CN107868773A - The Protein S SIIIa related to rice resistant starch and its encoding gene and application - Google Patents
The Protein S SIIIa related to rice resistant starch and its encoding gene and application Download PDFInfo
- Publication number
- CN107868773A CN107868773A CN201610848633.7A CN201610848633A CN107868773A CN 107868773 A CN107868773 A CN 107868773A CN 201610848633 A CN201610848633 A CN 201610848633A CN 107868773 A CN107868773 A CN 107868773A
- Authority
- CN
- China
- Prior art keywords
- encoding gene
- plant
- gene
- environment stress
- starch synthesis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y204/00—Glycosyltransferases (2.4)
- C12Y204/01—Hexosyltransferases (2.4.1)
- C12Y204/01021—Starch synthase (2.4.1.21)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Nutrition Science (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a kind of Protein S SIIIa related to plant resistance to environment stress content of starch and its encoding gene and application.The encoding gene of the albumen can control the resistance starch content of rice.SSIIIaGene can cultivate new high resistant starch content rice varieties as molecular mark and using the method for genetic engineering.The invention provides plant resistance to environment stress the Starch synthesis related amino acid sequence of albumen and its nucleotide sequence of encoding gene, the primer pair of the expression cassette containing the encoding gene, recombinant expression carrier, recombinant bacterium, transgenic cell line and the amplification encoding gene is additionally provided, while is provided and application of the encoding gene of plant resistance to environment stress Starch synthesis GAP-associated protein GAP in the related genetically modified plants of resistant starch synthesis are prepared and related transgenic method.The present invention provides strong means to improve the quality of rice and healthcare function, has important theory significance and huge application potential.
Description
Technical field
The present invention relates to a kind of function of albumen and its encoding gene and application, is specifically related to a kind of and rice resistance and forms sediment
The related albumen of powder and its encoding gene and application
Background technology
Resistant starch (Resistant starch) is also known as enzyme resistant starch, can not be digested in the small intestine of people, but
A kind of starch structure of fermentation reaction can be played in the intestines and stomach colon of people with volatile fatty acid.Itself it is still starch,
Chemical constitution is different from fiber, but its property is similar to disappearing fibre.This starch digests in vivo compared with other starch difficult degradations
Slowly, absorbed and to enter blood all slower.
The maximum component of ratio is carbohydrate in our food, and carbohydrate is also known as polysaccharide, and people eat carbon
Monose is decomposed into by hydrochloric acid in gastric juice and enzymic digestion in vivo after hydrate --- glucose could absorb later and enter blood, contain
Resistant starchy food is slow due to digesting and assimilating, and does not cause blood glucose rise too fast after edible, you can to adjust blood sugar level, therefore
As a kind of functional starch, particularly suitable patients with diabetes mellitus, diabetes patient is contributed to maintain normal blood sugar concentration, and
It is not easy starvation after edible for patients resistant starch, reduces hunger.
Resistant starch is present in some wholefoods, and such as potato, banana, rice all contain resistant starch.Everyone
Daily intake of about 20 grams of resistant starch can produce notable healthcare function, and usual diet composes 10 grams of insufficiency of intake.In the world one
More than half population is using rice as staple food, and resistance starch content is less than 3% in common cooked rice, cultivated rice by induced mutations,
Obtain the rice strain that rice resistance starch content is higher than 10%.If staple food rice contains enough resistant starches, pass through
Staple food takes in nutraceutical, is very easy to realize that routine health is defendd.So molecular genetic mechanism of rice resistance Starch synthesis
Illustrate and apply, realize the creation and production application of high-quality resistant starch rice, there is great social effect and commercial value
Potentiality.The molecular genetic mechanism on control resistant starch synthesis is still not clear in the prior art, is closed on control resistant starch
Into GAP-associated protein GAP encoding gene, seriously constrain creation and production application of the resistant starch in high-quality resistant starch rice.
The content of the invention
It is described with plant resistance to environment stress Starch synthesis phase the invention provides a kind of albumen related to plant resistance to environment stress Starch synthesis
The albumen of pass is the protein for having following amino acid sequence a) or b)：
A) by Seq ID NO in sequence table:The protein of amino acid sequence composition shown in 1；
B) by Seq ID NO in sequence table:1 amino acid sequence passes through the substitution of one or several amino acid and/or lacked
Lose and/or add, and the protein as derived from a) related to plant resistance to environment stress content of starch.
Present invention also offers a kind of encoding gene of the albumen related to plant resistance to environment stress Starch synthesis, the encoding gene
It is encoded to the albumen related to plant resistance to environment stress Starch synthesis.
In such scheme preferably, the encoding gene is following gene a) or b) or c)：
A) Seq ID NO in its nucleotide sequence such as sequence table:2 from the DNA shown in 5 ' end 1-14463 positions point
Son；
B) under strict conditions with a) described in nucleotide sequence hybridization and coding it is described with plant resistance to environment stress Starch synthesis phase
The DNA molecular of the albumen of pass；
C) nucleotide sequence described in and a) is with more than 90% homology and coding is described is closed with plant resistance to environment stress starch
Into the gene of the albumen of correlation.
In any of the above scheme preferably, the encoding gene is following gene a) or b) or c)：
A) its nucleotide sequence is the Seq ID NO in sequence table:DNA molecular shown in 3；
B) under strict conditions with a) described in nucleotide sequence hybridization and coding it is described with plant resistance to environment stress Starch synthesis phase
The DNA molecular of the albumen of pass；
C) nucleotide sequence described in and a) is with more than 90% homology and coding is described is closed with plant resistance to environment stress starch
Into the gene of the albumen of correlation.
It is used to express the expression cassette with plant resistance to environment stress Starch synthesis GAP-associated protein GAP present invention also offers a kind of, containing above-mentioned
The encoding gene of the albumen related to plant resistance to environment stress Starch synthesis in any one.
In any of the above scheme preferably, 5 ' and/or 3 ' ends of encoding gene described in the expression cassette have poly-
The encoding gene of at least one of Arg, Poly-His, FLAG, Strep-tag II and c-myc label.
In any of the above scheme preferably, added before the transcription initiation nucleotides of encoding gene described in the expression cassette
One or more in enhanced, composing type, organizing specific type or inducible promoter.
In any of the above scheme preferably, promoter described in the expression cassette is cauliflower mosaic virus (CAMV)
35S promoter or ubiquitin (Ubiquitin) gene promoter (pUbi).
In any of the above scheme preferably, the expression cassette also contains enhancer, and the enhancer is translational enhancer
Or transcriptional enhancer, the enhancer are identical with the reading frame of coded sequence.
In any of the above scheme preferably, the region of the enhancer is ATG initiation codon or the starting of adjacent battery limit (BL) domain
Codon.
In any of the above scheme preferably, the translation initiation region of expression cassette comes from transcription initiation region or structure base
Cause.
In any of the above scheme preferably, the expression cassette also comprising identification and/or screening-gene, it is described identification and/
Or screening-gene includes the one or more of following gene：
The enzyme of color change and/or the gene of luminophor can be produced；
Resistant antibiotic marker gene；
Anti- chemical reagent marker gene.
In any of the above scheme preferably, the gene of the enzyme for producing color change and/or luminophor is
One or more in gus gene, GFP genes and luciferase genes.
In any of the above scheme preferably, the resistant antibiotic marker gene is gentamicin label
Gene or kanamycins marker gene.
In any of the above scheme preferably, the anti-chemical reagent marker gene is anti-herbicide gene.
Present invention also offers the primer pair for expanding the protein coding gene related to plant resistance to environment stress Starch synthesis, institute
State primer pair can be used for amplification any of the above-described and plant resistance to environment stress Starch synthesis GAP-associated protein GAP encoding gene total length or its
One section of fragment.
It is used to express the recombinant expression carrier with plant resistance to environment stress Starch synthesis GAP-associated protein GAP present invention also offers a kind of, contains
There is the encoding gene of any of the above-described and plant resistance to environment stress Starch synthesis GAP-associated protein GAP.
It is used to express the recombinant expression carrier with plant resistance to environment stress Starch synthesis GAP-associated protein GAP present invention also offers a kind of, contains
Have and be used to express the gene with the expression cassette of plant resistance to environment stress Starch synthesis GAP-associated protein GAP described in any of the above-described.
In any of the above scheme preferably, the recombinant expression carrier is between pCAMBIA1300 multiple cloning sites
The recombinant expression carrier that the encoding gene of insertion any of the above-described and plant resistance to environment stress Starch synthesis GAP-associated protein GAP obtains.
In any of the above scheme preferably, the recombinant expression carrier be pCAMBIA3301, pCAMBIA1300,
A kind of carrier in the derivative plant expression vector of pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other
Multiple cloning sites in insert the restructuring table that the encoding gene of any of the above-described and plant resistance to environment stress Starch synthesis GAP-associated protein GAP obtains
Up to carrier.
Synthesized present invention also offers the encoding gene with plant resistance to environment stress Starch synthesis GAP-associated protein GAP preparing resistant starch
Application in related genetically modified plants, the related genetically modified plants of the resistant starch synthesis contain any of the above-described and plant
The encoding gene of resistant starch synthesis associated protein.
In any of the above scheme preferably, the plant is dicotyledon or monocotyledon.
In any of the above scheme preferably, the monocotyledon is rice.
In any of the above scheme preferably, the plant is resistance rice strain b10.
The invention provides a kind of coding base of the cultivation containing any of the above-described Yu plant resistance to environment stress Starch synthesis GAP-associated protein GAP
The method of the genetically modified plants of cause, including any of the above-described and the encoding gene of plant resistance to environment stress Starch synthesis GAP-associated protein GAP are transferred to
The step of in purpose plant to obtain genetically modified plants.
In any of the above scheme preferably, any of the above-described and the encoding gene of plant resistance to environment stress Starch synthesis GAP-associated protein GAP
The purpose plant is transferred to by any of the above-described recombinant expression carrier.
In any of the above scheme preferably, it is thin by conventional biology methods to be transformed into plant for the recombinant expression carrier
Born of the same parents or tissue in.
In any of the above scheme preferably, the biological method is completed to convert by the following method：Ti-plasmids mediates
Conversion, the plasmid-mediated conversions of Ri, the conversion of plant viral vector mediation, directly delivered DNA, microinjection conversion, conductance
A kind of method in conversion or Agrobacterium-medialed transformation.
In any of the above scheme preferably, the plant is dicotyledonous plant or monocot plant.
In any of the above scheme preferably, the monocotyledon is rice.
In any of the above scheme preferably, the plant is high-resistance starch rice strain b10.
Present invention also offers it is a kind of cultivate genetically modified plants method, including by interference carrier import purpose plant in
The step of obtaining genetically modified plants, the interference carrier are by Seq ID NO in sequence table:Nucleotide sequence and sequence shown in 4
Seq ID NO in list:Nucleotide sequence shown in 5 is sequentially inserted into recombinant vector.
In any of the above scheme preferably, the interference carrier is by Seq ID NO in sequence table:Nucleosides shown in 4
Seq ID NO in acid sequence and sequence table:Nucleotide sequence shown in 5 is sequentially inserted into BamHI the and KpnI positions of pTCK303 carriers
The recombinant vector obtained between point and Spe I and SacI sites.
In any of the above scheme preferably, the purpose plant is dicotyledonous plant or monocot plant.
In any of the above scheme preferably, the purpose plant is rice.
In any of the above scheme preferably, the purpose plant is conventional Indica Rice Cultivars R7954.
In any of the above scheme preferably, Seq ID NO:4 and Seq ID NO:Nucleotide sequence shown in 5 is through full base
Because a group comparison is analyzed to identify in rice genome without other homologous sequences.
It is described present invention also offers a kind of recombinant bacterium containing with plant resistance to environment stress Starch synthesis related protein encoding gene
Recombinant bacterium contains the encoding gene of any of the above-described and plant resistance to environment stress Starch synthesis GAP-associated protein GAP.
Present invention also offers a kind of transgenic cell containing with plant resistance to environment stress Starch synthesis related protein encoding gene
System, the transgenic cell line contain the encoding gene of any of the above-described and plant resistance to environment stress Starch synthesis GAP-associated protein GAP.
It is an object of the invention to provide a kind of albumen and its encoding gene related to plant resistance to environment stress Starch synthesis.
The albumen related to resistant starch synthesis provided by the present invention, entitled SSIIIa (Soluble starch
Synthase), it is following protein 1) or 2) from rice (Oryza sativa L.)：
1) by Seq ID NO in sequence table：The protein of amino acid sequence composition shown in 1；
2) by Seq ID NO in sequence table：1 amino acid sequence passes through the substitution of one or several amino acid and/or lacked
Lose and/or add the protein as derived from 1) related to resistant starch synthesis.
In order that 1) RS I in is easy to purify, can in by sequence table Seq NO：What the amino acid sequence shown in 1 formed
The upper label as shown in table 1 of amino terminal or carboxyl terminal connection of protein.
The sequence of the label of table 1
It is above-mentioned 2) in SSIIIa can be artificial synthesized, also can first synthesize its encoding gene, then carry out biological expression and obtain.On
The encoding gene of SSIIIa in stating 2) can be by by Seq ID NO in sequence table：2 from 5 ' ends the 1972nd to the 12795th
The codon of one or several amino acid residues is lacked or added in DNA sequence dna shown in bit base, and/or carries out one or several
The missense mutation of individual base-pair, and/or hold the coded sequence for connecting the label shown in table 1 to obtain at its 5 ' end and/or 3 '.
Present invention also offers the above-mentioned and encoding gene of plant resistance to environment stress starch GAP-associated protein GAP (being named as SSIIIa genes).
In one embodiment of this invention, there is provided the gene of following encoding gene a) or b) or c)：
A) its nucleotide sequence as in sequence table Seq ID NO.2 from the DNA shown in 5 ' end 1-14463 positions point
Son；
B) under strict conditions with a) described in nucleotide sequence hybridization and coding it is described with plant resistance to environment stress Starch synthesis phase
The DNA molecular of the albumen of pass；
C) nucleotide sequence described in and a) is with more than 90% homology and coding is described is closed with plant resistance to environment stress starch
Into the gene of the albumen of correlation.
Above-mentioned stringent condition can be miscellaneous in DNA or RNA with 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution
Hand over and hybridize in experiment at 65 DEG C and wash film.
In another embodiment of the invention, there is provided following encoding gene a) or b) or c)：
A) its nucleotide sequence is the Seq ID NO in sequence table:DNA molecular shown in 3；
B) under strict conditions with a) described in nucleotide sequence hybridization and coding it is described with plant resistance to environment stress Starch synthesis phase
The DNA molecular of the albumen of pass；
C) nucleotide sequence described in and a) is with more than 90% homology and coding is described is closed with plant resistance to environment stress starch
Into the gene of the albumen of correlation.
Seq ID NO in sequence table:3 by 5626 base compositions, and its open reading frame (ORF) is from 5 ' ends the
1 has Seq ID NO in sequence table to the 5367th bit base, coding:The SSIIIa albumen of 1 amino acid sequence.
Above-mentioned stringent condition can be miscellaneous in DNA or RNA with 0.1 × SSPE (or 0.1 × SSC), 0.1%SDS solution
Hand over and hybridize in experiment at 65 DEG C and wash film.
The invention provides the primer pair for expanding above-mentioned SSIIIa full length genes or its any fragment.
Present invention also offers carried containing above-mentioned with the expression cassette of the encoding gene of plant resistance to environment stress starch GAP-associated protein GAP, restructuring
Body, transgenic cell line and recombinant bacterium.
Contain the recombinant expression carrier of SSIIIa genes using existing plant expression vector construction.The plant expression
Carrier is double base agrobacterium vector or the carrier available for plant micropellet bombardment, including pCAMBIA3301, pCAMBIA1300,
One kind in the derivative plant expression vector of pBI121, pBin19, pCAMBIA2301, pCAMBIA1301-UbiN or other.
During recombinant expression carrier gene constructed using SSIIIa, it can increase before its transcription initiation nucleotides plus any
Strong type, composing type, organizing specific type or inducible promoter, such as cauliflower mosaic virus (CAMV) 35S promoter, ubiquitin
(Ubiquitin) gene promoter (pUbi) etc., they can be used alone or are used in combination with other plant promoters；This
When outside, using the gene constructed plant expression vector of the present invention, enhancer, including translational enhancer or transcription enhancing also can be used
Son, these enhancer regions can be ATG initiation codon or adjacent battery limit (BL) domain initiation codon etc., but must be with coded sequence
Reading frame is identical, to ensure the correct translation of whole sequence.The source of the translation control signal and initiation codon is extensive
, can be natural or synthesis.Translation initiation region can come from transcription initiation region or structural gene.
For the ease of transgenic plant cells or plant are identified and screened, plant expression vector used can be carried out
Processing, such as add in plant expression can produce color change enzyme or luminophor gene (gus gene, GFP genes,
Luciferase genes etc.), resistant antibiotic marker (gentamicin label, kanamycins label etc.) or anti-
Chemical reagent marker gene (such as anti-herbicide gene).
The recombinant expression carrier is concretely between plant expression vector pCAMBIA1300 multiple cloning sites in insertion
State the recombinant expression carrier obtained with the encoding gene of resistance starch content GAP-associated protein GAP.
It is a further object to provide a kind of method for cultivating genetically modified plants.
The method provided by the present invention for cultivating genetically modified plants, it is by above-mentioned and resistant starch GAP-associated protein GAP coding base
Because SSIIIa or genomic DNA are imported in high-resistance starch plant, genetically modified plants are obtained；The genetically modified plants and the mesh
Plant compare, resistance starch content decline.
Described and plant resistance to environment stress content of starch GAP-associated protein GAP encoding gene SSIIIa is by above-mentioned recombinant expression carrier
Import in purpose plant.
Carry can leading to plant resistance to environment stress starch related protein encoding gene SSIIIa plant expression vector for the present invention
Cross the conventional biology such as Ti-plasmids, Ri plasmids, plant viral vector, directly delivered DNA, microinjection, conductance, agriculture bacillus mediated
Method is transformed into plant cell or tissue.The plant host (purpose plant) being converted is that dicotyledon or unifacial leaf are planted
Strain, preferably rice, more preferably high-resistance starch rice strain b10.
A further object of the present invention is to provide a kind of method for cultivating genetically modified plants.This method is to lead interference carrier
Enter in purpose plant, obtain genetically modified plants；Compared with the purpose plant, resistance starch content increases the genetically modified plants
Add；The interference carrier is by Seq ID NO in sequence table:Seq ID NO in nucleotide sequence and sequence table shown in 4:5 institutes
The nucleotide sequence shown is sequentially inserted between BamHI the and KpnI sites and SpeI and SacI sites of pTCK303 carriers and obtained
Recombinant vector.The purpose plant can be dicotyledon or monocot plant, preferably rice, and the rice is preferably
R7954。
Seq ID NO:4 be Seq ID NO:3 the 2325th arrive 2836bp fragments.Seq ID NO:5 be Seq ID NO:4
Reverse complementary sequence.Seq ID NO:4 and Seq ID NO:5 are analyzed to identify in rice genome without it through full-length genome comparison
Its homologous sequence.
Seq ID NO:6 be by Seq ID NO in sequence table:1 amino acid sequence is by one or several amino acid
Substitution and/or missing and/or addition, and it is related to plant resistance to environment stress content of starch by Seq ID NO:Amino acid sequence shown in 1
Protein derived from arranging the protein of composition, is the protein sequence Nipponbare related to plant resistance to environment stress Starch synthesis
(Nipponbare) second transcript.
Seq ID NO:7 are and Seq ID NO in sequence table:2 from the DNA molecular shown in 5 ' end 1-14463 positions
Gene of the nucleotide sequence with more than 90% homology and the coding albumen related to plant resistance to environment stress Starch synthesis, be RP
Bio-226gDNA.Under strict conditions with Seq ID NO in sequence table:2 from the DNA shown in 5 ' end 1-14463 positions point
The DNA molecular of nucleotide sequence hybridization described in son and the coding albumen related to plant resistance to environment stress Starch synthesis is in sequence table
Seq ID NO:2 complementary strand from the DNA molecular nucleotide sequence shown in 5 ' end 1-14463 positions.
Seq ID NO:8 are and the Seq ID NO in sequence table:The nucleotide sequence of DNA molecular shown in 3 has 90%
Homology above and the gene for encoding the albumen related to plant resistance to environment stress Starch synthesis, second transcription for being protein sequence NP
This (R7954).Under strict conditions with the Seq ID NO in sequence table:The nucleotide sequence described in DNA molecular shown in 3 is miscellaneous
The DNA molecular for handing over and encoding the albumen related to plant resistance to environment stress Starch synthesis is the Seq ID NO in sequence table:Core described in 3
The complementary strand of nucleotide sequence.
The present invention carries out candidate gene prediction near zone and in the wild type R7954 (public according to QTL positioning results
It can be obtained from Zhejiang University, in (2) 523-528.Starch of document J Agric Food Chem 2006,54
Have disclosure in Properties of Mutant Rice High in Resistant Starch) and high-resistance starch material
Sequencing comparison is carried out between b10.As a result find, in high-resistance starch material, gene SSIIIa (LOC_Os08g09230) is the 5th
3 ' splice site AG of individual introne are mutated into AA, and the mutation may have impact on SSIIIa gene mRNA montages.Analyse in depth hair
It is existing, next nearest AG is moved on to after mutation after the splice site of original 3 ' of the 5th introne, forms new splice site, it is this to cut
The mode of connecing causes the missing of 4 bases, forms frameshift mutation, causes translation to terminate in advance.11 (ZH11) public are spent in
Can be from Hua Zhong Agriculture University National Botanical cara gene National Center of Plant Gene Research
Huazhong Agricultural University obtain, RiceMutantDatabase (RMD) (http:// signal.salk.edu/cgi-bin/RiceGEJOB=TEXT＆TYPE=TDNA＆QUERY=RMD_04Z11IX53) there are public affairs
Open) and Dongjin (in T-DNA insertional mutagenesis for functional genomics in rice,
The plant journal 2000 22(6):516-570 has information to disclose) SSIIIa T- in T-DNA insertional mutagenesis libraries
DNA insertion mutation bodies, its resistance starch content significantly rise.In summary information, the gene are defined as candidate gene.The candidate
Gene has corresponding full length cDNA sequence in Rice Genome Annotation Project databases.Clone is separated
The gene of the control endosperm resistance starch content, and demonstrate by transgenic function complementation experiment the function of the gene.
Experiment proves that the present invention has beneficial technique effect：The gene that the present invention is protected overexpression in rice
Afterwards, resistance starch content declines；And after the gene for protecting the present invention inactivates or reduced activity in rice, resistance starch content
Rise, illustrate that the gene can control paddy endosperm resistance starch content.Therefore, SSIIIa genes be molecular mark and
The rice varieties of high resistant starch content are cultivated using the method for genetic engineering, there is provided strong means, there is important reason
By meaning and huge application potential.
Brief description of the drawings
Fig. 1 rice high-resistance starch strain b10 and conventional Indica Rice Cultivars R7954 phenotypes, Figure 1A are the anti-of R7954 and b10
Property content of starch compare, T is examined, and double star represents pole significant difference；Figure 1B is R7954 and b10 brown rice outward appearance；Fig. 1 C are endosperm
The SEM observation of starch granules.
The map based cloning of Fig. 2 SSIIIa genes, Fig. 2A are to utilize BC2F2Carry out qtl analysis and positioning is schemed；Mark following
The individual of digitized representation restructuring；Fig. 2 B are the structural representations for the SSIIIa genes that the present invention clones, and black box represents outer aobvious
Son, medial lateral line represent introne.Base change above square frame represents the base mutation occurred in b10 materials.Bracket
The position for the base that interior digitized representation changes, the digitized representation extron sequence number below black box.A.a. ammonia is represented
Base acid residue.Fig. 2 C are SSIIIa cDNA mutant nucleotide sequence schematic diagrames, and a.a. represents amino acid residue.
The resistant starch of Fig. 3 SSIIIa CAPS mark Graphical genotypes SSIIIa allele individual plant different with carrying contains
Amount, Fig. 3 A are the Graphical genotypes of different SSIIIa allele；Fig. 3 B are R7954/b10F2Carried in segregating population different
Resistance starch content compares in SSIIIa allele individual plants, and Tukey is examined, and different letters represent significant difference be present on figure；
Fig. 3 C are middle colored 11/b10F2Resistance starch content in ssIIIassIIIa genotype individual plants, Tukey inspections are carried in segregating population
Test, different letters represent significant difference be present on figure.
SSIIIa T-DNA insertion mutations body in 11 and Dongjin T-DNA insertional mutagenesis libraries is spent to illustrate gene in Fig. 4
Type, Fig. 4 A are that T-DNA insertion positions illustrate in SSIIIa T-DNA insertion mutation bodies, and black box represents extron, middle horizontal
Line represents introne.Arrow represents primer binding sites and amplification direction, and a.a. represents amino acid residue.Fig. 4 B spend 11 in being
Source SSIIIa T-DNA insertion mutation body genotyping schematic diagrames；Fig. 4 C are that SSIIIa T-DNA insertions in Dongjin sources are prominent
Variant gene type analysis schematic diagram.
Fig. 5 SSIIIa T-DNA insertion mutation body surface type analysis schematic diagrames, Fig. 5 A derive from the middle SSIIIa for spending 11 backgrounds
T-DNA insertion mutation body resistance starch contents compare, and Tukey is examined, and different letters represent significant difference be present on figure；Fig. 5 B come
The SSIIIa T-DNA insertion mutation body resistance starch contents for coming from Dongjin backgrounds compare, and Tukey is examined, different words on figure
Matrix, which shows, has significant difference；Fig. 5 C SSIIIa T-DNA insertion mutations body brown rice outward appearances and amylum body electron scanning picture.
Fig. 6 SSIIIa:GSSIIIa Vector maps and different carriers transgenic paddy rice phenotype and expressing quantity analysis, figure
6A gSSIII genomes；Fig. 6 B detect SSIIIa expression quantity by RT-PCR；Fig. 6 C are detected by Wester-blot
SSIIIa expression quantity；Resistance starch content in Fig. 6 D transgenic seedling endosperm.Tukey is examined, and different letters represent exist on figure
Significant difference.
Fig. 7 genetically modified plants brown rice outward appearances and amylum body electron scanning picture.
Embodiment
With reference to specific embodiment, the invention will be further described, but the present invention is not limited to following examples.
It is conventional method unless otherwise specified in following embodiments.
Rice is cultivated obtain as follows in following embodiments：(1) field cultivation of rice material：Rice seed
After being soaked seed 2 days in sub water at normal temperatures, vernalization 48 hours between 37 DEG C of cultures of immigration, then by the seed to show money or valuables one carries unintentionally sowing on seedbed
Seedling is carried out, rice seedling is transplanted into paddy field to during 4 leaf phase.
The determination of embodiment 1, gene and its function
By rice (Oryza sativa L.) resistance rice strain b10 seed and conventional Indica Rice Cultivars R7954
Seed is cultivated according to above-mentioned field cultivation method respectively, and plant forms are as shown in Figure 6 D.Blade is taken to carry out DNA extractions.
The extraction of oryza sativa genomic dna：
Using improved CTAB methods (Mou Z, He Y, Dai Y, et al.Deficiency in fatty acid
synthase leads to premature cell death and dramatic alterations in plant
Morphology.The Plant Cell.2000,12,405-418.) genomic DNA is extracted from rice leaf.Take 20mg water
Rice blade, it is put into 2ml PVC centrifuge tubes, adds 1 piece of 6mm steel balls, through liquid nitrogen frozen, rapid take out is put into vibration beveller,
Shaken under 11000 revs/min 60 seconds, then add buffer extractions DNA, the DNA of acquisition and be precipitated and dissolved in 100 μ l MQ H2O
In.
Cloned in accordance with the following steps：
1st, the Primary Location of SSIIIa genes.
Using spending 11 structure F in b10 and japonica rice conventional variety2Segregating population, 182 individual plants are randomly choosed, analyze individual plant
Genotype and resistance starch content.By resistant starch gene Primary Location on the 8th the short arm of a chromosome in 0.8Mb interval ranges,
Further expand colony to 412 individual plants, most the resistant starch assignment of genes gene mapping in 456kb interval ranges, annotates and contains 76 at last
Individual protein coding gene, soluble starch synthase (sss) gene SSIIIa (LOC_Os08g09230) are located in the section, and we will form sediment
Candidate genes of the powder synthase gene SSIIIa as resistant starch.
2nd, the identification and sequence analysis of candidate gene
Sequencing result shows that compared with wild type R7954, SSIIIa has single base change in mutant b10.Mutant
SSIIIa is mutated into A (Fig. 2A) at 6223bp by the G of wild type in b10.Wild type full gene sequencing and analysis shows, SSIIIa
It is made up of (Fig. 2A) 16 extrons and 15 intrones.SSIIIa includes the 5th in mutant b10 compared with wild type R7954
G is changed in 3 ' splice site AG of son, is mutated into A.The shearing site, which is undergone mutation, may influence mRNA montage.
MRNA montage whether can be influenceed in order to determine that the splice site is undergone mutation, we extract R7954 and b10 respectively
The RNA in rear 10 days young fringes is spent, and reverse transcription carries out sequencing into cDNA after being expanded by PCR.CDNA sequence analysis result
Show, in mutant b10 the mRNA montages of SSIIIa genes changed, moved after the splice site of original 3 ' of the 5th introne
New splice site is formed to next nearest AG, this montage mode causes the missing (Fig. 2 B) of 4 bases, forms frameshit
Mutation, and translation is terminated in advance, the truncation polypeptide of 1302 amino acid (AA) is formed, and normal polypeptide should be 1788 ammonia
The polypeptide (Fig. 2 B) of base acid (AA).According to design SSIIIa CAPs marks in mutational site between wild type R7954 and mutant b10
Note, and identify R7954 (SSIIIaSSIIIa)/b10 (ssIIIassIIIa), middle spend 11 (SSIIIaSSIIIa)/b10
(ssIIIassIIIa)F2Segregating population genotype, as a result show that SSIIIa sites carry b10 (ssIIIassIIIa) equipotential base
The individual plant resistance starch content of cause is significantly raised.Meanwhile from the middle 11 and Dongjin T-DNA insertional mutagenesis libraries spent
SSIIIa T-DNA insertion mutation body resistance starch contents substantially rise.In summary information, the gene are defined as candidate gene.
Embodiment 2, the acquisition and its detection of genetically modified plants
First, the acquisition of genetically modified plants
1st, the structure of recombinant expression carrier
1) clone of gene
Utilize the gSSIIIa-1F/gSSIIIa-1R primers combination in table 2 and gSSIIIa-2F/gSSIIIa-2R primer sets
Close, the DNA preparation fragments for including SSIIIa genes have been amplified from Nipponbare BAC libraries.Preparation fragment is passed through into SalI enzymes
Cut, reclaim and connect, then by KpnI and SbfI digestions and reclaimed, obtain including total length SSIIIa final genome
DNA fragmentation, sequencing show, Seq ID NO in its nucleotide sequence such as sequence table:Shown in 2 from 5 ' ends.
Seq ID NO:In genomic DNA shown in 2, the 1972nd to 2073 are the 1st extron, and the 3019th is arrived
3082 are the 2nd extron, and the 3169th to 6402 are the 3rd extron, and the 6586 to 6802nd is aobvious outside the 4th
Son, the 7336th to 7604 are the 5th extron, and the 8197th to 8374 are the 6th extron, the 8400th to 8607
Position is the 7th extron, and the 9034th to 9142 are the 8th extron, and the 10503rd to 10604 are aobvious outside the 9th
Son, the 10869th to 11041 are the 10th extron, and the 11165th to 11291 are the 11st extron, the 11533rd
Position is the 12nd extron to 11717, and the 11825th to 11954 are the 13rd extron, the 12034th to 12146
For the 14th extron, the 12312nd to 12434 are 15 extrons, and the 12663rd to 12795 are aobvious outside the 16th
Son.
Seq ID NO:CDNA nucleotide sequence such as sequence corresponding to genomic DNA shown in 2 1972bp to 12795bp
Seq ID NO in list:Shown in 3.Seq ID NO:3 by 5626 base compositions, and its open reading frame (ORF) is from 5 ' ends
Hold the 1st has Seq ID NO in sequence table to the 5367th bit base, coding:The SSIIIa albumen of 1 amino acid sequence.
The primer sequence of table 2
| Primer | Primer sequence (5 ' -3 ') |
| gSSIIIa-1F | AAAGGTACCCGCATGCTTCACCGCCGCTCGTCT |
| gSSIIIa-1R | GCTTCCTCCCGTTCTCTGATCTCGTGGA |
| gSSIIIa-2F | CTGGGTTTTTGCTGACGGGCCACCT |
| gSSIIIa-2R | AAACCTGCAGGTCACGGCTCAGATCGACGAGTAGACCCA |
5 ' ends of gSSIIIa1F primers plus KpnI restriction enzyme sites, 5 ' ends of gSSIIIa2R primers plus SbfI restriction enzyme sites.
2) construction of expression vector
The final genomic DNA fragment insertion vector for including total length SSIIIa genes that step 1) is obtained
Between pCAMBIA1300 (being purchased from Cambia companies) KpnI and SbfI restriction enzyme sites, recombinant expression carrier SSIIIa is obtained:
GSSIIIa (Fig. 6 A), empirical tests vector construction is correct.
2nd, the acquisition of genetically modified plants
By plasmid SSIIIa:GSSIIIa is transferred to Agrobacterium (Agrobacterium by the method for electric shock
Tumefaciens) (public can be obtained strain EHA105 from Inst. of Genetics and Development Biology, CAS's Developmental Biology research, record this
The non-patent literature of material is Lin H, Wang R, Qian Q, et al.DWARF27, an iron-containing
protein required for the biosynthesis of strigolactones,regulates rice tiller
Bud outgrowth.Plant Cell 2009,21,1512-1525.) in, screening is obtained containing recombinant plasmid SSIIIa:
GSSIIIa recombinational agrobacterium bacterial strain.
The mature seed of material b10 containing mutation gene ssIIIa is shelled and sterilized, is inoculated into the training of callus induction
Support base in, light culture grows callus after 2 weeks at scultellum, select growth it is vigorous, color is pale yellow, compares the embryo of consolidation
Property callus, the acceptor as conversion.
With containing recombinant plasmid SSIIIa:GSSIIIa recombinational agrobacterium bacterial strain infects b10 callus, at dark
After 25 DEG C are cultivated 2 days, kanamycin-resistant callus tissue and transfer-gen plant are screened on the Selective agar medium containing 40mg/L hygromycin.Tide is mould
Plain resistant plant hardening in the cool, after be transplanted in paddy field, the transfer-gen plant of acquisition is T0Generation.Harvest T0For the kind of plant
Son, cultivated according to the method for above-mentioned field cultivation, and detected by common molecular, acquisition turns SSIIIa:GSSIIIa T1
For transfer-gen plant.
2nd, the resistance starch content detection of genetically modified plants
1st, the resistance starch content measure of genetically modified plants
To turning SSIIIa:GSSIIIa T1For false sun in transfer-gen plant, b10, R7954 adjoining tree and same strain
Property individual plant control carry out resistance starch content statistics, every kind of 5 plants of positive individual plants of homozygosis of Material Takeoff.As a result if Fig. 6 is (in Fig. 6
The control of false positive individual plant is consistent with b10 controls phenotype, is omitted in figure) shown in, turn SSIIIa:GSSIIIa T1Planted for transgenosis
Compared with b10 adjoining trees and false positive individual plant compare, its resistance starch content reduces (average to be dropped to from 5.69% for strain
1.76%).
2nd, the expressing quantity of SSIIIa genes is detected by Western-blot
By His-SSIIIa, (SSIIIa gene fragment amplification primers are shown in Table 3, and nucleotide sequence is shown in Seq ID in sequence table
NO：3 from shown in 5 ' end 1294-2016 positions) in protein expression strain RosettaDE3 (being purchased from Beijing Quan Shi King Companies)
Rabbit is immunized after Ni-NTA Spin Kits (being purchased from Qiagen companies) affinity purification after recombination expression, prepared more
Clonal antibody.Antigen corresponds to Seq ID NO in sequence table:1 432-672 amino acids, compare and be analyzed to identify through full-length genome
Without other albumen homology sequences in rice genome.The polyclonal antibody of preparation (is being purchased from Thermo using ProteinA/G
Scientific companies) post material carry out affinity purification after use.
Using strong albuminate extract solution, (non-patent literature for recording the formula is Crofts N, Abe B, Aihara
S,et al.Lack of starch synthase IIIa and high expression of granule-bound
starch synthase I synergistically increase the apparent amylose content in
Rice endosperm.Plant Science 2012,193-194,62-69.) extraction transfer-gen plant and control R7954,
The plant total protein of b10 plant, total protein use anti-SSIIIa 1 after diluting 40 times:2000 hybridization checks.Utilize actin bases
Because (act11, purchased from Abmart companies) is used as internal reference, SSIIIa expressing quantities increase (figure in transfer-gen plant is as a result shown
6B)。
The primer sequence of table 3
| Primer | Primer sequence (5 ' -3 ') |
| SSIIIa antiF | GAATTCGAGGTTGATTTGTTTGGAAATGCTTCA |
| SSIIIa antiR | AAGCTTCATGTTTTGCTCAGGTAAACCAGC |
Embodiment 3, the acquisition and its detection of genetically modified plants
First, the acquisition of genetically modified plants
1st, total length CDS acquisition
The cDNA library that the seed of latter 15 days is spent using R7954 is template, respectively with the primer pair SSIIIa OE- in table 4
1F/SSIIIa OE-1R and primer pair SSIIIa OE-2F/SSIIIa OE-2R enter performing PCR amplification, and the fragment amplified passes through
SalI digestions, the fragment obtained after recovery, connection are sequenced, Seq ID NO in sequence such as sequence table:3.
The primer sequence of table 4
| Primer | Primer sequence (5 ' -3 ') |
| SSIIIa OE-1F | AAAGGTACCATGGAGATGGCTCTCCGGCCTCAAA |
| SSIIIa OE-1R | GCATGAAAATCTTGTCGACCATTGTTGT |
| SSIIIa OE-2F | ACAACAATGGTCGACAAGATTTTCATGC |
| SSIIIa OE-2R | AAACCTAGGCTAAATCAAGTATTCATAATTAAAACTG |
5 ' ends of SSIIIa OE-1F primers plus KpnI restriction enzyme sites, 5 ' ends of SSIIIa OE-2R primers plus AvrII enzymes
Enzyme site.
2nd, the structure of overexpression vector
Total length SSIIIa CDS fragments insert band after intermediate carrier T-Vector clones is included by what step 1) obtained
Have Ubiquitin promoters carrier pTCK303 (public can be obtained from Inst. of Genetics and Development Biology, CAS's Developmental Biology research,
The non-patent literature for recording the material is Wang Z, Chen C, Xu Y, et al.A practical vector for
efficient knockdown of gene expression in rice(Oryza sativa L.).Plant
Mol.Biol.Rep.2004,22,409-417.) between KpnI and SacI restriction enzyme sites, overexpression vector pUbi is obtained:
CSSIIIa, empirical tests vector construction are correct.
3rd, the acquisition of genetically modified plants
By plasmid pUbi:CSSIIIa is transferred to Agrobacterium (Agrobacterium tumefaciens) by the method for electric shock
In strain EHA105, screening is obtained containing recombinant plasmid pUbi:CSSIIIa recombinational agrobacterium bacterial strain.
The mature seed of material b10 containing mutation gene ssIIIa is shelled and sterilized, is inoculated into the training of callus induction
Support base in, light culture grows callus after 2 weeks at scultellum, select growth it is vigorous, color is pale yellow, compares the embryo of consolidation
Property callus, the acceptor as conversion.
With containing recombinant plasmid pUbi:CSSIIIa recombinational agrobacterium bacterial strain infects b10 callus, 25 at dark
After DEG C culture 2 days, kanamycin-resistant callus tissue and transfer-gen plant are screened on the Selective agar medium containing 40mg/L hygromycin.By hygromycin
Resistant plant hardening in the cool, after be transplanted in paddy field, the transfer-gen plant of acquisition is T0Generation.Harvest T0For the seed of plant,
Method according to above-mentioned field cultivation is cultivated, and is detected by common molecular, and acquisition turns pUbi:CSSIIIa T1In generation, turns
Gene plant.
2nd, the detection of genetically modified plants
1st, the resistance starch content measure of genetically modified plants
To turning pUbi:CSSIIIa T1For false positive in transfer-gen plant, b10, R7954 adjoining tree and same strain
Individual plant control carries out the statistics of resistance starch content, every kind of 5 plants of positive individual plants of homozygosis of Material Takeoff.As a result such as Fig. 6 (vacations in Fig. 6
Positive individual plant control is consistent with b10 controls phenotype, is omitted in figure) shown in, turn pUbi:CSSIIIa T1For transfer-gen plant with
B10 adjoining trees and the control of false positive individual plant are compared, and its resistance starch content reduces (average to drop to 1.56% from 5.69%).
2nd, the expressing quantity of SSIIIa genes is detected by Western-blot
Transfer-gen plant is extracted using strong albuminate extract solution and compares the plant total protein of R7954, b10 plant, always
Albumen uses anti-SSIIIa 1 after diluting 40 times:2000 hybridization checks.Utilize actin genes (act11, purchased from Abmart public affairs
Department) internal reference is used as, as a result show SSIIIa expressing quantities increase (Fig. 6 B) in transfer-gen plant.
Embodiment 4, the acquisition and its detection of genetically modified plants
First, the acquisition of genetically modified plants
1st, the acquisition of interference fragment
The cDNA library that the seed of latter 15 days is spent using Nipponbare is template, with the primer pair SSIIIa RNAiF/ in table 5
SSIIIa RNAiR enter performing PCR amplification, and the product of acquisition is sequenced.Expand the nucleotide sequence such as sequence of obtained genetic fragment
Seq ID NO in list:4 and Seq ID NO:5.
The primer sequence of table 5
SSIIIa RNAiF primer 5' ends are simultaneously plus SacI and BamHI joints, SSIIIa RNAiR primer 5' ends add simultaneously
Spe I and KpnI joints.
Seq ID NO:4 be Seq ID NO:3 2325bp to 2836bp fragments, Seq ID NO:5 be Seq ID NO:4
Reverse complementary sequence.Seq ID NO:4 and Seq ID NO:5 are analyzed to identify the nothing in rice genome through full-length genome comparison
Other homologous sequences.
2nd, the structure of interference carrier
The primer pair SSIIIa RNAiF/SSIIIa RNAiR portion of product for expanding to obtain is carried out with BamHI and KpnI
Digestion, carrier pTCK303 of the insertion with Ubiquitin promoters BamHI and KpnI sites, obtains carrier 1；Again by residue
Amplified production carry out digestion with SpeI and SacI, be inserted into Spe I and the SacI sites of carrier 1, obtain recombinant expression carrier
SSIIIa RNAi (i.e. interference carrier SSIIIa RNAi), hairpin structure is formed after Insert Fragment expression.
3rd, the acquisition of genetically modified plants
Interference carrier SSIIIa RNAi are transferred to Agrobacterium (Agrobacterium by the method for electric shock
Tumefaciens) in strain EHA105, screening obtains the recombinational agrobacterium bacterial strain containing interference carrier SSIIIa RNAi.
Wild type R7954 mature seed is shelled and sterilized, is inoculated into the culture medium of callus induction, after cultivating 2 weeks, from
Callus is grown at scultellum, select growth it is vigorous, color is pale yellow, compares the embryo callus of consolidation, as conversion
Acceptor.
R7954 Rice Callus is infected with the recombinational agrobacterium bacterial strain containing interference carrier SSIIIa RNAi.In dark
After 25 DEG C of place culture 2 days, kanamycin-resistant callus tissue and transfer-gen plant are screened on the Selective agar medium containing 40mg/L hygromycin.By tide
Chloramphenicol resistance plant hardening in the cool, after be transplanted in paddy field, the transfer-gen plant of acquisition is T0Generation, by T0That withholds turns base
Because seed is planted, obtain turning SSIIIa RNAi T1For transfer-gen plant.
2nd, the detection of genetically modified plants
1st, the resistance starch content measure of genetically modified plants
T to turning SSIIIa RNAi1For false positive list in transfer-gen plant, b10, R7954 adjoining tree and same strain
Strain control carries out the statistics of resistance starch content, every kind of 5 plants of positive individual plants of homozygosis of Material Takeoff.As a result such as Fig. 6, (vacation is positive in Fig. 6
Property individual plant control it is consistent with R7954 controls phenotype, omitted in figure) it is shown, turn SSIIIa RNAi T1For transfer-gen plant with
R7954 adjoining trees and the control of false positive individual plant are compared, and the rise of its resistance starch content is (average to be risen to from 1.74%
5.29%).
2nd, the expressing quantity of SSIIIa genes is detected by Western-blot
Transfer-gen plant is extracted using strong albuminate extract solution and compares the plant total protein of R7954, b10 plant, always
Albumen uses anti-SSIIIa 1 after diluting 40 times:2000 hybridization checks.Utilize actin genes (act11, purchased from Abmart public affairs
Department) internal reference is used as, as a result show that SSIIIa expression quantity declines (Fig. 6 B) in transfer-gen plant.
Claims (13)
1. a kind of albumen related to plant resistance to environment stress Starch synthesis, the albumen related to plant resistance to environment stress Starch synthesis is that have
Following a）Or b）Amino acid sequence protein：
a）By Seq ID NO in sequence table:The protein of amino acid sequence composition shown in 1；
b）By Seq ID NO in sequence table:1 amino acid sequence by one or several amino acid substitution and/or missing and/
Or addition, and it is related to plant resistance to environment stress content of starch by a）Derivative protein.
2. a kind of encoding gene of the albumen related to plant resistance to environment stress Starch synthesis, encoding gene coding claim 1 institute
The albumen stated.
3. encoding gene as claimed in claim 2, it is characterised in that：The encoding gene is following a）Or b）Or base c)
Cause：
a）Seq ID NO in its nucleotide sequence such as sequence table:2 from the DNA molecular shown in 5 ' end 1-14463 positions；
b）Under strict conditions with a）The DNA molecular of albumen described in described nucleotide sequence hybridization and coding claim 1；
c）With a）Gene of the described nucleotide sequence with albumen described in more than 90% homology and coding claim 1.
4. encoding gene as claimed in claim 2, it is characterised in that：The encoding gene is following a）Or b）Or base c)
Cause：
A) its nucleotide sequence is the Seq ID NO in sequence table:DNA molecular shown in 3；
b）Under strict conditions with a）The DNA molecular of albumen described in described nucleotide sequence hybridization and coding claim 1；
And a c)）Gene of the described nucleotide sequence with albumen described in more than 90% homology and coding claim 1.
5. a kind of be used to express the expression cassette with plant resistance to environment stress Starch synthesis GAP-associated protein GAP, contain any one of claim 2-4
The encoding gene.
6. the primer pair for expanding the protein coding gene related to plant resistance to environment stress Starch synthesis, the primer pair can be used for expanding
Increase the total length or its either segment fragment of encoding gene any one of claim 2-4.
7. a kind of be used to express the recombinant expression carrier with plant resistance to environment stress Starch synthesis GAP-associated protein GAP, appoint containing claim 2-4
One encoding gene.
8. a kind of be used to express the recombinant expression carrier with plant resistance to environment stress Starch synthesis GAP-associated protein GAP, it is characterised in that：Containing having the right
Profit requires to be used to express the gene with the expression cassette of plant resistance to environment stress Starch synthesis GAP-associated protein GAP described in 5.
9. to the encoding gene of plant resistance to environment stress Starch synthesis GAP-associated protein GAP in the genetically modified plants that to prepare resistant starch synthesis related
In application, the related genetically modified plants of resistant starch synthesis contain the coding base any one of claim 2-4
Cause.
10. a kind of method of the cultivation containing the genetically modified plants of encoding gene any one of claim 2-4, including will power
Profit requires the step of encoding gene any one of 2-4 is transferred in purpose plant to obtain genetically modified plants.
11. a kind of method for cultivating genetically modified plants, including interference carrier is imported in purpose plant to obtain genetically modified plants
The step of, it is characterised in that：The interference carrier is by Seq ID NO in sequence table:Nucleotide sequence and sequence table shown in 4
Middle Seq ID NO:Nucleotide sequence shown in 5 is sequentially inserted into recombinant vector.
12. a kind of recombinant bacterium containing with plant resistance to environment stress Starch synthesis related protein encoding gene, the recombinant bacterium, which contains, has the right
It is required that the encoding gene any one of 2-4.
13. a kind of transgenic cell line containing with plant resistance to environment stress Starch synthesis related protein encoding gene, the transgenosis are thin
Born of the same parents are the encoding gene any one of containing claim 2-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610848633.7A CN107868773A (en) | 2016-09-23 | 2016-09-23 | The Protein S SIIIa related to rice resistant starch and its encoding gene and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610848633.7A CN107868773A (en) | 2016-09-23 | 2016-09-23 | The Protein S SIIIa related to rice resistant starch and its encoding gene and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107868773A true CN107868773A (en) | 2018-04-03 |
Family
ID=61751726
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610848633.7A Pending CN107868773A (en) | 2016-09-23 | 2016-09-23 | The Protein S SIIIa related to rice resistant starch and its encoding gene and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107868773A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111848804A (en) * | 2020-07-15 | 2020-10-30 | 四川农业大学 | Preparation method of polyclonal antibody of corn starch synthetase SS III |
| CN115029377A (en) * | 2022-05-11 | 2022-09-09 | 广东省农业科学院水稻研究所 | Method for editing rice SSIIIa gene to cultivate high-resistance starch indica rice variety |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102577948A (en) * | 2012-02-07 | 2012-07-18 | 浙江大学 | Rice cultivating method capable of improving resistant starch content |
| WO2012103594A1 (en) * | 2011-02-03 | 2012-08-09 | Commonwealth Scientific And Industrial Research Organisation | Barley with modified ssiii |
-
2016
- 2016-09-23 CN CN201610848633.7A patent/CN107868773A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012103594A1 (en) * | 2011-02-03 | 2012-08-09 | Commonwealth Scientific And Industrial Research Organisation | Barley with modified ssiii |
| CN102577948A (en) * | 2012-02-07 | 2012-07-18 | 浙江大学 | Rice cultivating method capable of improving resistant starch content |
Non-Patent Citations (6)
| Title |
|---|
| DIAN, WM等: "《Evolution and expression analysis of starch synthase III and IV in rice》", 《JOURNAL OF EXPERIMENTAL BOTANY 》 * |
| FUJITA等: "《Characterization of SSIIIa-Deficient Mutants of Rice: The Function of SSIIIa and Pleiotropic Effects by SSIIIa Deficiency in the Rice Endosperm》", 《PLANT PHYSIOLOGY》 * |
| SASAKI,T等: "《Oryza sativa Japonica Group genomic DNA, chromosome 8, BAC clone:OSJNBa0056O06》", 《GENBANK: AP005441.3》 * |
| TIAN, ZHIXI等: "《Allelic diversities in rice starch biosynthesis lead to a diverse array of rice eating and cooking qualities》", 《PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA 》 * |
| TIAN,Z.等: "《Oryza sativa Indica Group cultivar 9308 soluble starch synthase III-2 (SSIII-2) gene, complete cds》", 《GENBANK: GQ151018.1》 * |
| 沈同等编著: "《生物化学》", 31 December 1990, 高等教育出版社 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111848804A (en) * | 2020-07-15 | 2020-10-30 | 四川农业大学 | Preparation method of polyclonal antibody of corn starch synthetase SS III |
| CN115029377A (en) * | 2022-05-11 | 2022-09-09 | 广东省农业科学院水稻研究所 | Method for editing rice SSIIIa gene to cultivate high-resistance starch indica rice variety |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109321582B (en) | Application of aegilops tauschii Yr4DS gene in stripe rust resistant breeding of wheat plants | |
| CN104480119B (en) | Plant salt stress inducible gene OsSIR1 and its encoding proteins and application | |
| CN105753953B (en) | Disease-resistant wheat albumen and encoding gene and its application in regulation disease resistance of plant | |
| CN107827964A (en) | A kind of transcription factor PwNAC2 related to plant stress tolerance and its encoding gene and application | |
| CN110938617A (en) | Lilium regale LrPAL-1 gene and application thereof | |
| CN109971766A (en) | A kind of and plant stress tolerance-associated protein PwRBP1 and its encoding gene and application | |
| CN107630033B (en) | Application of protein OsZFP213 in regulation and control of plant stress resistance | |
| CN107868773A (en) | The Protein S SIIIa related to rice resistant starch and its encoding gene and application | |
| CN110885813B (en) | Application of rice histone deacetylase gene HDA710 in delaying leaf senescence | |
| CN106432444B (en) | One plant glutelin transhipment storage GAP-associated protein GAP GPA4 and its encoding gene and application | |
| CN103570813B (en) | With plant adversity resistance related protein Gh01399 and encoding gene and application | |
| CN104372019B (en) | Turn cultivation, authentication method and the application of CmWRKY48 gene Cut Flower Chrysanthemum Morifoliums | |
| WO2012039159A1 (en) | Method for production of stolon-forming plant having improved tuber production ability or stolon production ability compared with wild type, and stolon-forming plant produced by the method | |
| CN105175519B (en) | Applications of the Protein S RL2 in cultivating leaf roll Qushui River rice | |
| CN107446031A (en) | A kind of plant glutelin transhipment storage GAP-associated protein GAP OsVHA E1 and its encoding gene and application | |
| CN104109682B (en) | A kind of pectin lyase BnPL gene and promoter thereof and application | |
| CN113881685A (en) | Gene PpHSP20-like1 for promoting plant organs to generate red color and application thereof | |
| CN102021181A (en) | Application of paddy gene KT488 to improvement on stress resistance of plants | |
| CN114516908B (en) | Rice grain shape regulatory protein HOS59, encoding gene and application thereof | |
| CN106754932A (en) | A kind of DNA molecular STTM miR482a and its application | |
| CN108148846A (en) | Rice blade profile mutator ZY103 and its application | |
| CN112521470B (en) | Plant starch synthesis related protein OsFLO18, and coding gene and application thereof | |
| CN110734911B (en) | Application of miR159b in regulation and control of rice bacterial leaf blight resistance | |
| Yang et al. | Fine mapping of CaMYB113 regulating anthocyanin accumulation in pepper cotyledons | |
| CN107188938A (en) | Paddy rice resists leaf senile albumen RLS3 and its encoding gene and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |