CN107860765A - A kind of metal ion detection probe, kit, preparation method, application - Google Patents

A kind of metal ion detection probe, kit, preparation method, application Download PDF

Info

Publication number
CN107860765A
CN107860765A CN201711077460.4A CN201711077460A CN107860765A CN 107860765 A CN107860765 A CN 107860765A CN 201711077460 A CN201711077460 A CN 201711077460A CN 107860765 A CN107860765 A CN 107860765A
Authority
CN
China
Prior art keywords
rlu
metal ion
copper
probe
buffer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201711077460.4A
Other languages
Chinese (zh)
Other versions
CN107860765B (en
Inventor
黄沛力
熊亚敏
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Capital Medical University
Original Assignee
Capital Medical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Capital Medical University filed Critical Capital Medical University
Priority to CN201711077460.4A priority Critical patent/CN107860765B/en
Publication of CN107860765A publication Critical patent/CN107860765A/en
Application granted granted Critical
Publication of CN107860765B publication Critical patent/CN107860765B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/76—Chemiluminescence; Bioluminescence
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/531—Production of immunochemical test materials
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54326—Magnetic particles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G01N33/54313—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals the carrier being characterised by its particulate form
    • G01N33/54346—Nanoparticles

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Microbiology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Nanotechnology (AREA)
  • Plasma & Fusion (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Investigating Or Analysing Materials By The Use Of Chemical Reactions (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to biology sensor metal ion detection technical field, and in particular to a kind of metal ion detection probe, kit, preparation method, application.The present invention is using metal ion picodna sequence and substrate chain-ordering modification probe, and there is the group Molecule of catalytic luminescence effect to chemiluminescence system in the modification of the end of substrate chain, detection to metal ion is realized by chemiluminescence principle, and further the modification of the end of substrate chain by metal ion inhibitory activity being capable of the luminous group Molecule of cataluminescence system, realize that cataluminescence activity suppression dual signal amplifies, improve detection sensitivity；This method can realize the regulation of other side's normal interval range by changing reaction buffer ionic strength simultaneously.Specific cuttings and Cu of the inventive method combination Cu DNAzyme to Cu Sub2+Suppression to HRP cataluminescences activity produces dual signal amplification.

Description

A kind of metal ion detection probe, kit, preparation method, application
Technical field
The present invention relates to biology sensor metal ion detection technical field, and in particular to a kind of metal ion detection is visited Pin, kit, preparation method, application.
Background technology
Metal maximum is characterized in that losing electronics turns into positively charged ion, therefore it is each to be present in biological fluid The metal ion of kind form, they can produce various bonding actions with biomolecule, various so as to undertake in vivo Function, such as electronics transfer, oxygen carrier, the activated centre of enzyme.In-vivo metal ion is excessive or very few will all cause human normal The disorder of physiological function, so as to cause various diseases.For example the transition metal ions such as iron, copper, manganese, zinc is important god Through chemokines, the disease of their metabolic disorders and nervous system is closely related, such as early senile dementia, family's flesh withering property ridge Marrow lateral schlerosis and rabid ox disease or Keyashi's syndrome.
Such as copper (Cu) be life entity necessary to one of trace element, it can be used as cofactors to participate in vital movement, The formation of red blood cell can be participated in.With extensive uses of the Cu in fields such as manufacturing industry, chemical industry and pharmaceutical synthesis, people pass through ring The contact such as border exposure, occupational exposure and Iatrogenic Exposure Cu chance is more and more, is produced after the Cu of organism excess intake A large amount of free radicals, body oxidative damage can be caused.Cu is first loosely combined after entering blood with albumin, wherein 90%~98% Cu be transported in liver and form CER with alpha2 Globulin strong bonded, then be discharged into blood.It is former according to Cu is combined The difference of subnumber, CER can be divided into saturation CER and unsaturated CER.When CER synthesis barrier in body When hindering, the Cu contents increase that dissociates in blood can be caused, and then cause substantial amounts of free radical to produce.When these Cu that dissociate are deposited on Organ dysfunction is just caused during the organs such as liver, kidney, brain.Research finds that the disease related to Cu metabolism becomes including liver lenticular nucleus Property (Wilson Disease, WD), alzheimer disease (Alzheimer's disease, AD), Parkinson's (Parkinson's disease, PD), vascular dementia (vascular dementia, VD) etc..Therefore, with free serum Cu Or the relatively free Cu (the total Cu of free serum Cu/ serum) of serum is used as Cu dysbolism relevant disease clinical diagnosis biomarkers And the research of therapeutic process evaluation index is increasingly paid high attention to by medical field.Clinically, free serum Cu mainly includes Free Cu in the serum and Cu loosely combined with albumin, amino acid, typically by calculating the total Cu of serum and CER Obtained with reference to Cu difference, i.e.,：Free Cu=serum total Cu (mg/L) -0.3 × CER (mg/L)/100, or free Cu= The total Cu of serum (μm ol/L) -0.049 × CER (mg/L).However, due to the CER measured using immuno-precipitation It cannot distinguish between saturation CER and unsaturated CER so that CER combination Cu partial results are higher, and dissociate Cu meters Lower result is calculated, the computational methods obtain negative findings in the patient more than 20%.Free serum Cu other assay methods It is then to be peeled off free Cu from the protein such as albumin using chelating agents such as EDTA, passes through inductively coupled plasma after ultrafiltration Body atomic emission spectrometry (ICP-AES), atomic absorption spectrography (AAS) (AAS), inductively coupled plasma mass spectrometry (ICP-MS) The methods of be measured, although these detection method results are accurate, high sensitivity, required expensive equipment, operation difficulty is big, sample Product complex pretreatment, and high are required to operating personnel, it is difficult to popularize in basic unit.Therefore, quick, sensitive, easy Gao Xuan is developed The detection method of selecting property complex system copper ion and other metal ions has great importance.
Based on the biology sensor detection method of identification molecule construction, the advantages that due to high specificity, gradually it is applied to Every field, in fields such as metal ion detections there is also the application of correlation, can quickly, specifically it be examined compared to traditional method , sensitivity often be present in survey target metal ions, but the detection of the metal ion of the low concentration for dissociating in biological specimen It is not high, the defects of detection accuracy is low.Therefore, how to improve based on identification molecular biosensor detect biological in-vivo metal from The sensitivity of son and accuracy, become technical problem urgently to be resolved hurrily at present.
The content of the invention
The defects of in order to overcome prior art, can it is an object of the invention to provide a kind of metal ion detection probe Quickly, it is sensitive, specific detection accurately is carried out to target metal ions.
The second object of the present invention is to provide a kind of preparation method of metal ion detection probe.
The third object of the present invention is to provide a kind of metal ion detection kit, can be quick, sensitive, accurate Specific detection is carried out to target metal ions in human serum.
The fourth object of the present invention is to provide a kind of application of metal ion detection kit.
In order to realize the above object the present invention adopts the following technical scheme that：
A kind of metal ion detection probe, on the probe modification be connected with metal ion picodna enzyme sequence and with The substrate chain-ordering of metal ion picodna enzyme sequence complementary pairing connection, the substrate chain-ordering 3 ' terminal modified have can Cataluminescence system produces chemiluminescent group Molecule.
Optionally, the metal ion suppresses the catalytic activity of the terminal modified group Molecule of substrate chain-ordering 3 '.
Optionally, the metal ion is copper ion；
The picodna enzyme sequence is：5’-GGTAAGCCTGGGCCTCTTTCTTTTTA AGAAAGAAC-3’；
3 ' terminal modified group Molecules of the substrate chain-ordering are horseradish peroxidase HRP；
The substrate chain-ordering is：
5’-Biotin-TTTTTTTTTTTTTTTTTTTTAGCTTCTTTCTAATACGGCTTAC C-HRP-3’。
Optionally, the probe is using the nanometer magnetic bead that Streptavidin is modified as solid phase carrier.Optionally, the nano magnetic Pearl is Fe3O4。
Above-mentioned picodna sequence and substrate chain-ordering are artificial synthesized sequence, are purified after synthesis through HPLC, use preceding use TE buffer solutions are made into 100 μm of ol/L, store for future use；
The preparation method of above-mentioned metal ion detection probe, it is characterised in that including following operating procedure：
1) after taking the nanometer magnetic bead that Streptavidin is modified to be cleaned using buffer solution 1, buffer solution 1 and substrate chain, room are added Warm lucifuge, which is vortexed, reacts, and after reaction terminates, carries out Magneto separate and is simultaneously cleaned using buffer solution 1, obtain the nano magnetic of bound substrates chain Pearl；
2) nanometer magnetic bead of the bound substrates chain of step 1) preparation is taken to add picodna enzyme sequence and hybridization buffer, temperature Reaction is educated, after reaction terminates, Magneto separate is carried out, obtains the nanometer magnetic bead with reference to picodna enzyme sequence and substrate chain；
3) after nanometer magnetic bead prepared by step 2) is cleaned using buffer solution 2, it is stored in buffer solution 2, produces institute The probe stated.
Optionally, the molal weight dosage of substrate chain corresponding to 1mg nanometer magnetic beads is 0.2~0.8nmol in step 1), right The molal weight dosage for the picodna enzyme sequence answered is 1~4nmol.
Optionally, the vortex reaction time in step 1) is 20~40min；The incubation reaction time in step 2) is 60min。
Optionally, the buffer solution 1 is containing NaCl and 0.05%, v/v, Tween-20 TE buffer solutions；The hybridization is slow Fliud flushing be the NaCl containing 1.5mol/L 0.05mol/L HEPES buffer solutions, pH 7.0；The buffer solution 2 is containing NaCl's 0.01mol/L Tris-HCl buffer solutions, pH 8.0.
A kind of metal ion detection kit, including above-mentioned probe.
Mentioned reagent box, in addition to Chemiluminescent plate, Chemoluminescent substrate, standard sample, dilution buffer, washing are slow Fliud flushing, EDTA solution, PBST buffer solutions, treatments of the sample treatment fluid, pH adjusting agent.
In serum, it is in reference state that copper is combined with protein or amino acid, and non-ionic form is present, so detecting It is preceding, it is necessary to serum sample carry out digestion process obtain the Cu of ionic condition, above-mentioned treatments of the sample treatment fluid is including volume ratio 2:1:The peroxidating that the concentrated nitric acid and mass concentration that the concentrated sulfuric acid that 1 mass concentration is 98%, mass concentration are 70% are 30% The mixture of hydrogen.
Optionally, above-mentioned pH adjusting agent is KOH solution.
Optionally, the dilution buffer is 0.05~1.5mol/L HEPES buffer solutions containing NaCl, pH7.0；It is described Lavation buffer solution is the 0.01mol/L Tris-HCl buffer solutions containing NaCl, pH 8.0.
Optionally, the Chemoluminescent substrate includes chemical luminous substrate A and chemical luminous substrate B；Wherein chemistry hair Light substrate A is Luminol and BIP mixture；Chemical luminous substrate B is H2O2。
Application of the above-mentioned metal ion detection kit in terms of the concentration of detection Copper in Serum ion, its feature exist In its detection method includes following operating procedure：
A：Probe is added in Chemiluminescent plate, Magneto separate, after being cleaned with lavation buffer solution, adds ascorbic acid, room temperature Lucifuge is reacted, and reaction terminates rear Magneto separate, and after being cleaned with PBST, is added Chemoluminescent substrate, determined Chemiluminescent plate Luminous intensity, it is designated as RLU0；
B：Ascorbic acid is added in copper ion standard liquid, is added according to the method described in step A in Chemiluminescent plate Enter the copper ion standard liquid containing ascorbic acid, measure luminous intensity is designated as RLU, according to corresponding to different copper ion concentrations (RLU0-RLU)/RLU0Change, draw copper ion concentration examination criteria curve, obtain (RLU0-RLU)/RLU0With copper ion concentration Between corresponding relation formula；
C：Determine the total copper content of serum sample：After taking human serum sample to add sample digestion process liquid progress digestion process, Total copper testing sample is used as after dilution buffer dilution in serum digestive juice, according to the same methods of step A, test sample is treated in total copper After adding ascorbic acid in product, luminous intensity RLU is detected, brings (the RLU of step B acquisitions into0-RLU)/RLU0With copper ion concentration Between corresponding relation formula in, total copper content of serum sample is calculated；
Determine the free copper content of serum sample：Human serum sample is taken, after adding EDTA solution reactions, filtrate is collected by filtration, After filtrate is added into treatments of the sample treatment fluid progress digestion process, filtrate digestive juice is added after dilution buffer dilution as free Copper testing sample, according to the same methods of step A, after adding ascorbic acid in free copper testing sample, detect luminous intensity RLU, bring (the RLU of step B acquisitions into0-RLU)/RLU0In corresponding relation formula between copper ion concentration, serum is calculated The free copper content of sample.
The effect that ascorbic acid is added in above-mentioned copper ion detection process is by Cu2+It is reduced into Cu+, accelerate detection rates, Optionally, the concentration of the ascorbic acid is 20~200 μm of ol/L.
Optionally, the specific method of above-mentioned digestion process is：Every 100 μ L treat to add 400 μ L samples in digestion process sample Digestion process liquid, it is warming up to 150 DEG C and is evaporated after 70 DEG C of reaction 1h, then dissolved with 800 μ L ultra-pure waters, then pH is adjusted with KOH solution For neutrality.
Metal ion picodna enzyme sequence is obtained by Fas lignand system evolution technology (SELEX) screening of index concentration The DNA single-chain fragments with specific catalysis, be made up of the substrate chain-ordering of picodna sequence corresponding thereto, work as gold In the presence of belonging to ion, catalytic activity is played, substrate chain is cut into two parts, the concentration of its cleavage activity and metal ion has Close, according to the principle, the present invention modifies probe, and the end of substrate chain using metal ion picodna sequence and substrate chain-ordering Portion's modification has the group Molecule that catalytic luminescence acts on to chemiluminescence system, is realized by chemiluminescence principle to metal ion Detection.Metal ion picodna sequence is fixed, and cost is low for synthesis, purity is high, after repeatedly denaturation and renaturation activity not by Influence, probe of the present invention based on chemiluminescence principle structure, realize quick to metal ion, specific detection.
The specific present invention is using copper ion picodna sequence (Cu-DNAzyme) and corresponding substrate chain (Cu- Sub probe) is modified, Cu-DNAzyme used is keeping carrying out one on the basis of its peculiar functional structure is constant with Cu-Sub sequences Fixed modification, sequence are as follows：Cu-DNAzyme：5’-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3’、Cu- Sub：5’-Biotin-T20AGCTTCTTTCTAATACGGCTTA CC-HRP-3 ', Cu-Sub 5 ' ends extend 20 T bases can Reduce in its Fe3O4Steric hindrance when surface hybridizes with Cu-DNAzyme, the horseradish peroxidase (HRP) of 3 ' end marks is no Luminol-H can be only catalyzed2O2System produces chemiluminescence, and in Cu2+Under effect, its activity is suppressed, with Cu2+It is right Cu-DNAzyme cutting produces synergy, produces dual amplification to detection signal, improves detection sensitivity, can realize pair Total copper and free copper high specific, the detection of high sensitivity in serum sample.
Its principle is：In no Cu2+In the case of, the Cu-DNAzyme compounds of detecting probe surface keep conformational stability, its HRP terminal modified middle Cu-Sub 3 ' keeps its native conformation, is catalyzed Luminol-H2O2System produces strong chemiluminescence (CL)；Add Cu2+Afterwards, Cu-DNAzyme combinations Cu2+And catalytic activity is produced, catalysis cutting Cu-Sub generations S1 (- T20AGCTTCTTTCTAATACG) and the segment DNA fragments of S2 (- GCTTACC-HRP) two, wherein be marked with HRP S2 ends due to The reduction of Cu-DNAzyme complementary bases pair and be released in solution, after Magneto separate washs, detecting probe surface HRP contents subtract It is few, in addition, Cu2+Its catalytic activity is reduced with HRP with reference to its conformational change is caused, therefore, because Fe3O4Surface HRP contents Reduction and activity reduction, cause probe cataluminescence ability to decline, according to chemiluminescence intensity (RLU) and treating test sample Cu in product2+Content, which is inversely proportional, carries out quantitative analysis.
Brief description of the drawings
Fig. 1 is the synthesising probing needle Fe of the embodiment of the present invention 13O4The principle signal of@Cu-Sub@Cu-DNAzyme detection copper ions Figure；
Fig. 2 is the synthesising probing needle Fe of the embodiment of the present invention 13O4@Cu-Sub@Cu-DNAzyme particle diameter distributions；1 is Fe in figure3O4 Particulate；2 be Fe3O4@Cu-Sub；3 be Fe3O4@Cu-Sub@Cu-DNAzyme；
Fig. 3 is the synthesising probing needle Fe of the embodiment of the present invention 13O4@Cu-Sub@Cu-DNAzyme Zeta potentials characterize；4 are in figure Fe3O4Particulate；5 be Fe3O4@Cu-Sub；6 be Fe3O4@Cu-Sub@Cu-DNAzyme；
Fig. 4 is Cu2+To Fe in the embodiment of the present invention 13O4@Cu-Sub and Fe3O4@Cu-Sub@Cu-DNAzyme response is bent Line；
Fig. 5 be in the embodiment of the present invention 4 in serum sample detection process in dilution buffer NaCl concentration to detection line and The influence of sensitivity；
Fig. 6 is in the embodiment of the present invention 4 in serum sample detection process in dilution buffer corresponding to different NaCl concentrations Standard curve.
Embodiment
Technical scheme is described in detail below by specific embodiment.
The instrument and reagent that following embodiments are used：
Auto injection Chemiluminescence Apparatus (Victor X Light, PerkinElmer), laser particle size analyzer (Nano ZS90, Malvern)；Streptavidin MagneSphere (Fe3O4- SA, the Mai Ge BioMag bio tech ltd of Wuxi hundred), Cu- DNAzyme (sequences：5 '-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3 '), Cu-Sub (sequences：5’- Biotin-T20AGCTTCTTTCTAATACGGCTTACC-HRP-3 ') synthesized by the precious biological Takara in Dalian and purified through HPLC, Use the preceding storing solution that 100 μm of ol/L are made into TE buffer solutions.1.0mol/L pH 8.0Tris-HCl buffer solutions, 1.0mol/L PH 8.8Tris-HCl buffer solutions, TE buffer solutions (Beijing Suo Laibao Science and Technology Ltd), HEPES buffer solution, parazon (BIP), ascorbic acid, potassium hydroxide (electron level, 99.999%) (Shanghai Aladdin biochemical technology limited company), Rumi Promise (Luminol, Sigma), 30% hydrogen peroxide (H2O2, traditional Chinese medicines), Cu2+,Mn2+,Te2+,Bi3+,Ni2+,Hg2+,Pb2+,Se2+,Cd2 +,In3+,Ca2+,Mg2+,Fe3+,Co2+Standard liquid (State center for standard matter), other reagents used are that analysis is pure, are owned Solution is prepared with Milli-Q ultra-pure waters (resistivity is more than 18.2M Ω cm), and glassware is through HNO used in experiment3Immersion Pure water cleaning down is used after overnight.
The buffer solution used in experiment is as follows：(1)Buffer A：TE containing NaCl and 0.05% (v/v) Tween-20 delays Fliud flushing；(2)Buffer B：0.01mol/L Tris-HCl buffer solutions containing NaCl, pH 8.0；(3)Buffer C：Containing 0.05- 1.5mol/L NaCl 0.05mol/L HEPES buffer solutions, pH 7.0；(4) hybridization buffer：The NaCl's containing 1.5mol/L 0.05mol/L HEPES buffer solutions, pH 7.0；(5)PBST：PBS containing 0.5% (v/v) Tween-20, pH 7.4. (6) chemical luminous substrate A：1.60mmol/L Luminol and 0.03mmol/L BIP mixture；(7) chemical luminous substrate B： 10mmol/L H2O2。
Embodiment 1
The present embodiment provides a kind of copper ion detection probe, with Streptavidin MagneSphere Fe3O4- SA is solid phase carrier, Streptavidin MagneSphere surface modification connects copper ion picodna sequence C u-DNAzyme and the substrate chain being connected is matched with it Sequence C u-Sub, substrate chain-ordering Cu-Sub 3 ' it is terminal modified have horseradish peroxidase HRP, its synthetic method is specially：
(1) 1mg Fe are taken3O4- SA cleans 3 times in centrifuge tube, with buffer solution 1 (Buffer A), Magneto separate；
(2) toward adding 6 μ L, 100 μm of ol/L Cu-Sub in centrifuge tube, and Buffer A are added to 500 μ L, room temperature lucifuge Be vortexed reaction 30min；
(3) after reaction terminates, Magneto separate discards uncombined Cu-Sub and cleaned 3 times with Buffer A, obtains Fe3O4@ Cu-Sub；
(4) 30 μ L, 100 μm of ol/L Cu-DNAzyme are then added in system, and add hybridization buffer to 500 μ L, Incubate 60min；
(5) after reaction terminates, products therefrom is cleaned 3 times with buffer solution 2 (Buffer B), and is resuspended in Buffer B, 4 DEG C preserve, produce probe Fe3O4@Cu-Sub@Cu-DNAzyme, as copper ion detection probe.
It is measured using change of the laser particle analyzer to particle diameter distribution and Zeta potential in probe building-up process, as a result such as Shown in Fig. 2 and Fig. 3, with Fe3O4Compare, Fe3O4@Cu-Sub and Fe3O4@Cu-Sub@Cu-DNAzyme particle diameter is increased slightly, can Can be caused by its water solubility increase after modifying Cu-Sub and Cu-DNAzyme.Three is in negative electricity, and with Cu-Sub and Cu- DNAzyme modification, Zeta potential absolute value increase, it may be possible to caused by DNA is negatively charged in water, thus judge probe Synthesize successfully, wherein Fe3O4@Cu-Sub@Cu-DNAzyme Zeta potential is -31.8mV, and it is good to show that it has in aqueous Good stability.
Embodiment 2
The present embodiment provides a kind of copper ion detection probe, with Streptavidin MagneSphere Fe3O4- SA is solid phase carrier, Streptavidin MagneSphere surface modification connects copper ion picodna sequence C u-DNAzyme and the substrate chain being connected is matched with it Sequence C u-Sub, substrate chain-ordering Cu-Sub 3 ' it is terminal modified have horseradish peroxidase HRP, its synthetic method is specially：
(1) 1mg Fe are taken3O4- SA cleans 3 times in centrifuge tube, with buffer solution 1 (Buffer A), Magneto separate；
(2) toward adding 2 μ L, 100 μm of ol/L Cu-Sub in centrifuge tube, and Buffer A are added to 500 μ L, room temperature lucifuge Be vortexed reaction 20min；
(3) after reaction terminates, Magneto separate discards uncombined Cu-Sub and cleaned 3 times with Buffer A, obtains Fe3O4@ Cu-Sub；
(4) 10 μ L, 100 μm of ol/L Cu-DNAzyme are then added in system, and add hybridization buffer to 500 μ L, Incubate 60min；
(5) after reaction terminates, products therefrom is cleaned 3 times with buffer solution 2 (Buffer B), and is resuspended in buffer B, 4 DEG C preserve, produce probe Fe3O4@Cu-Sub@Cu-DNAzyme, as copper ion detection probe.
Embodiment 3
The present embodiment provides a kind of copper ion detection probe, with Streptavidin MagneSphere Fe3O4- SA is solid phase carrier, Streptavidin MagneSphere surface modification connects copper ion picodna sequence C u-DNAzyme and the substrate chain being connected is matched with it Sequence C u-Sub, substrate chain-ordering Cu-Sub 3 ' it is terminal modified have horseradish peroxidase HRP, its synthetic method is specially：
(1) 1mg Fe are taken3O4- SA cleans 3 times in centrifuge tube, with buffer solution 1 (Buffer A), Magneto separate；
(2) toward adding 8 μ L, 100 μm of ol/L Cu-Sub in centrifuge tube, and Buffer A are added to 500 μ L, room temperature lucifuge Be vortexed reaction 40min；
(3) after reaction terminates, Magneto separate discards uncombined Cu-Sub and cleaned 3 times with Buffer A, obtains Fe3O4@ Cu-Sub；
(4) 40 μ L, 100 μm of ol/L Cu-DNAzyme are then added in system, and add hybridization buffer to 500 μ L, Incubate 60min；
(5) after reaction terminates, products therefrom is cleaned 3 times with buffer solution 2 (Buffer B), and is resuspended in buffer B, 4 DEG C preserve, produce probe Fe3O4@Cu-Sub@Cu-DNAzyme, as copper ion detection probe.
Embodiment 4
The present embodiment provides a kind of copper ion detection kit, including the probe of the preparation of embodiment 1, Chemiluminescent plate, Chemical luminous substrate A, chemical luminous substrate B, copper ion standard liquid, dilution buffer, lavation buffer solution, PBST buffer solutions, Treatments of the sample treatment fluid, pH adjusting agent；Wherein dilution buffer is the Buffer C in mentioned reagent, and lavation buffer solution is above-mentioned Buffer B in reagent；It is 2 that treatments of the sample treatment fluid, which includes volume ratio,：1：The concentrated sulfuric acid, the quality that 1 mass concentration is 98% The mixture for the hydrogen peroxide that the concentrated nitric acid and mass concentration that concentration is 70% are 30%；PH adjusting agent is KOH.
Total copper content and the free copper content in blood samples, specific detection method are detected using the present embodiment kit For：
A：The probe of 100 μ L, 800 times of dilutions is added per hole in Chemiluminescent plate, Magneto separate, two are cleaned with Buffer B After secondary, the ascorbic acid that 100 μ L concentration are 100 μm of ol/L, the reaction of room temperature lucifuge are added per hole, reaction terminates rear Magneto separate, and After cleaning 5 times with PBST, 50 μ L chemical luminous substrates A and 50 μ L chemical luminous substrate B are separately added into, determine Chemiluminescent plate Luminous intensity, it is designated as RLU0；
B：Ascorbic acid is added in copper ion standard liquid, is added according to the method described in step A in Chemiluminescent plate Enter the copper ion standard liquid that 100 μ L contain ascorbic acid, the concentration and the ascorbic acid of step A additions of ascorbic acid therein Concentration it is equal, measure luminous intensity be designated as RLU, according to (RLU corresponding to different copper ion concentrations0-RLU)/RLU0Change, Copper ion concentration examination criteria curve is drawn, obtains (RLU0-RLU)/RLU0Corresponding relation formula between copper ion concentration；
C：Determine the total copper content of serum sample：Take the μ L of human serum sample 100, add 400 μ L sample digestion process liquid, 70 DEG C 150 DEG C are warming up to after reaction 1h to be evaporated, is then dissolved with 800 μ L ultra-pure waters, then it is neutral to adjust pH with KOH solution, is added Buffer C dilute, and as total copper testing sample, 100 μ L are added in Chemiluminescent plate according to method same step A and are contained Total copper testing sample of ascorbic acid, the concentration of ascorbic acid therein is equal with the concentration of the step A ascorbic acid added, surveys Determine luminous intensity and be designated as RLU, bring (the RLU of step B acquisitions into0-RLU)/RLU0Corresponding relation formula between copper ion concentration In, total copper content of serum sample is calculated；
Determine the free copper content of serum sample：Human serum sample is taken, after adding EDTA solution reactions, is entered with 10KD super filter tubes Row ultrafiltration, filtrate is collected, after filtrate is carried out into digestion process according to above-mentioned same method, filtrate digestive juice adds Buffer C Free copper testing sample is used as after dilution, 100 μ L are added in Chemiluminescent plate according to method same step A contains Vitamin C The free copper testing sample of acid, the concentration of ascorbic acid therein is equal with the concentration of the step A ascorbic acid added, measure hair Luminous intensity is designated as RLU, brings (the RLU of step B acquisitions into0-RLU)/RLU0In corresponding relation formula between copper ion concentration, meter Calculate the free copper content for drawing serum sample.
The present embodiment is detected using chemiluminescence principle to copper ion, and concrete principle is as shown in figure 1, with Fe3O4-SA For solid phase carrier, first by biotin-Streptavidin system in Fe3O4Surface ornament Cu-Sub, subsequent Cu-DNAzyme with Cu-Sub forms stable secondary structure, Fe by base pair complementarity3O4With modifying the Cu-DNAzyme compounds on its surface Form Fe3O4@Cu-Sub@Cu-DNAzyme nano-probes.In no Cu2+In the case of, Fe3O4The Cu-DNAzyme on surface is answered Compound keeps conformational stability, and HRP terminal modified wherein Cu-Sub 3 ' keeps its native conformation, is catalyzed Luminol-H2O2System is produced Raw strong chemiluminescence (CL)；Add Cu2+Afterwards, Cu-DNAzyme combinations Cu2+And catalytic activity is produced, catalysis cutting Cu- Sub generation S1 (- T20AGCTTCTTTCTAATACG) and the segment DNA fragments of S2 (- GCTTACC-HRP) two, wherein being marked with HRP's S2 ends are released in solution due to the reduction with Cu-DNAzyme complementary bases pair, after Magneto separate washs, Fe3O4Surface HRP contents are reduced, in addition, Cu2+Its catalytic activity is reduced with HRP with reference to its conformational change is caused, therefore, because Fe3O4Table The reduction of face HRP contents and the reduction of activity, cause probe cataluminescence ability to decline, according to chemiluminescence intensity (RLU) with testing sample in Cu2+Content, which is inversely proportional, carries out quantitative analysis.
1st, compliance test result test：Reduction for RLU in checking the present embodiment copper ion detection probe is by Cu-DNAzyme To Cu-Sub dissection or Cu2+To caused by HRP activity suppression, respectively from Fe3O4@Cu-Sub and Fe3O4@ Cu-Sub@Cu-DNAzyme are Cu2+Substrate specificity, and different Cu are drawn respectively2+To both response curves, as a result such as Fig. 4 institutes Show, it can be found that Cu from figure2+It can decline RLU after being acted on both, and with Fe3O4@Cu-Sub@Cu-DNAzyme are Substrate is to low concentration Cu2+Response it is sensitiveer, and the Cu of higher concentration2+Just can be to Fe3O4The RLU of@Cu-Sub groups produces suppression. Therefore, the present embodiment probe combination Cu-DNAzyme is to Cu-Sub cuttings and Cu2+The double action of HRP activity suppressions is produced Signal amplifies, with utilizing Cu-DNAzyme fluorescence senses method and HRP activity suppressions detection Cu merely2+Method compare, have Higher sensitivity, it is more suitable for trace Cu2+Detection.
2nd, condition optimizing is tested：NaCl concentration is to detecting the linear model of copper ion concentration in optimization dilution buffer Buffer C The influence enclosed：
For different actual samples, the concentration difference of its target analytes is larger, for example, the total copper reference value of serum is 10.9~21.8 μm of ol/L, and free serum copper only accounts for the 5%~15% of the total copper of serum, and copper dysbolism Disease Urinating copper content, to it to drive copper therapeutic process related.Therefore, one there is the adjustable method of linearly interval to be more suitable for actual sample Detection.Because buffer solution ionic strength has considerable influence to detecting probe surface Cu-DNAzyme compound conformations, and influence Cu- DNAzyme catalysis cuttings Cu-Sub activity, therefore the Buffer C of different ionic strength have been investigated to Cu2+Half-inhibition concentration (IC50) influence.As shown in figure 5, with the reduction of NaCl concentration in Buffer C, IC50 is gradually reduced, and sensitivity is increased, In 5 selected NaCl concentrations, when NaCl concentration is 0.05mol/L, IC50 reaches minimum.The reason for this phenomenon, can Following two aspects can be：When with buffer C NaCl concentration increase, cuttings of the Cu-DNAzyme to Cu-Sub Activity is gradually suppressed；On the other hand it is that ionic strength influences suspension of the nanometer magnetic bead in buffer C to a certain extent Stability, high concentration NaCl causes nanometer magnetic bead to be assembled and its smaller surface area, so as to reduce Cu-DNAzyme and Cu2+Between Contact-impact chance.As shown in fig. 6, in the case where other conditions are optimal, when NaCl concentration is 1.5mol/L in Buffer C When, Cu2+Linear response section be 50~1500nmol/L；When NaCl concentration is reduced to 0.05mol/L in Buffer C, Cu2+ Linear response section be 0.01~200nmol/L.Therefore, this method can be simply by reaction buffer Buffer C The regulation of ionic strength reaches Cu2+The regulation of the range of linearity and sensitivity is detected, can easily more be applied to different Cu2+Concentration Sample detection.
In addition, same reason, therefore, rational to infer because Cu-DNAzyme and HRP activity is also sensitive to pH The range of linearity of method can be adjusted by adjusting Buffer C pH.
3rd, method standard curve, test limit and specificity
Under the conditions of NaCl concentration is reduced to 0.05mol/L in Buffer C, detected according to the method described in embodiment 4 different Concentration C u2+Luminous intensity RLU, with Cu2+Concentration is abscissa, (RLU0-RLU)/RLU0Standard curve is drawn for ordinate, its Middle Cu2+Concentration in the range of 0.01~200nmol/L with (RLU0-RLU)/RLU0There are good linear relation, regression equation Y= (wherein Y is (RLU to 0.06125+0.00344X0-RLU)/RLU0, X Cu2+Concentration), R2For 0.9923.
It is as shown in table 1 that method test limit (LOD) by limiting dilution method measures result, detects low concentration region Cu2+Standard items Corresponding RLU, and detect some Cu2+Blank sample obtainsValue be 4901996, withInstitute Corresponding Cu2+Concentration is method test limit, and therefore, in optimal conditions, this method detection is limited to 0.001nmol/L.
The low concentration Cu of table 12+Testing result
4th, method specific detection：
The detection that the kit of embodiment 4 is used for free Cu in complex system may be disturbed by other metal ions, because This chooses 13 kinds of common metal ion Mn2+、Te2+、Bi3+、Ni2+、Hg2+、Pb2+、Se2+、Cd2+、In3+、Ca2+、Mg2+、Fe3+、Co2+ The specificity of method is investigated, wherein Cu2+Concentration be 0.1 μm of ol/L, remaining per metal ion species respectively from 3 it is dense Spend (10,100 and 500 μm of ol/L).As a result find, 0.1 μm of ol/L Cu2+Strong suppression is produced to CL, except 500 μm of ol/L Hg2+、Cd2+And Fe3+CL is slightly suppressed, its inhibition level is far below 0.1 μm of ol/L Cu2+, probe is to remaining metal ion Without response.Therefore the probe is to Cu2+Selectivity be at least above Hg2+、Cd2+And Fe3+1000 times, higher than remaining metal from 5000 times of son.
5th, the degree of accuracy of method and precision
Cu is detected to kit in embodiment 42+The degree of accuracy and precision investigated, prepare respectively high, medium and low The Cu of (150,80,1.0nmol/L) three concentration2+Sample, each concentration parallel determination three times, and calculate the rate of recovery and relative mark Quasi- deviation (RSD), the results are shown in Table 2 and table 3.The scope of the rate of recovery is 91.9%~110.0% wherein in plate, and the rate of recovery is between plate 94.0%~103.9%, corresponding RSD is respectively 3.0%~11.8% and 4.2%~12.8%；In a few days and in the daytime the rate of recovery Respectively 97.2%~118.0% and 92.3%~106.0%, corresponding RSD be respectively 3.3%~13.5% and 8.7%~ 10.6%.Show that this method is used for Cu2+The degree of accuracy of detection and precision are higher.
The degree of accuracy between plate and precision (n=3) in the method plate of table 2
The degree of accuracy in a few days and in the daytime of the method for table 3 and precision (n=3)
6th, practical application effect
Using the detection method described in embodiment 4, NaCl concentration is reduced to 0.05mol/L, 9 drug therapies in Buffer C In hepatolenticular degeneration (WD) patients serum, 10 Healthy Human Serums as detection samples, detect the total of different serum samples Cu, free Cu, testing result are shown in Table, and the scope that the total Cu of Healthy Human Serum is obtained according to testing result is 12.71~23.86 μ Mol/L, free serum Cu scope are 0.59~2.61 μm of ol/L, consistent with document report result.With paired-sample t test pair This method testing result is analyzed with Atomic absorption (AAS) testing result, its P>0.01, two kinds of detection method testing results No significant difference, it was demonstrated that this method degree of accuracy is high, being capable of Cu effectively in complex system2+Detection.
In addition, with independent samples t test respectively to WD patients serums and total Cu of Healthy Human Serum, free Cu and relative trip Statistical analysis is carried out from Cu testing results, as a result finds the total Cu of serum and relatively free differences of the Cu between WD patient and Healthy People It is different that there is statistical significance (P<0.01), free serum Cu no significant difference (P>0.01), as a result prompt, through driving Copper drug therapy, the free Cu of WD patients serums can be made to be down to normal level, but because its CER dyssynthesis causes serum Total Cu reduction makes its relatively free Cu be still higher than normal person.
The serum sample testing result of table 4
7th, conclusion
The present invention is using Cu-DNAzyme as Cu2+Molecule is identified, can by solid phase carrier and separating tool, synthesis of nanometer magnetic bead Quickly identify and separate the nano-probe of copper ions in sample, the luminous inspection of copper ion ultra sensitive chemical in complex system is built with this Survey method.Further cuttings and Cu of the inventive method combination Cu-DNAzyme to Cu-Sub2+HRP cataluminescences are lived Property suppression produce dual signal amplification, realize the hypersensitive quick detection to copper ion in complex sample, tune can be passed through The ionic strength of reaction buffer is saved to Cu2+The range of linearity of detection is adjusted, the Cu suitable for different samples2+It is direct Detection, and optimization obtains when NaCl concentration is 0.05mol/L in dilution buffer and Cu2+In 0.01~200nmolL-1 In the range of be in good linear relationship, test limit as little as 0.001nmolL-1, while this method is selectively good, the degree of accuracy and essence Density is higher, in addition, being found by statistical analysis, the inventive method detects to the testing result of serum sample with Atomic absorption As a result no significant difference, it is multiple to show that the inventive method can be efficiently applied to biological specimen, environmental sample, food etc. Trace Cu in miscellaneous system2+Quick detection, while can according to provided in embodiment copper ion detection probe and copper ion detection Method And Principle designs the detection probe and detection method of other metal ions, such as zinc, manganese plasma.
Finally it should be noted that：The above embodiments are merely illustrative of the technical solutions of the present invention, rather than its limitations；Although The present invention is described in detail with reference to the foregoing embodiments, it will be understood by those within the art that：It still may be used To be modified to the technical scheme described in foregoing embodiments, or equivalent substitution is carried out to which part technical characteristic； And these modification or replace, do not make appropriate technical solution essence depart from various embodiments of the present invention technical scheme spirit and Scope.

Claims (10)

1. a kind of metal ion detection probe, it is characterised in that modification is connected with metal ion picodna on the probe Enzyme sequence and the substrate chain-ordering being connected with metal ion picodna enzyme sequence complementary pairing, 3 ' ends of the substrate chain-ordering Being modified with being capable of the chemiluminescent group Molecule of cataluminescence system generation.
2. metal ion detection probe as claimed in claim 1, it is characterised in that the metal ion suppresses substrate chain sequence The catalytic activity of the terminal modified group Molecule of row 3 '.
3. metal ion detection probe as claimed in claim 1, it is characterised in that the metal ion is copper ion；
The picodna enzyme sequence is：5’-GGTAAGCCTGGGCCTCTTTCTTTTTAAGAAAGAAC-3’；
3 ' terminal modified group Molecules of the substrate chain-ordering are horseradish peroxidase HRP；
The substrate chain-ordering is：
5’-Biotin-TTTTTTTTTTTTTTTTTTTTAGCTTCTTTCTAATACGGCTTACC-HRP-3’。
4. metal ion detection probe as claimed in claim 3, it is characterised in that the probe is modified with Streptavidin Nanometer magnetic bead be solid phase carrier.
5. a kind of preparation method of metal ion detection probe as claimed in claim 4, it is characterised in that including following behaviour Make step：
1) nanometer magnetic bead for taking Streptavidin to modify, after being cleaned using buffer solution 1, add buffer solution 1 and substrate chain, room temperature are kept away Light, which is vortexed, to react, and after reaction terminates, carries out Magneto separate and is simultaneously cleaned using buffer solution 1, obtain the nanometer magnetic bead of bound substrates chain；
2) take the nanometer magnetic bead of the bound substrates chain of step 1) preparation to add picodna enzyme sequence and hybridization buffer, incubate anti- Should, after reaction terminates, obtain the nanometer magnetic bead with reference to picodna enzyme sequence and substrate chain；
3) by step 2) prepare nanometer magnetic bead cleaned using buffer solution 2 after, be stored in buffer solution 2, produce described in Probe.
6. a kind of metal ion detection kit, it is characterised in that including the probe as described in any one of Claims 1 to 4.
7. metal ion detection kit as claimed in claim 6, it is characterised in that the kit be used for detect copper from Son, including probe as claimed in claim 4.
8. metal ion detection kit as claimed in claim 7, it is characterised in that also including Chemiluminescent plate, chemistry Luminous substrate liquid, standard sample, dilution buffer, lavation buffer solution, EDTA solution, PBST buffer solutions, treatments of the sample treatment fluid, PH adjusting agent.
A kind of 9. metal ion detection kit as claimed in claim 8 answering in terms of Copper in Serum ion concentration is detected With, it is characterised in that its detection method includes following operating procedure：
A：Probe is added in Chemiluminescent plate, Magneto separate, after being cleaned with lavation buffer solution, it is anti-to add ascorbic acid room temperature lucifuge Should, reaction terminates rear Magneto separate, and after being cleaned with PBST, adds Chemoluminescent substrate, determines the luminous strong of Chemiluminescent plate Degree, is designated as RLU0；
B：Ascorbic acid is added in copper ion standard liquid, adds and contains in Chemiluminescent plate according to the method described in step A There is the copper ion standard liquid of ascorbic acid, measure luminous intensity is designated as RLU, according to (RLU corresponding to different copper ion concentrations0- RLU)/RLU0Change, draw copper ion concentration examination criteria curve, obtain (RLU0-RLU)/RLU0Between copper ion concentration Corresponding relation formula；
C：Determine the total copper content of serum sample：After taking human serum sample to add treatments of the sample treatment fluid progress digestion process, serum Digestive juice diluted by the use of dilution buffer after as total copper testing sample, according to the same methods of step A, in total copper testing sample After adding ascorbic acid, luminous intensity RLU is detected, brings (the RLU of step B acquisitions into0-RLU)/RLU0Between copper ion concentration Corresponding relation formula in, total copper content of serum sample is calculated；
Determine the free copper content of serum sample：Human serum sample is taken, after adding EDTA solution reactions, is collected and filtered with super filter tube ultrafiltration Liquid, after filtrate is added into treatments of the sample treatment fluid progress digestion process, filtrate digestive juice adds conduct after dilution buffer dilution Free copper testing sample, according to the same methods of step A, after adding ascorbic acid in free copper testing sample, detection is luminous Intensity RLU, bring (the RLU of step B acquisitions into0-RLU)/RLU0In corresponding relation formula between copper ion concentration, it is calculated The free copper content of serum sample.
10. application as claimed in claim 9, it is characterised in that the dilution buffer is the 0.05mol/L containing NaCl HEPES buffer solution, pH=7.0.
CN201711077460.4A 2017-11-06 2017-11-06 Probe for metal ion detection, kit, preparation method and application Active CN107860765B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711077460.4A CN107860765B (en) 2017-11-06 2017-11-06 Probe for metal ion detection, kit, preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711077460.4A CN107860765B (en) 2017-11-06 2017-11-06 Probe for metal ion detection, kit, preparation method and application

Publications (2)

Publication Number Publication Date
CN107860765A true CN107860765A (en) 2018-03-30
CN107860765B CN107860765B (en) 2020-08-04

Family

ID=61700981

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711077460.4A Active CN107860765B (en) 2017-11-06 2017-11-06 Probe for metal ion detection, kit, preparation method and application

Country Status (1)

Country Link
CN (1) CN107860765B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108287219A (en) * 2018-01-10 2018-07-17 桂林理工大学 A kind of universal exponential amplification method of chemical-biological transducing signal
CN108982458A (en) * 2018-08-14 2018-12-11 江苏科技大学 A kind of magnetic bead particles based on deoxyribozyme modification are used for the fluorescent method of zinc ion detection
WO2020177059A1 (en) * 2019-03-04 2020-09-10 Nano And Advanced Materials Institute Limited System and method for detecting heavy metals and bacteria in an analyte
CN113640515A (en) * 2021-08-09 2021-11-12 郑州大学 Method and kit for detecting exosome by using multiple markers in combined manner

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103558215A (en) * 2013-11-06 2014-02-05 中国科学院广州生物医药与健康研究院 Copper ion detection kit based on click chemistry and G tetramer and detection method of copper ion detection kit
CN104655615A (en) * 2014-07-08 2015-05-27 青岛科技大学 Biological sensor based on CuS nano-particle cation exchange enhanced chemiluminescence
CN107064515A (en) * 2017-03-13 2017-08-18 广东省生态环境技术研究所 A kind of copper ion detection method and detection kit based on click chemistry

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103558215A (en) * 2013-11-06 2014-02-05 中国科学院广州生物医药与健康研究院 Copper ion detection kit based on click chemistry and G tetramer and detection method of copper ion detection kit
CN104655615A (en) * 2014-07-08 2015-05-27 青岛科技大学 Biological sensor based on CuS nano-particle cation exchange enhanced chemiluminescence
CN107064515A (en) * 2017-03-13 2017-08-18 广东省生态环境技术研究所 A kind of copper ion detection method and detection kit based on click chemistry

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
BIN-CHENG YIN等: "An Allosteric Dual-DNAzyme Unimolecular Probe for Colorimetric Detection of Copper(II)", 《J. AM. CHEM. SOC》 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN108287219A (en) * 2018-01-10 2018-07-17 桂林理工大学 A kind of universal exponential amplification method of chemical-biological transducing signal
CN108982458A (en) * 2018-08-14 2018-12-11 江苏科技大学 A kind of magnetic bead particles based on deoxyribozyme modification are used for the fluorescent method of zinc ion detection
WO2020177059A1 (en) * 2019-03-04 2020-09-10 Nano And Advanced Materials Institute Limited System and method for detecting heavy metals and bacteria in an analyte
CN113640515A (en) * 2021-08-09 2021-11-12 郑州大学 Method and kit for detecting exosome by using multiple markers in combined manner
CN113640515B (en) * 2021-08-09 2023-08-08 郑州大学 Method and kit for jointly detecting exosomes by utilizing multiple markers

Also Published As

Publication number Publication date
CN107860765B (en) 2020-08-04

Similar Documents

Publication Publication Date Title
Liu et al. Fe3O4@ Au SERS tags-based lateral flow assay for simultaneous detection of serum amyloid A and C-reactive protein in unprocessed blood sample
CN107860765A (en) A kind of metal ion detection probe, kit, preparation method, application
Tan et al. Determination of tetracycline in milk by using nucleotide/lanthanide coordination polymer-based ternary complex
Huang et al. A carbon dots based fluorescent probe for selective and sensitive detection of hemoglobin
Ding et al. Fluorescent carbon dots nanosensor for label-free determination of vitamin B12 based on inner filter effect
Chen et al. Protein-templated gold nanoclusters as fluorescence probes for the detection of methotrexate
Chen et al. Design of smart chemical ‘tongue’sensor arrays for pattern-recognition-based biochemical sensing applications
Ma et al. Metal complexes for the detection of disease-related protein biomarkers
Liang et al. Hydrothermal growth of nitrogen-rich carbon dots as a precise multifunctional probe for both Fe3+ detection and cellular bio-imaging
Yang et al. Synthesis of highly fluorescent lysine-stabilized Au nanoclusters for sensitive and selective detection of Cu 2+ ion
CN110437199B (en) Selenium cysteine near-infrared fluorescent probe and preparation method and application thereof
CN106083888B (en) The fluorescence probe of hydrogen sulfide in a kind of detection cancer cell
CN106442373B (en) The method and application individually or simultaneously detected for iron ion and copper ion
WO2017210928A1 (en) Fluorescent gold nanocluster-based method for detecting intracellular ros
Meng et al. An “on–off–on” fluorescence assay based on silicon nanoparticles for selective detection of manganese (II)
Ma et al. Wash-free magnetic oligonucleotide probes-based NMR sensor for detecting the Hg ion
Yuan et al. Label-free gold nanorods sensor array for colorimetric detection and discrimination of biothiols in human urine samples
CN103045720B (en) Targeting molecule for detecting pathogenic cell and application thereof
Pu et al. Recent progress in sensor arrays using nucleic acid as sensing elements
Li et al. Fluorescence-based aptasensors for small molecular food contaminants: From energy transfer to optical polarization
Wang et al. A multifunctional upconversion nanoparticles probe for Cu2+ sensing and pattern recognition of biothiols
CN110387402B (en) SERS-fluorescence dual-mode probe based on DNA strand displacement and preparation method and application thereof
CN108802360A (en) Commutative copper and one step of ceruloplasmin are detected with kit, preparation method and application simultaneously in a kind of serum
Shao et al. Rapid determination of levofloxacin in pharmaceuticals and biological fluids using a new chemiluminescence system
CN114958360A (en) Preparation method and application of nitrogen-sulfur double-doped carbon quantum dots

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant