CN107868774A - A kind of thermal starting archaeal dna polymerase, preparation method and applications - Google Patents
A kind of thermal starting archaeal dna polymerase, preparation method and applications Download PDFInfo
- Publication number
- CN107868774A CN107868774A CN201610849001.2A CN201610849001A CN107868774A CN 107868774 A CN107868774 A CN 107868774A CN 201610849001 A CN201610849001 A CN 201610849001A CN 107868774 A CN107868774 A CN 107868774A
- Authority
- CN
- China
- Prior art keywords
- nucleotides
- dna polymerase
- archaeal dna
- preparation
- modified oligonucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
- C12Y207/07—Nucleotidyltransferases (2.7.7)
- C12Y207/07007—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Abstract
The invention discloses a kind of thermal starting archaeal dna polymerase, preparation method and applications.It uses dU modified oligonucleotides to be mixed with to obtain at room temperature by archaeal dna polymerase and dU modified oligonucleotides for archaeal dna polymerase inhibitor.DU modified oligonucleotides as polymerase activity inhibitor can be loop-stem structure, duplex structure or single-stranded structure.The number of dU nucleotides is 15.In the present invention, heat endurance UDG is added when thermal starting archaeal dna polymerase is applied in round pcr field, during PCR as polymerase activity activator.The beneficial effects of the present invention are：Preparation method is easy to operate, cost is low.Obtained thermal starting archaeal dna polymerase hot start effect is good, versatile.
Description
Technical field
The present invention relates to a kind of preparation method and applications of thermal starting archaeal dna polymerase, belong to gene engineering technology field.
Background technology
PCR reactions based on high temperature-resisting DNA polymerase are a kind of conventional molecular biological technologies for having numerous applications.Respectively
Kind of high temperature-resisting DNA polymerase substantially increases PCR efficiency, simplifies PCR operations, make PCR be widely used in various DNA detections with
Genetic engineering field.The enzymatic reaction activity of high temperature-resisting DNA polymerase highest under the high temperature conditions, but under cryogenic conditions, its
Also there is certain activity, understand the progress of catalytic dna polymerisation at low temperature.When annealing temperature is slightly less than particularly in PCR, when
Primer 3 ' hold a few base with it is non-amplification target area template DNA sequence match when, high temperature-resisting DNA polymerase low temperature
Under polymerase activity can extend these primers that non-specific pairing occurs, ultimately result in DNA non-specific amplification bands
Produce.In order to solve caused non-specific amplification problem under the high temperature-resisting DNA polymerase low temperature in regular-PCR, develop by
The various methods that DNA polymerase activity is closed in low temperature, only reach certain temperature, just activate DNA polymerase activity.At present
Conventional method mainly has two kinds：Enclosure method based on archaeal dna polymerase antibody or archaeal dna polymerase inhibitor.The former by
Its antibody is added in archaeal dna polymerase to close polymerase activity.Polymerase activity is closed by antibody under low temperature, is resisted after temperature rise
Body protein inactivates, and is separated with archaeal dna polymerase, polymerase activity is released.Closing based on archaeal dna polymerase inhibitor
Method has no detailed description, thus it is speculated that inhibitor is covalently bonded on the essential amino acid of polymerase activity.Inhibitor low-temperature stabilization,
Polymerase activity can be suppressed；Pyrolytic, no longer suppress polymerase activity.Sealing effect based on polymerase antibody is simultaneously paid no attention to
Think, it is impossible to prevent the activity of archaeal dna polymerase at low temperature completely；And need to prepare expensive antibody, Antibody preparation is grasped in addition
Make that cumbersome, preparation amount is limited, so the thermal starting archaeal dna polymerase application effect based on antibody is poor.Heat based on inhibitor opens
Dynamic archaeal dna polymerase is needed the temperature sensitive inhibitor covalent modification archaeal dna polymerase of costliness, complex operation, and it is thoroughly (not poly- to there is modification
Synthase activity is not completely enclosed) the shortcomings of.
The content of the invention
It is an object of the invention to the deficiency for existing thermal starting archaeal dna polymerase technology of preparing, there is provided a kind of new
The preparation method of thermal starting archaeal dna polymerase.The inventive method is easy to operate, cost is low.Obtained thermal starting archaeal dna polymerase heat opens
Dynamic effect is good, versatile.
For purpose as realization, the present invention adopts the following technical scheme that.
The present invention provides a kind of preparation method of thermal starting archaeal dna polymerase, and it uses dU modified oligonucleotides to polymerize for DNA
Enzyme inhibitor, it is mixed with to obtain at room temperature by archaeal dna polymerase and dU modified oligonucleotides.
In the present invention, the dU modified oligonucleotides are in loop-stem structure, duplex structure or single-stranded structure.
In the present invention, when the dU modified oligonucleotides are in loop-stem structure, the length of stem and ring is not less than 6 bases
Right, 5 ' ends of stem have a single stranded zone, and dU nucleotides is located at 5 ' single stranded zones, and dU is 1-6 nucleotides apart from the end of stem, distance
5 ' ends are not less than 1 nucleotides, it is further preferred that optimal values of the dU apart from stem end is 4 or 5 nucleotides, distance 5 ' is held
Optimal distance is 5 nucleotides.
In the present invention, when the dU modified oligonucleotides are in duplex structure, double stranded region is not less than 12 base-pairs, dU nucleosides
Acid is located at 5 ' single stranded zones, and dU is 1-6 nucleotides apart from duplex ends, and the end of distance 5 ' is not less than 1 nucleotides, further excellent
Choosing, optimal values of the dU apart from stem end is 4 or 5 nucleotides, and it is 5 nucleotides that distance 5 ', which holds optimal distance,.
In the present invention, when the dU modified oligonucleotides are in single-stranded structure, length is 12-30 nucleotides, dU nucleotides
Positioned at single-stranded centre.
The present invention also provides the thermal starting archaeal dna polymerase that a kind of above-mentioned preparation method obtains.
The present invention further provides application of the above-mentioned thermal starting archaeal dna polymerase in round pcr field, add during PCR
Enter polymerase activity activator, the polymerase activity activator is heat endurance UDG.Specifically, under cryogenic conditions, dU modifications
Oligonucleotides combined closely with archaeal dna polymerase, after 95 DEG C of thermal denaturations, DNA becomes single-chain state, and archaeal dna polymerase is modified with dU
The adhesion of oligonucleotides reduce, while the dU on heat endurance UDG excision oligonucleotides, oligonucleotides no longer contains dU cores
Thuja acid, therefore archaeal dna polymerase can not be made to go to be catalyzed the PCR of target nucleic acid sequence, realize archaeal dna polymerase in conjunction with archaeal dna polymerase
Hot activation and heat start PCR.
Of the invention to have significant progress compared with existing thermal starting archaeal dna polymerase technology of preparing, main beneficial effect is such as
Under：
(1) when the present invention prepares thermal starting archaeal dna polymerase, archaeal dna polymerase need not be modified, suitable for that can combine closely
The Type Bs such as the various archaeal dna polymerases of dU nucleotides, such as Pfu archaeal dna polymerases, KOD archaeal dna polymerases, Vent archaeal dna polymerases
Archaeal dna polymerase；Thermal starting archaeal dna polymerase of the present invention is widely used simultaneously, can be applied to regular-PCR, high specific PCR, short
Amplification of reiterated DNA sequences polymorphism etc..
(2) it is low to prepare cost, oligonucleotide probe synthesis cost is far below the 1/10 of antibody protein, only antibody；
(3) archaeal dna polymerase enclosure method is easy to operate, result is stable, it is only necessary to which first the oligonucleotides by dU modifications suppresses
Agent mixes with archaeal dna polymerase at normal temperatures；
(4) activity inhibitor is versatile, and a kind of inhibitor can suppress a variety of DNA polymerase activities, unlike antibody only
A kind of DNA polymerase activity can be suppressed；
(5) when applying, activator heat endurance UDG is used alone, and PCR is added before starting, and facilitates use and storage.
Brief description of the drawings
Fig. 1 is that the application of the thermal starting archaeal dna polymerase based on stem ring type dU modified oligonucleotides in the embodiment of the present invention 1 is shown
It is intended to.
Fig. 2 is that the application of the thermal starting archaeal dna polymerase based on double chain dU modified oligonucleotides in the embodiment of the present invention 2 is shown
It is intended to.
Fig. 3 is that the application of the thermal starting archaeal dna polymerase based on single-stranded type dU modified oligonucleotides in the embodiment of the present invention 3 is shown
It is intended to.
Embodiment
Technical scheme is described in further detail by the following examples.Following examples are not formed to this
The restriction of invention.
The heat start PCR of the E. coli Endo nuclease IV encoding genes of embodiment 1
The inventive method using stem ring type dU modified oligonucleotides and heat endurance ApeUDG as shown in figure 1, prepared a kind of
Hot spacetabs type archaeal dna polymerase.Wherein 32 nucleotides of dU modified oligonucleotides total length, whole oligonucleotides normal temperature form stem ring knot
Structure, stem length 10bp, ring grow 6 nucleotides, and 5 ' single stranded zones of the end with 6 nucleotides of stem；The dU nucleotides of this single stranded zone
It is 3 nucleotides apart from the end of stem, distance 5 ' holds 2 nucleotides.Thermostable DNA polymerase and UDG are respectively Pfu DNA
Polymerase and ApeUDG.PCR in the present embodiment is the endonuclease IV genes of amplification Escherichia coli.Specific implementation step is such as
Under：
The first step, design synthesis are used for the primer sequence for expanding the endonuclease IV genes of Escherichia coli.2 primers point
Wei not endoIV-F, endoIV-R.2 primer base sequences are as follows：
endoIV-F:5’ATGAAATACATTGGAGCGCA
endoIV-R:5’TCAGGCTACCGCTTTTTCAG
Primer and the endonuclease IV gene complementations of Escherichia coli match.
Second step, synthesized polymer activity inhibitor dU modified oligonucleotides.Oligonucleotide sequence is：
5’TTdUTTTGGAATGCCTGTTTTTTCAGGCATTCC3’.The oligonucleotides grows 32 nucleotides, shape under normal temperature
Into loop-stem structure, 10 base-pairs of stem length, ring is 6 thymidylic acid T, and 5 ' ends of stem are with 6 nucleotides
Single stranded zone；The dU nucleotides of this single stranded zone is 3 nucleotides apart from the end of stem, and distance 5 ' holds 2 nucleotides.
It is prepared by the 3rd step, active enclosed type Pfu archaeal dna polymerases.First by the dU in Pfu archaeal dna polymerases and second step
Modified oligonucleotide is mixed at ambient temperature in the ratio of 1 unit archaeal dna polymerase/1 gram mole oligonucleotide, is added dense eventually
10-50% glycerine is spent, room temperature is placed 10 minutes, is placed in -20 degree or -80 degree.
4th step, prepare activator heat endurance ApeUDG.The thermostabilization expressed using engineering strain Prepare restructuring
Property ApeUDG, be stored in the preservation liquid of the glycerine containing 10-50%, and be stored in -20 degree or -80 degree.Activator ApeUDG's makes
It is ApeUDG/1 gram mole of dU modified oligonucleotide of 100 nanogram with concentration.
5th step, E. coli Endo nuclease IV gene heat start PCRs reactant mixture are prepared.E. coli Endo core
The heat start PCR reactant mixture composition (50 microlitres) of sour enzyme IV genes：Forward primer and each 0.5 μM of reverse primer；DNA profiling
For 50 nanogram genome of E.coli DNA；200μM dNTPs；2.5 units activity enclosed type Pfu archaeal dna polymerases；5 microlitre 10
× Pfu DNA polymerase reaction buffer solutions；250 nanogram activator heat endurance ApeUDG, finally add deionized water to totality
Product is 50 microlitres.
5th step, the amplification of E. coli Endo nuclease IV genes heat start PCR.PCR reaction conditions：95 DEG C × 5 minutes；
Circulate (95 DEG C × 30 seconds, 50 DEG C × 30 seconds, 72 DEG C × 90 seconds) × 30；72 DEG C × 3 minutes.Amplification of DNA fragments length is
858bp。
6th step, the detection of E. coli Endo nuclease IV gene heat start PCRs amplified production.Compound concentration is 1.0%
Ago-Gel, with the addition of the Ethidum Eremide of final concentration of 0.5 mcg/ml or other DNA developers in gel.Utilize water
Flat electrophoresis apparatus, 20 minutes separation amplified productions of electrophoresis, observe under ultraviolet light or in gel imaging system and expanding under 200V voltages
Increase production thing.The DNA bands specificity that the length of heat start PCR amplification is 858bp is high, without miscellaneous DNA bands.
The heat start PCR of the plasmid pUC18 coding ampicillin resistance gene of embodiment 2
The inventive method using double chain dU modified oligonucleotides and heat endurance TthUDG as shown in Fig. 2 prepared a kind of
Hot spacetabs type archaeal dna polymerase.Wherein 29 nucleotides of dU modified oligonucleotides total length, complementary 18 nucleotides of chain length, the two is normal
The double-stranded DNA of the single stranded tails of band 5 ' is formed under temperature；The long 18bp of double stranded section；5 ' single-stranded 11 nucleotides of length, the dU of this single stranded zone
Nucleotides is 5 nucleotides apart from duplex ends, and distance 5 ' holds 5 nucleotides.Thermostable DNA polymerase is respectively with UDG
Vent archaeal dna polymerases and TthUDG.PCR in the present embodiment is the ampicillin resistance gene on amplification plasmid pUC18.
Specific implementation step is as follows：
The first step, design synthesis are used for the primer sequence for expanding the endonuclease IV genes of Escherichia coli.2 primers point
Wei not amp-F, amp-R.2 primer base sequences are as follows：
amp-F:5’ATGAGTATTCAACATTTCCG
amp-R:5’TTACCAATGCTTAATCAGTG
Primer and plasmid pUC18 ampicillin resistance gene complementary pairing.
Second step, prepare polymerase activity inhibitor dU modified oligonucleotide double-strands.DU modified oligonucleotide sequences are：5’
CTTTTdUTTCCTGGAATGCCTGGCTAGTCC；Non- dU modified oligonucleotides complementary strand is：GGACTAGCCAGGCATTCC3’.
After two oligonucleotide chains etc. divide subnumber to mix, duplex structure is formed at normal temperatures, 18 base-pairs of the double-strand head of district, 5 ' ends are single-stranded
11 nucleotides of the head of district, wherein dU are among single stranded zone, and apart from 5 nucleotides of duplex ends, distance 5 ' holds 5 nucleotides.
It is prepared by the 3rd step, active enclosed type Vent archaeal dna polymerases.First by Vent archaeal dna polymerases and second step
DU modified oligonucleotides double-strand is mixed at ambient temperature in the ratio of 0.5 unit archaeal dna polymerase/1 gram mole oligonucleotide,
Final concentration 10-50% glycerine is added, room temperature is placed 10 minutes, is placed in -20 degree or -80 degree.
4th step, prepare activator heat endurance TthUDG.The thermostabilization expressed using engineering strain Prepare restructuring
Property TthUDG, be stored in the preservation liquid of the glycerine containing 10-50%, and be stored in -20 degree or -80 degree.Activator TthUDG's makes
It is TthUDG/1 gram mole of dU modified oligonucleotide of 50 nanogram with concentration.
5th step, plasmid pUC18 ampicillin resistance gene heat start PCR reactant mixture are prepared.Plasmid pUC18 ammonia
The heat start PCR reactant mixture composition (50 microlitres) of parasiticin resistant gene：Forward primer and each 0.5 μM of reverse primer；
DNA profiling is 1 nanogram pUC18 DNAs；200μM dNTPs；2.5 units activity enclosed type Vent archaeal dna polymerases；5 microlitres
10 × Vent DNA polymerase reaction buffer solutions；250 nanogram activator heat endurance TthUDG, deionized water is finally added to total
Volume is 50 microlitres.
5th step, the amplification of plasmid pUC18 ampicillin resistance gene heat start PCR.PCR reaction conditions：95 DEG C × 5 points
Clock；Circulate (95 DEG C × 30 seconds, 50 DEG C × 30 seconds, 72 DEG C × 90 seconds) × 30；72 DEG C × 3 minutes.Amplification of DNA fragments length is
861bp。
6th step, the detection of plasmid pUC18 ampicillin resistance gene heat start PCR amplified production.Compound concentration is
1.0% Ago-Gel, the Ethidum Eremide of final concentration of 0.5 mcg/ml or other DNA developers are with the addition of in gel.
Utilize horizontal cataphoresis apparatus, 20 minutes separation amplified productions of electrophoresis under 200V voltages, under ultraviolet light or in gel imaging system
Observe amplified production.Heat start PCR amplified production be 861bp plasmid pUC18 ampicillin resistance gene, target product
DNA bands specificity is high, no miscellaneous bands of DNA.
The heat start PCR of the Escherichia coli exonuclease I II genes of embodiment 3
The inventive method using single-stranded type dU modified oligonucleotides and heat endurance PfuUDG as shown in figure 3, prepared a kind of
Hot spacetabs type archaeal dna polymerase.Wherein 21 nucleotides of dU modified oligonucleotides total length, dU nucleotides are in centre.Heat endurance
Archaeal dna polymerase and UDG are respectively Pfu archaeal dna polymerases and PfuUDG.PCR in the present embodiment is the amplification circumscribed core of Escherichia coli
Sour enzyme III genes.Specific implementation step is as follows：
The first step, design synthesis are used for the primer sequence for expanding Escherichia coli exonuclease I II genes.2 primers point
Wei not xth-F, xth-R.2 primer base sequences are as follows：
xth-F:5’ATGAAATTTGTCTCTTTTAATATC
xth-R:5’TTAGCGGCGGAAGGTCGCC
Primer matches with Escherichia coli exonuclease I II gene complementations.
Second step, prepare polymerase activity inhibitor dU modified oligonucleotide double-strands.DU modified oligonucleotide sequences are：5’
TTTCCTGGAAdUTGCCTGGCTA, dU are among single stranded zone, and two ends of distance are all 10 nucleotides.
It is prepared by the 3rd step, active enclosed type Pfu archaeal dna polymerases.First by the dU in Pfu archaeal dna polymerases and second step
The single-stranded ratio in 0.2 unit archaeal dna polymerase/1 gram mole oligonucleotide of modified oligonucleotide mixes at ambient temperature, adds
Enter final concentration 10-50% glycerine, room temperature is placed 10 minutes, is placed in -20 degree or -80 degree.
4th step, prepare activator heat endurance PfuUDG.The thermostabilization expressed using engineering strain Prepare restructuring
Property PfuUDG, be stored in the preservation liquid of the glycerine containing 10-50%, and be stored in -20 degree or -80 degree.Activator PfuUDG's makes
It is PfuUDG/1 gram mole of dU modified oligonucleotide of 10 nanogram with concentration.
5th step, Escherichia coli exonuclease I II gene heat start PCRs reactant mixture are prepared.Escherichia coli are circumscribed
The heat start PCR reactant mixture composition (50 microlitres) of nuclease III genes：Forward primer and each 0.5 μM of reverse primer；DNA
Template is 50 nanogram genome of E.coli DNA；200μM dNTPs；2.5 units activity enclosed type Pfu archaeal dna polymerases；5 is micro-
Rise 10 × Pfu DNA polymerase reaction buffer solutions；125 nanogram activator heat endurance PfuUDG, finally add deionized water extremely
Cumulative volume is 50 microlitres.
5th step, the amplification of Escherichia coli exonuclease I II genes heat start PCR.PCR reaction conditions：95 DEG C × 5 points
Clock；Circulate (95 DEG C × 30 seconds, 50 DEG C × 30 seconds, 72 DEG C × 80 seconds) × 30；72 DEG C × 3 minutes.Expand target DNA fragments length
For 807bp.
6th step, the detection of Escherichia coli exonuclease I II gene heat start PCRs amplified production.Compound concentration is 1.0%
Ago-Gel, with the addition of the Ethidum Eremide of final concentration of 0.5 mcg/ml or other DNA developers in gel.Utilize water
Flat electrophoresis apparatus, 20 minutes separation amplified productions of electrophoresis, observe under ultraviolet light or in gel imaging system and expanding under 200V voltages
Increase production thing.Heat start PCR amplified production is 807bp Escherichia coli exonuclease I II genes, and target product DNA bands are special
It is different in nature high, no miscellaneous bands of DNA.
Claims (9)
1. a kind of preparation method of thermal starting archaeal dna polymerase, it is characterised in that it uses dU modified oligonucleotides to polymerize for DNA
Enzyme inhibitor, it is mixed with to obtain at room temperature by archaeal dna polymerase and dU modified oligonucleotides.
2. preparation method as claimed in claim 1, it is characterised in that the dU modified oligonucleotides are in loop-stem structure, double-strand
Structure or single-stranded structure.
3. preparation method as claimed in claim 2, it is characterised in that when the dU modified oligonucleotides are in loop-stem structure, stem
It is not less than 6 base-pairs with the length of ring, 5 ' ends of stem have single stranded zone, and dU nucleotides is located at 5 ' single stranded zones, and dU distances
The end of stem is 1-6 nucleotides, and the end of distance 5 ' is not less than 1 nucleotides.
4. preparation method as claimed in claim 3, it is characterised in that when the dU modified oligonucleotides are in loop-stem structure, dU
It is 4 or 5 nucleotides apart from the end of stem, the end of distance 5 ' is 5 nucleotides.
5. preparation method as claimed in claim 2, it is characterised in that double when the dU modified oligonucleotides are in duplex structure
Sequence is not less than 12 base-pairs, and dU nucleotides is located at 5 ' single stranded zones, and dU is 1-6 nucleotides apart from duplex ends, distance
5 ' ends are not less than 1 nucleotides.
6. preparation method as claimed in claim 5, it is characterised in that when the dU modified oligonucleotides are in duplex structure, dU
It is 4 or 5 nucleotides apart from duplex ends, the end of distance 5 ' is 5 nucleotides.
7. preparation method as claimed in claim 2, it is characterised in that long when the dU modified oligonucleotides are in single-stranded structure
Spend and be located at single-stranded centre for 12-30 nucleotides, dU nucleotides.
A kind of 8. thermal starting archaeal dna polymerase that preparation method as claimed in claim 1 obtains.
A kind of 9. application of the thermal starting archaeal dna polymerase in round pcr field as claimed in claim 8, it is characterised in that
Polymerase activity activator is added during PCR, the polymerase activity activator is heat endurance UDG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610849001.2A CN107868774A (en) | 2016-09-23 | 2016-09-23 | A kind of thermal starting archaeal dna polymerase, preparation method and applications |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610849001.2A CN107868774A (en) | 2016-09-23 | 2016-09-23 | A kind of thermal starting archaeal dna polymerase, preparation method and applications |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107868774A true CN107868774A (en) | 2018-04-03 |
Family
ID=61750596
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610849001.2A Pending CN107868774A (en) | 2016-09-23 | 2016-09-23 | A kind of thermal starting archaeal dna polymerase, preparation method and applications |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107868774A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101168769A (en) * | 2007-11-08 | 2008-04-30 | 上海交通大学 | Mononucleotide polymorphism detecting method based on dU or dI oligonucleotide probe |
| US20080108073A1 (en) * | 2001-11-19 | 2008-05-08 | Affymetrix, Inc. | Methods of Analysis of Methylation |
| US20130177915A1 (en) * | 2010-06-14 | 2013-07-11 | National University Of Singapore | Modified stem-loop oligonucleotide mediated reverse transcription and base-spacing constrained quantitative pcr |
| CN105176946A (en) * | 2015-09-16 | 2015-12-23 | 苏州旷世骏弛生物科技有限公司 | Uracil DNA (deoxyribonucleic acid) glycosidase, and preparation method and application thereof |
-
2016
- 2016-09-23 CN CN201610849001.2A patent/CN107868774A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080108073A1 (en) * | 2001-11-19 | 2008-05-08 | Affymetrix, Inc. | Methods of Analysis of Methylation |
| CN101168769A (en) * | 2007-11-08 | 2008-04-30 | 上海交通大学 | Mononucleotide polymorphism detecting method based on dU or dI oligonucleotide probe |
| US20130177915A1 (en) * | 2010-06-14 | 2013-07-11 | National University Of Singapore | Modified stem-loop oligonucleotide mediated reverse transcription and base-spacing constrained quantitative pcr |
| CN103210092A (en) * | 2010-06-14 | 2013-07-17 | 新加坡国立大学 | Modified stem-loop oligonucleotide mediated reverse transcription and base-spacing constrained quantitative PCR |
| CN105176946A (en) * | 2015-09-16 | 2015-12-23 | 苏州旷世骏弛生物科技有限公司 | Uracil DNA (deoxyribonucleic acid) glycosidase, and preparation method and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| LIU ET AL.: "Characterization of Family IV UDG from Aeropyrum pernix and Its Application in Hot-Start PCR by Family B DNA Polymerase", 《PLOS ONE》 * |
| 林利波: "火球菌尿嘧啶DNA糖苷酶基因克隆、表达纯化和酶学性质研究", 《中国优秀硕士学位论文全文数据库 基础科学辑》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20220042009A1 (en) | Systems and methods for nucleic acid preparation | |
| EP3377657B1 (en) | Transformable tagging methods | |
| CN110079588B (en) | Methods, compositions, systems, instruments and kits for nucleic acid amplification | |
| JP6894501B2 (en) | Isothermal nucleic acid self-amplification method | |
| US11725206B2 (en) | Second strand direct | |
| EP2658988B1 (en) | Nucleic acid sample preparation methods and compositions | |
| US20220162660A1 (en) | Methods and compositions for nucleic acid amplification | |
| WO2023098492A1 (en) | Sequencing library construction method and application | |
| CN106661632A (en) | RNA amplification methods | |
| WO2022121658A1 (en) | Reagent for improving replication efficiency of single-stranded nucleic acid molecule having secondary structure, method for replicating nucleic acid fragment, and application | |
| CN106555011B (en) | Compositions and methods for genetic testing or genotyping | |
| CN113215224A (en) | Method and kit for amplifying and detecting nucleic acid | |
| CN107868774A (en) | A kind of thermal starting archaeal dna polymerase, preparation method and applications | |
| CN102459632B (en) | Amplification of complex nucleic acids | |
| CN102382851B (en) | cloning vector | |
| CN111575272B (en) | High-copy DNA repetitive sequence in vitro rapid synthesis based on blocking type chain polymerization amplification reaction | |
| JP2022518917A (en) | Nucleic acid detection method and primer design method | |
| Wang et al. | A Simple Blocking PCR‐Based Method for the Synthesis of High‐Copy dsDNA Tandem Repeats | |
| Stevenson et al. | Universal CG cloning of polymerase chain reaction products | |
| CN111718983B (en) | Detection method for detecting activity of nucleic acid polymerase | |
| CN106754814A (en) | A kind of preparation method of thermal starting archaeal dna polymerase | |
| WO2023222014A1 (en) | Sgrna sequencing linker and use thereof | |
| US11371094B2 (en) | Systems and methods for nucleic acid processing using degenerate nucleotides | |
| WO2018145041A1 (en) | Systems and methods for nucleic acid preparation | |
| KR102049238B1 (en) | Stimulation of the polymerization of poly A tail by Poly(A) polymerase by inorganic Pyrophosphatase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20200317 Address after: 201100 unit 512, 514, building 13, No. 134, 154, 184, Lane 953, Jianchuan Road, Minhang District, Shanghai Applicant after: Shanghai ang enzyme Biotechnology Co., Ltd. Address before: 200240 room 1225, room 555, Dongchuan Road, Minhang District, Shanghai Applicant before: SHANGHAI ZIZHONG BIOTECHNOLOGY Co.,Ltd. |
|
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180403 |