes 9-28 show 20 progeny of the cross.

Detailed Description

The present invention is described in detail below with reference to specific examples, but the present invention should not be construed as being limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified, and materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Test materials and methods

245 parts of main hybrid rice and parent samples (shown in table 2) are collected in the middle and lower reaches of Yangtze river, wherein 157 parts of conventional seeds/parents, 38 parts of two-line hybrid seeds and 50 parts of three-line hybrid seeds are collected. Extracting single DNA (10 single plants of each variety) by a CTAB method, storing at 20 ℃ and taking the DNA as an experimental material for the next work.

TABLE 2245 Rice samples

2. Functional gene screening of rice

Starting from the characteristics and characteristics determining the characteristics of rice varieties, known important functional genes closely related to the main agronomic characteristics of rice are selected, and specific information is shown in table 3.

TABLE 3 function of known important genes closely related to major agronomic traits in rice

3. Functional SNP marker screening

3.1, seed sprouting: from the rice samples collected in Table 1, 96 conventional/parental samples were randomly selected, several seeds were taken, and germinated at 28 ℃ for one week.

3.2, DNA extraction: DNA was extracted by CTAB method.

3.3, PCR amplification reaction system: 1 XPCR buffer, 2.5mmol/L Mg²⁺0.25mmol/L dNTPs, 0.1. mu. mol/L forward primer 1, 0.1. mu. mol/L forward primer 2, 0.2. mu. mol/L downstream primer, 1.0U Taq DNA polymerase, 20ng to 40ng sample DNA, totalThe volume is 10 μ L.

3.4, PCR reaction program: circulating for 10 times at 94 deg.C for 15min, 94 deg.C for 20s, 76 deg.C for 30s (0.6 deg.C per cycle), circulating for 26 times at 94 deg.C for 20s, 55 deg.C for 1min, and storing at 72 deg.C for 5min at 30 deg.C. The denaturation program was run on a PCR instrument.

3.5, detecting the PCR amplification product by electrophoresis (non-denaturing polyacrylamide gel): adding 0.5 volume percent ammonium persulfate solution and 0.1 volume percent TEMED into 6 volume percent non-denatured polyacrylamide solution, fully and uniformly mixing, and pouring glue. Performing pre-electrophoresis for 10-30min at constant voltage of 100V. Each well was loaded with 1-3. mu.L. 200-250V constant voltage, electrophoresis for 1-2h, and electrophoresis of the xylene cyanide FF to the middle part. The power is turned off, the gel is peeled off from the glass plate, and the mark is made in time to distinguish the rubber plate. The gel was immersed in the fixative and placed on a shaker for 5min of fixation. With appropriate amount of ddH₂O quick rinse once. The staining solution prepared in advance is shaken for 10 min. With appropriate amount of ddH₂O (0.1% sodium thiosulfate in 0.2% volume) was rinsed quickly for no more than 10 seconds. Shaking in fresh developer until clear bands appear. Fixing in the fixing solution for 5 min. The results were recorded directly on a film viewing light or a photograph.

3.6 capillary electrophoresis fluorescence detection

And (3) PCR amplification: amplifying 4 single plants in each sample, wherein the amplification reaction system is as follows: 1 XPCR buffer, 2.5mmol/L Mg²⁺0.25mmol/L dNTPs, 0.1 mu mol/L upstream primer 1, 0.1 mu mol/L upstream primer 2, 0.1 mu mol/L anchored primer 1, 0.1 mu mol/L anchored primer 2, 0.2 mu mol/L downstream primer, 1.0U Taq DNA polymerase, 20ng-40ng sample DNA, and the total volume is 10 mu L. The reaction procedure is as in 3.4.

Fluorescence detection: the PCR product was diluted 40-fold, 1. mu.L of the diluted PCR product, 9.05. mu.L of deionized formamide, 0.05. mu.L of Genescan500-LIZ molecular weight internal standard (ABI), centrifuged at 4000r/min for 1min, denatured at 95 ℃ for 5min, placed on ice for 10min, and analyzed by capillary electrophoresis on an ABI3730DNA analyzer. Pre-electrophoresis for 3min at 15 kV; carrying out electro-injection for 10s under 2 kV; electrophoresis is carried out for 20min at 15 kV. Meanwhile, raw Data was collected with Data collection software. After the electrophoresis is finished, the original Data collected by the Data Collection software is analyzed by using Genemapper4.0 software, and the software system compares the position of a target peak with an internal standard Genescan500-LIZ in the same lane so as to determine the accurate length (unit: bp) of SSR amplified fragments of different samples. Independent 4 replicates of each sample were run, with the 4 replicates averaged and rounded off as the size of the amplified fragment at this site for that sample.

3.7 SNP marker screening

2687 SNP sites for sorting the functional genes are downloaded through a related website (http:// ricevarmap. ncpgr. cn /). Combining related documents, the knockout effect is nonsense mutation (Synonymous), Intron (INNTRON), Non-functional sites such as 5-terminal untranslated region (UTR-5-PRIME), 3-terminal untranslated region (UTR-3-PRIME), and the like, Non-nonsense mutation (Non-Synonymous), introduction initiation codon (introductions codon), destruction initiation codon (disturbitution codon), introduction termination codon (introductions stop codon), destruction cutting site (disturbitution spot sites), and the like, and the frequency is less than or equal to 0.95, and finally 1319 functional SNP sites are obtained. The different SNP marker sites, the corresponding primer sequences, and the agronomic traits are shown in Table 1 of the summary of the invention section. In table 1, two upstream primers and one downstream primer are designed, respectively, and mainly function in implementing SNP typing detection by using specific matching of terminal bases of the primers, specifically including: 1. alleles with different terminal bases of the two upstream primers and one downstream primer form a primer mix, and the 5' ends of the two upstream primers are different. 2. The template is bound to the matching primer in primer mix. 3. Two upstream primers can be used for complementary strand synthesis of the allele-specific terminal sequences, respectively. 4. Realizing the typing difference, thereby achieving the purpose of identification. The 2 designed upstream primers and 1 designed downstream primer are amplified after being actually combined and are matched with the 1 designed upstream primer and the 1 designed downstream primer, and the unmatched upstream primers have no function and are actually 2 designed primers. Each SNP marker locus in Table 1 corresponds to two primers, wherein the number of the primer with the sequence number 1 in the sequence table sequentially corresponds to SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3, the number of the primer with the sequence number 2 in the sequence table sequentially corresponds to SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, and so on, the corresponding primers are numbered according to the sequence of SNP marker loci, and the number of the primer with the sequence number 1 in the sequence table sequentially corresponds to SEQ ID NO.370, SEQ ID NO.371 and SEQ ID NO. 372. All sequences in the sequence table are DNA artificial sequences. The SNP marker design of the invention comprises the following steps: designing amplification primers in the range of 60bp respectively at the upstream and downstream of the SNP locus, wherein 2 upstream primers are designed according to the following requirements: the length is 14-35bp, the 3' end is respectively complementary with two allelic gene types, wherein the last three basic group of 1 primer is mutated from G/C to A/T or from A/T to G/C; designing a downstream primer: the length is 14-25bp, the annealing temperature is most suitable for 63 ℃, the minimum temperature is 58 ℃ and the maximum temperature is 68 ℃. Finally, two primers which have no homology with rice and have a difference of at least 4bp in length are anchored in the 2 upstream primers respectively. The anchoring primers applied by the invention are respectively as follows: m13-1-gtaaaacgacggccagt, M13-2-cgccagggttttcccagtcacgac and the anchor primer ensure that the difference of the lengths of the amplification products of the two genes is at least 4bp, thereby being beneficial to polyacrylamide gel electrophoresis detection, being convenient to mark fluorescent markers and being beneficial to capillary electrophoresis detection.

4. Application of functional SNP marker in rice genetic diversity analysis

4.1 seed sprouting: from 245 rice samples collected, several seeds were collected and germinated at 28 ℃ for one week.

4.2DNA extraction: the operation steps are the same as 3.2; an amplification reaction system: the operation steps are the same as 3.3; PCR amplification reaction procedure: the operation steps are the same as 3.4; and (3) carrying out electrophoresis detection on the PCR amplification product: the operation steps are the same as 3.5.

4.6SNP marker electrophoretic detection band data recording.

4.7 clustering analysis of rice varieties: polymorphism is detected among 245 parts of materials according to all 125 SNP markers, and the detection efficiency reaches 100%. FIG. 1 is a diagram of cluster analysis of the application of functional SNP markers in genetic diversity analysis of rice; as can be seen from FIG. 1, the 245 materials can be obviously divided into different groups according to the distance of the genetic distance by the cluster analysis, and the group structure analysis shows that the 245 materials have obvious group structures and can accurately distinguish the genotypes of the varieties to be detected and the genetic differences among the varieties.

5. Application of functional SNP (single nucleotide polymorphism) marker in rice molecular marker-assisted selective breeding

Rice male parent: GG allelic type with major gene (waxy gene Wx) determining amylose content of rice; female parent: TT alleles bearing Wx. Performing DNA amplification analysis on the parents and the filial generations by respectively utilizing the CAPs marker and the functional SNP marker, and comparing whether the genotypes of the two generations which are compared and screened are consistent or not so as to verify the application effectiveness of the functional SNP marker in the rice molecular marker-assisted selective breeding.

5.1DNA extraction: taking 4 young leaves of each male parent and female parent of the rice and 20 young leaves of filial generation. The CTAB method is used for extracting DNA, and the specific operation steps are the same as 3.2.

5.2(1) CAPs marker amplification and digestion: the CAPS-AccI marker was first detected using Wx's (GG/TT) site specificity: an upstream primer: 5'-gcttcacttctctgcttgtg-3', downstream primer: 5'-atgatttaacgagagttgaa-3' is added. PCR reaction (25. mu.L): 2.5. mu.L of 10 XPCR buffer, 2.0. mu.L of MgCl2(25mM), 2.0. mu.L of dNTPs (2.0mM), 2. mu.L of Primer-F (10. mu.M), 2. mu.L of Primer-R (10. mu.M), 0.2. mu.L of Taq enzyme (5 u/. mu.L), 4. mu.L of template DNA, 10.3. mu.L of ddH₂And O. (2) And (3) amplification reaction program: 5min at 95 ℃, 40s at 94 ℃, 40s at 55 ℃, 60s at 72 ℃ and 35 cycles; 7min at 72 ℃. Acc I enzyme digestion: 10 μ L of PCR amplification product, 1.5 μ L of 10 Xdigestion buffer, 5U of Acc I enzyme, sterile ddH₂And O, complementing the total volume to 15 mu L, uniformly mixing, and keeping the temperature at 37.0 ℃ for 1-4 h. (3) And (3) electrophoresis detection: GG genotype generates fragments of 403bp and 57bp detected by 2% agarose gel electrophoresis; the TT genotype can not be cut by enzyme and only has a 460bp band; the heterozygous GT genotype can be partially digested and can simultaneously generate 460bp and 403bp bands. The results are shown in FIG. 2. In FIG. 2, lanes 1-4, 10, 17, and 24 represent samples that produce 403bp and 57bp fragments for GG genotype; lanes 5-8, 11, 14, 15, 26 and 27 show that the TT genotype of the sample cannot be digested, but is a 460bp band; 9.

lanes

12, 13, 16, 18, 19, 21, 22, 23, 25, and 28 represent the sample as a hetero-complexThe synthetic GT genotype can be partially cut by enzyme, and 460bp and 403bp bands can be simultaneously generated. The restriction enzyme digestion method is suitable for detecting a smaller amount of SNP in a laboratory, but needs conventional experimental reagents, and can complete the detection work more conveniently and quickly. According to the 124 polymorphic SNP marker information, the genetic distance between 245 test varieties is calculated by applying NTSYS software, and a genetic relationship cluster map is drawn according to a UPGMA method (see figure 1). The results show that the developed SNP markers are helpful for analyzing the genetic difference of rice varieties, and the molecular markers are hot spots of the current research for molecular assisted breeding.

5.3SNP marker amplification analysis: and carrying out amplification analysis on the single strain by using the site-specific marker SNP-sf0601764762 (GG/TT) of the screened Wx, wherein the reaction system is the same as 3.3, and the reaction program is the same as 3.4. An upstream primer 1: 5'-GTAAAACGACGGCCAGTcaggaagaacatctgcaCgt-3', upstream primer 2: 5'-CGCCAGGGTTTTCCCAGTCACGACcaggaagaacatctgcaagg-3', downstream primer: r is 5'acgagcaatgaaagatgcatgtga 3'. And (3) electrophoresis detection: detecting by non-denaturing polyacrylamide gel electrophoresis, and amplifying a 114bp fragment by GG genotype; amplifying a 121bp segment by the TT genotype; the hybrid GT type can amplify two fragments of 114 and 121bp, and the results are shown in FIG. 3.

5.4 comparison of progeny selection: analyzing the genotype of filial generation Wx by using Caps-AccI marker, and reserving a single plant generating 403bp and 57bp fragment GG genotypes; the SNP-sf0601764762 is used for analyzing the single plant, the single plant with a large fragment is reserved and amplified, and from the amplification results of the two markers, the Caps-AccI marker is completely consistent with the Wx genotypes of the SNP-sf0601764762 amplification parent and the progeny, so that the rice functional SNP marker can be completely used for identifying the authenticity of rice varieties.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Claims

1. The application of the SNP marker in analyzing and identifying the agronomic traits of rice is characterized in that the sites of the SNP marker in the rice and the corresponding agronomic traits are shown in Table 1:

TABLE 1 different SNP marker sites, corresponding primer sequences

2. The application of the SNP marker in analyzing and identifying the agronomic traits of rice according to claim 1, wherein the corresponding primer sequence table 1 of the SNP marker is obtained.

3. The application of the SNP marker in analyzing and identifying the agronomic traits of rice according to claim 1, wherein the SNP marker is used for rice molecular marker assisted breeding.

4. The application of the SNP marker in analyzing and identifying the agronomic traits of rice according to claim 1, wherein the primer for amplifying the SNP marker is used for rice molecular marker assisted breeding.