CN107858405A - A kind of methods of measure external source dsRNA to ladybug toxic effect - Google Patents

Abstract

A kind of method the invention discloses measure external source dsRNA to ladybug toxic effect.External source dsRNA is specifically uniformly blended into Direct-fed ladybug 2~3 days after sucrose solution, then fed with acyrthosiphum pisim；Then expression quantity change of the target gene in ladybug is tested and analyzed, and observes the biology change of ladybug, to evaluate toxicity of the external source dsRNA to ladybug；The ladybug includes harmonia axyridia, coccinella septempunctata or 12 star ladybugs.This method can effectively determine direct toxic effects of the external source dsRNA to ladybugs such as harmonia axyridia, coccinella septempunctata or 12 star ladybugs, and method simple possible, validity and sensitivity are good, and the environmental risk assessment of functional study and related RNAi genetically modified crops to related gene has great importance and application prospect.

Description

A kind of methods of measure external source dsRNA to ladybug toxic effect

Technical field

The invention belongs to insect molecular biology studying technological domain.External source double-stranded RNA is determined more particularly, to one kind (dsRNA) to the method for ladybug (harmonia axyridia, coccinella septempunctata or 12 star ladybugs) toxic effect, including external source synthesis dsRNA Or surveys of the dsRNA of RNAi genetically modified crops expression to ladybug (harmonia axyridia, coccinella septempunctata or 12 star ladybugs) toxic effect Determine method.

Background technology

Core technology of the agriculture transgenic technology as Second Green Revolution, has quickly remolded the lattice of modern agriculture Office.The anti-pest crop for turning thuringiensis Bacillus thuringiensis (Bt) insecticidal protein gene for 1996 starts Commercial growth, to plantation Bt crops in 2015 country up to 28, the nearly 2,700,000,000 mu of (http of annual planting area:// www.isaaa.org/).The country for planting genetically modified crops is ranked up by the cultivated area of genetically modified crops, China is listed in After the U.S., Brazil, Argentina, India and Canada, the 6th is arranged.Central No. 1 file is emphasized within 2016, " to strengthen agricultural to turn Gene technology is researched and developed and supervision, is cautiously promoted on the basis of safety is ensured "." 13 " country that August in 2016 is printed and distributed on the 8th Scientific and technical innovation planning is clear and definite, and a series of national major scientific and technological projects including transgenosis are by Expedite the application, key skill Art will persistently capture during " 13 ", promote the industrialization of the great products such as new transgenic cotton against pests, pest-resistant corn to enter Journey.So the cultivated area of following China genetically modified crops can be increased further.

RNA interference (RNA interference, RNAi) refer to it is that species are highly conserved during evolution, by double-strand Phenomenon (the Fire et for the efficient selective degradation of homologous mRNA that RNA (double-stranded RNA, dsRNA) induces al.1998).In the past 20 years, RNAi technology and product are fast-developing, in scientific circles, industrial quarters and the public by Unprecedented concern.Agriculturally, RNAi is considered to have the control of insect new method (Gordon of application potential and Waterhouse,2007；Huvenne and Smagghe,2010).Anti-pest GM crop based on RNAi technology is Method through being proved to be effectively control Lepidoptera, coleoptera and Hemipteran pest, such as corn root leaf A Diabrotica virgifera virgifera(Baum et al.2007)；Colorado potato bug Leptinotarsadecemlineata(Zhang et al.2015)；Bollworm Helicoverpa armigera (Mao et al.2007)；Ostrinia furnacalis Ostrinia furnacalis (Wu et al.2016)；Bemisia tabaci Bemisia tabaci (Thakur et al.2014；Shukla et al.2016)；Black peach aphid Myzuspersicae (Guo et al.2014)；Wheat two Pitch aphid Schizaphis graminum (Zhang et al.2015)；Grain aphid Sitobion avenae (Xu et al.2014)；Brown paddy plant hopper Nilaparvata lugens (Zha et al.2011) etc..RNAi with good pest-resistant character turns Gene crops have been succeeded in developing, and imply that its commercial applications is possibly realized.Although current Bt crops preventing and treating Lepidoptera and elytrum Mesh insect still effectively (Wu et al.2008；Tabashnik et al.2008), but Bt crops to persistently break out in recent years for Harmful sucking pest such as aphid, leafhopper, plant hopper and aleyrodid etc. is invalid.So development RNAi genetically modified crops will be bag Include the prevention and control including this class pest and new way (Price and Gatehouse, 2008), or preventing and treating Lepidoptera and sheath are provided The Bt crops of wing mesh insect provide important rotation.

And the ecological risk about RNAi genetically modified crops is people's problem of concern before commercial applications.Wherein, with The risk assessment content of Bt crops is similar (Duan et al.2002), and RNAi anti-pest crops are potential to Siphonophora natural enemy insect Influence to also become its environmental safety assessment an important content (Lundgren and Duan, 2013；Roberts et al.2015).Harmonia axyridia Harmonia axyridis, coccinella septempunctata Coccinella septempunctata and 12 stars Ladybug Coleomegilla maculata are the very common predatory natural enemy insects of the various agricultural ecosystem, its adult and Larva can prey on a variety of aphids, coccid, wood louse, the ovum of moth class and small grub, chrysomelid larva etc..In the florescence of crop, it is also Take pollenophagous habit.So, RNAi genetically modified crops may be exposed to indirectly by feeding prey in the crop fields ladybug The dsRNA of expression；The dsRNA that crop is expressed is directly exposed to by feeding pollen.Therefore, the natural enemy class insect is used as and referred to The property shown biology has been widely used for transgenic anti-insect plants environmental safety study.However, there is presently no available for evaluating dsRNA To the technical system of the direct toxic effect of ladybug.

The content of the invention

The technical problem to be solved in the present invention is to overcome existing external source dsRNA to harmonia axyridia, coccinella septempunctata or 12 stars The shortage of the ladybug toxicity assessment technology such as ladybug and system, there is provided it is straight to ladybug to detect external source dsRNA to a kind of energy simple and sensitive The assay method of toxic effect is connect, by the way that external source dsRNA is uniformly mixed into sucrose solution Direct-fed to ladybug, is then applied Real-time fluorescence quantitative PCR (RT-qPCR) tests and analyzes the expression quantitative change of target gene different time after ladybug feeding dsRNA Change, and the biology by observing ladybug changes, to evaluate influences of the dsRNA to ladybug toxicity.

A kind of method it is an object of the invention to provide measure external source dsRNA to ladybug toxic effect.

Another object of the present invention is to provide methods described in evaluation external source dsRNA to the application in terms of ladybug toxic effect.

Above-mentioned purpose of the present invention is achieved through the following technical solutions：

A kind of measure external source dsRNA is uniformly blended into external source dsRNA after sucrose solution directly to the method for ladybug toxic effect Feeding ladybug is connect, then tests and analyzes expression quantity change of the target gene after ladybug feeding, and the biology for observing ladybug becomes Change, to evaluate toxicity of the external source dsRNA to ladybug.

Preferably, the measure external source dsRNA is that the dsRNA of external source synthesis is uniformly mixed to the method for ladybug toxic effect After entering sucrose solution, the Pediobius foveolatus 2~3 days (being preferably 2 days) of 1 day has just been hatched in feeding, is then fed with acyrthosiphum pisim, then The expression quantity change of target gene different time after ladybug feeding is tested and analyzed, and observes the biology change of ladybug, to Evaluate toxicity of the external source dsRNA to ladybug.

It is highly preferred that the measure external source dsRNA is that external source dsRNA is uniformly blended into sugarcane to the method for ladybug toxic effect The Pediobius foveolatus 2 days just hatched 1 day is fed after sugar juice, is then fed with acyrthosiphum pisim, this is treatment group；While to be mixed with arsenic The sucrose solution of sour potassium is positive control, and molten to be mixed into the sucrose for the β-glucuronidase genes dsRNA for deriving from plant Liquid is negative control；By comparing the change of target gene expression quantity in treatment group and control group ladybug, and observe statistics ladybug Biology change, to evaluate dsRNA genotoxic potential.

Preferably, the ladybug is harmonia axyridia, coccinella septempunctata and/or 12 star ladybugs.

Furthermore it is preferred that final concentration of the 10~15% of above-mentioned sucrose solution.

It is highly preferred that final concentration of the 10% of above-mentioned sucrose solution.

As described above, the feeding system of i.e. feeding ladybug (harmonia axyridia, coccinella septempunctata or 12 star ladybugs) is：To just The Pediobius foveolatus of hatching 1 day provides 2 days 10% sucrose solutions for being mixed with dsRNA, feeds ladybug using acyrthosiphum pisim afterwards.It is specific to raise Feed method be：The sucrose solution for being mixed with dsRNA is placed in container, there is provided the 2 days solution；Then the broad bean covered with acyrthosiphum pisim Seedling is cut into section and is put into culture dish, enough supplies.

As a kind of specific case study on implementation, specific feeding method is：2 μ l are mixed with dsRNA sucrose solution liquid-transfering gun A diameter of 5cm is placed in, in a height of 1.3cm culture dish, there is provided 2 days totally 4 μ l sucrose solution；Then the silkworm covered with acyrthosiphum pisim Bean seedlings are cut into section and are put into culture dish, enough supplies.

As a kind of reference case, dsHA, dsCS or dsCM that above-mentioned external source dsRNA is not synthesized in vitro, sequence is respectively such as Shown in table 1.

Furthermore it is preferred that in the positive control (sucrose solution for being mixed with Macquer's salt) concentration of Macquer's salt for 50~ 100ng/μl。

It is highly preferred that the concentration of Macquer's salt is 100ng/ μ l in the positive control (sucrose solution for being mixed with Macquer's salt).

Preferably, said determination is at 23 DEG C, 50% RH, illumination 14L:Carried out in 10D incubator.Each processing test 30 first 1 instar larvaes are tested for gene expression dose, and experiment is repeated 3 times.

Preferably, the assay method of the expression quantity change of the target gene is：Take respectively within 3,5,7,9 days after feeding Ladybug (harmonia axyridia, coccinella septempunctata or 12 star ladybugs) sample, 5 larvas collect 3 as a sample, each time point Biology repeated sample, the analysis of target gene expression quantity change is carried out using RT-qPCR.Wherein, target gene and internal reference base The RT-qPCR primers of cause are as shown in table 2.

Preferably, the biological parameter is survival rate and development duration.Specific 9 points and at night 9 points of every morning is respectively seen Examine 1 time.Test is at 23 DEG C, 50% RH, illumination 14L:Carried out in 10D incubator.

In addition, the above method is evaluating external source dsRNA to ladybug (harmonia axyridia, coccinella septempunctata or 12 star ladybugs) toxicity Application in terms of influence, also should be within protection scope of the present invention.

The invention has the advantages that：

The invention provides one kind measure external source dsRNA to the ladybugs such as harmonia axyridia, coccinella septempunctata or 12 star ladybugs poison Property the method that influences, after external source dsRNA is uniformly blended into after sucrose solution Direct-fed Pediobius foveolatus 2 days, then raised with acyrthosiphum pisim Hello；Then expression quantity change of the target gene after ladybug feeding is tested and analyzed, and observes the biology change of ladybug, to comment Toxicity of the external source dsRNA to ladybug described in valency.This method can effectively determine direct toxic effects of the external source dsRNA to ladybug, And method simple possible, validity and sensitivity are good, the research and related RNAi genetically modified crops to related gene function Environmental risk assessment has great importance and application prospect.

Brief description of the drawings

Fig. 1 is 3,5,7,9 day after the feeding dsRNA of embodiment 1, the express spectra of v-ATPaseA genes in harmonia axyridia body； RP49 and GAPDH is as reference gene (table 1), the table of v-ATPaseA genes in undressed (hatching 1 day) harmonia axyridia It is arranged to 1 up to amount；Value in figure is average value+standard error, and different letters represents the expression between treatment group and control group Measurer there were significant differences (P<0.05).

Fig. 2 is the treatment group and the harmonia axyridia survival rate of control group after the feeding dsRNA of embodiment 1；Value in figure is flat Average+standard error, different letters represent that the expression quantity between treatment group and control group has significant difference (P<0.05).

Fig. 3 is influence of the feeding dsRNA of embodiment 1 to harmonia axyridia development duration；Different letters represent treatment group and Expression quantity between control group has significant difference (P<0.05).

Fig. 4 is 3,5,7,9 day after the feeding dsRNA of embodiment 2, the express spectra of v-ATPaseA genes in coccinella septempunctata body； EF1A and Actin are as reference gene；The expression quantity of v-ATPaseA genes in undressed (hatching 1 day) coccinella septempunctata It is set to 1；Value in figure is average value+standard error；Different letters represents the expression measurer between treatment group and control group There were significant differences (P<0.05).

Fig. 5 is the treatment group and the coccinella septempunctata survival rate of control group after the feeding dsRNA of embodiment 2；Value in figure is flat Average+standard error, different letters represent that the expression quantity between treatment group and control group has significant difference (P<0.05).

Fig. 6 is influence of the feeding dsRNA of embodiment 2 to the age of coccinella septempunctata 1 and 2 age development durations；Different letter expressions Expression quantity between treatment group and control group has significant difference (P<0.05).

Fig. 7 is 3,5,7,9 day after the feeding dsRNA of embodiment 3, the expression of v-ATPase A genes in 12 star ladybug bodies Spectrum；EF1A and Actin are as reference gene；The table of v-ATPaseA genes in undressed (hatching 1 day) 12 star ladybugs 1 is set to up to amount；Value in figure is average value+standard error；Different letters represents the expression between treatment group and control group Measurer there were significant differences (P<0.05).

Fig. 8 is the treatment group and 12 star ladybug survival rates of control group after the feeding dsRNA of embodiment 3；Value in figure is Average value+standard error, different letters represent that the expression quantity between treatment group and control group has significant difference (P<0.05).

Fig. 9 is influence of the feeding dsRNA of embodiment 3 to the age of 12 star ladybug 1 and 2 age development durations；Different alphabets Show that the expression quantity between treatment group and control group has significant difference (P<0.05).

Embodiment

The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention Limit in any form.Unless stated otherwise, the reagent of the invention used, method and apparatus routinely try for the art Agent, method and apparatus.

Unless stated otherwise, following examples agents useful for same and material are purchased in market.

Embodiment 1

The present embodiment is using harmonia axyridia as research object, by taking its v-ATPaseA gene as an example, studies the method for the invention For determining external source dsRNA to the direct toxic effect of ladybug.

A kind of detection external source dsRNA of simple and sensitive passes through an external conjunction to the assay method of the direct toxic effect of ladybug Into dsHA or dsCS or dsCM be uniformly mixed into sucrose solution and feed the acyrthosiphum pisim that abundance to ladybug 2 days, is then provided, with The sucrose solution for being mixed into Macquer's salt is positive control, and the sucrose solution to be mixed into dsGUS is handled as negative control by comparing The change of v-ATPaseA gene expression amounts in group and control group ladybug, and the important biomolecule such as ladybug survival rate, development duration The Assessment of Changes dsRNA of parameter genotoxic potential.

Embodiment 2

Using coccinella septempunctata as research object, remaining is studied the present embodiment with embodiment 1.

Embodiment 3

Using 12 star ladybugs as research object, remaining is studied the present embodiment with embodiment 1.

Specifically, the specific research assay method of above-described embodiment 1~3 is as follows：

1st, design external source dsRNA (sequence is as shown in table 1)：

(1) be made up of the nucleotides shown in table 1 and the nucleotides shown in its reverse complementary sequence dsRNA (dsHA, DsCS, dsCM)；

(2) dsRNA (dsGUS) being made up of the nucleotides shown in the nucleotides shown in table 1 and its reverse complementary sequence；

Table 1dsRNA sequences

Primer	Sequence 5 ' -3 ' (wherein T7=TAATACGACTCACTATAGGG)	Sequence number
			dsHA-F	TAATACGACTCACTATAGGGAGATCTCTTTTCCCATGTGTCCA	SEQIDNO.1
dsHA-R	TAATACGACTCACTATAGGGAGAGCATCTCGGCCAGAC	SEQIDNO.2
			dsCS-F	TAATACGACTCACTATAGGGAGATCCCTTTTCCCATGTGT	SEQIDNO.3
dsCS-R	TAATACGACTCACTATAGGGAGAGCATCTCGGCCAGAC	SEQIDNO.4
			dsCM-F	TAATACGACTCACTATAGGGAGATCTCTTTTCCCATGT	SEQIDNO.5
dsCM-R	TAATACGACTCACTATAGGGAGAGCATCTCGGCCAGAC	SEQIDNO.6
			dsGUS-F	TAATACGACTCACTATAGGGAGAGGGCGAACAGTTCCTGATTA	SEQIDNO.7
dsGUS-R	TAATACGACTCACTATAGGGAGAGGCACAGCACATCAAAGAGA	SEQIDNO.8

2nd, the structure of toxicity test system

Establish direct toxicity of the measure external source dsRNA to tested insect, it is necessary first to a suitable method is found, DsRNA is fed to tested insect.The habit of sucrose solution is sucked based on ladybug, we have developed one based on sucrose solution Ladybug feed.In the feeding system, 2 days sucrose solutions for being mixed with dsRNA are provided to the ladybug just hatched 1 day, afterwards Ladybug is fed using acyrthosiphum pisim.Acyrthosiphum pisim provides method and provided for the broad bean seedling covered with acyrthosiphum pisim is cut into section, enough supplies.

System is fed based on the ladybug established, establishes the measure system that external source dsRNA influences on ladybug, determines system Including following processing：1) negative control is handled：DsGUS sucrose solution is mixed into as negative control, dsRNA total amounts are 16 μ g； 2) dsHA or dsCS or dsCM sucrose solution are mixed into, dsRNA total amounts are 16 μ g；3) sucrose solution of Macquer's salt is mixed with as sun Property control, the concentration of Macquer's salt is 100ng/ μ l.Pass through established measure system, the known Macquer's salt poisonous to ladybug is equal It is even to be mixed into sucrose solution, ladybug, influence of the research Macquer's salt to ladybug biology are fed according to the method described above；It is to verify Whether the validity and sensitivity of the ladybug toxicity test method of foundation, i.e. test system can show the toxicity of test-compound.

For each ladybug, each processing tests about 30 first 1 instar larvaes and tested for gene expression dose, experiment weight Answer 3 times.3,5,7,9 days difference insect-takings after feeding dsRNA, 5 conducts, one sample, each time point collect 3 lifes Thing repeated sample, research (v-ATPaseA genes and the internal reference of v-ATPaseA gene expression amount changes are carried out using RT-qPCR The RT-qPCR primers of gene are as shown in table 2).Test is at 23 DEG C, 50% RH, illumination 14L：Carried out in 10D incubator.Obtain After obtaining data, using suitable biological statistical method com-parison and analysis treatment group and negative control group ladybug difference v-ATPaseA bases Because of the difference of expression quantity.

Table 2RT-qPCR primers

For each ladybug, each processing tests about 30 first 1 instar larvaes and is used to observe biological characteristics change experiment, Experiment is repeated 3 times.Biological parameter index includes survival rate and development duration.9 points of every morning and at night 9 points of each observations 1 It is secondary.Experiment is at 23 DEG C, 50% RH, illumination 14L：Carried out in 10D incubator.After obtaining data, united using suitable biology Meter method com-parison and analysis treatment group and the difference of negative control group ladybug difference life parameters.

3rd, result is found, all harmonia axyridias individual, is contained in its feeding positive control in Macquer's salt sucrose solution 2 days It is all dead.Show that provided ladybug toxic effect measure system has very high sensitivity, can be effectively used for detecting external source Potential negative effects of the dsRNA to ladybug.

And simultaneously, feeding contain external source dsRNA (dsHA or dsCS or dsCM) sucrose solution treatment group and feminine gender it is right According to (dsGUS) result respectively as shown in Fig. 1~9, the results showed that：Using external feeding dsRNA method, ladybug body can be suppressed The expression of interior v-ATPaseA genes, ladybug is caused to produce lethal effect.Also demonstrate the validity of the inventive method and sensitive Property.

4th, to sum up experimental result can be drawn to draw a conclusion：

(1) external source dsRNA can be passed to ladybug by the feeding system that the present invention is established, sucrose solution as carrier (harmonia axyridia, coccinella septempunctata or 12 star ladybugs)；

(2) established ladybug (harmonia axyridia, coccinella septempunctata or 12 are demonstrated as positive control by using Macquer's salt Star ladybug) toxicity test method validity and sensitivity；

(3) the invention provides a kind of simple possible, can effectively determine external source dsRNA to ladybug (harmonia axyridia, seven-star wooden dipper Worm or 12 star ladybugs) toxic effect test method.

Sequence table

<110>Agricultural University Of South China

<120>A kind of methods of measure external source dsRNA to ladybug toxic effect

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 43

<212> DNA

<213> dsHA-F(dsHA-F)

<400> 1

taatacgact cactataggg agatctcttt tcccatgtgt cca 43

<210> 2

<211> 38

<212> DNA

<213> dsHA-R(dsHA-R)

<400> 2

taatacgact cactataggg agagcatctc ggccagac 38

<210> 3

<211> 40

<212> DNA

<213> dsCS-F(dsCS-F)

<400> 3

taatacgact cactataggg agatcccttt tcccatgtgt 40

<210> 4

<211> 38

<212> DNA

<213> dsCS-R(dsCS-R)

<400> 4

taatacgact cactataggg agagcatctc ggccagac 38

<210> 5

<211> 38

<212> DNA

<213> dsCM-F(dsCM-F)

<400> 5

taatacgact cactataggg agatctcttt tcccatgt 38

<210> 6

<211> 38

<212> DNA

<213> dsCM-R(dsCM-R)

<400> 6

taatacgact cactataggg agagcatctc ggccagac 38

<210> 7

<211> 43

<212> DNA

<213> dsGUS-F(dsGUS-F)

<400> 7

taatacgact cactataggg agagggcgaa cagttcctga tta 43

<210> 8

<211> 43

<212> DNA

<213> dsGUS-R(dsGUS-R)

<400> 8

taatacgact cactataggg agaggcacag cacatcaaag aga 43

<210> 9

<211> 22

<212> DNA

<213> HA v-ATPase A RT-qPCR F(HA v-ATPase A RT-qPCR F)

<400> 9

gagttgggtc ctggtattat gg 22

<210> 10

<211> 22

<212> DNA

<213> HA v-ATPase A RT-qPCR R(HA v-ATPase A RT-qPCR R)

<400> 10

agttctggac aaacaaggta ca 22

<210> 11

<211> 20

<212> DNA

<213> HA RP49 RT-qPCR F(HA RP49 RT-qPCR F)

<400> 11

gccgtttcaa gggacagtat 20

<210> 12

<211> 22

<212> DNA

<213> HA RP49 RT-qPCR R(HA RP49 RT-qPCR R)

<400> 12

tgaatccagt aggaagcatg tg 22

<210> 13

<211> 20

<212> DNA

<213> HA GAPDH RT-qPCR F(HA GAPDH RT-qPCR F)

<400> 13

tgactacagt tcacgcaacc 20

<210> 14

<211> 23

<212> DNA

<213> HA GAPDH RT-qPCR R(HA GAPDH RT-qPCR R)

<400> 14

gatgactttg gttacagcct ttg 23

<210> 15

<211> 22

<212> DNA

<213> CS v-ATPase A RT-qPCR F(CS v-ATPase A RT-qPCR F)

<400> 15

ccgtcatctc ccaatctctt tc 22

<210> 16

<211> 22

<212> DNA

<213> CS v-ATPase A RT-qPCR R(CS v-ATPase A RT-qPCR R)

<400> 16

cggtttgacc ttcgatctct ac 22

<210> 17

<211> 21

<212> DNA

<213> CS EF1A RT-qPCR F(CS EF1A RT-qPCR F)

<400> 17

cctgaagtgg aagacgaaga g 21

<210> 18

<211> 22

<212> DNA

<213> CS EF1ART-qPCR R(CS EF1ART-qPCR R)

<400> 18

agaaggaaag gctgatggta aa 22

<210> 19

<211> 22

<212> DNA

<213> CS Actin RT-qPCR F(CS Actin RT-qPCR F)

<400> 19

gcgtaacctt cgtagattgg ta 22

<210> 20

<211> 22

<212> DNA

<213> CS Actin RT-qPCR R(CS Actin RT-qPCR R)

<400> 20

caagctgtac tctccctgta tg 22

<210> 21

<211> 21

<212> DNA

<213> CM v-ATPase A RT-qPCR F(CM v-ATPase A RT-qPCR F)

<400> 21

ttgactggag gcgacattta c 21

<210> 22

<211> 22

<212> DNA

<213> CM v-ATPase A RT-qPCR R(CM v-ATPase A RT-qPCR R)

<400> 22

cttccaggtt cggctatgta tg 22

<210> 23

<211> 21

<212> DNA

<213> CM EF1A RT-qPCR F(CM EF1A RT-qPCR F)

<400> 23

tgaattcgaa gccggtatct c 21

<210> 24

<211> 20

<212> DNA

<213> CM EF1ART-qPCR R(CM EF1ART-qPCR R)

<400> 24

cgccgacaat gagttgtttc 20

<210> 25

<211> 21

<212> DNA

<213> CM Actin RT-qPCR F(CM Actin RT-qPCR F)

<400> 25

cttcccgacg gtcaagttat c 21

<210> 26

<211> 21

<212> DNA

<213> CM Actin RT-qPCR R(CM Actin RT-qPCR R)

<400> 26

gcaggattcc atacccaaga a 21

Claims (10)

1. a kind of measure external source dsRNA is to the method for ladybug toxic effect, it is characterised in that external source dsRNA is uniformly blended into sugarcane Direct-fed ladybug after sugar juice, expression quantity change of the target gene in ladybug is then tested and analyzed, and observe the life of ladybug Thing changes, to evaluate toxicity of the external source dsRNA to ladybug.

2. according to the method for claim 1, it is characterised in that fed just after external source dsRNA is uniformly blended into sucrose solution The Pediobius foveolatus of hatching 1 day is fed after 2~3 days, then with acyrthosiphum pisim, and it is different after ladybug feeding then to test and analyze target gene The expression quantity change of time, and the biology change of ladybug is observed, to evaluate toxicity of the external source dsRNA to ladybug.

3. according to the method for claim 1, it is characterised in that fed just after external source dsRNA is uniformly blended into sucrose solution Just the Pediobius foveolatus of hatching 1 day is fed after 2 days, then with acyrthosiphum pisim, and this is treatment group；While to be mixed with the sucrose solution of Macquer's salt For positive control, and plant is derived to be mixed intoβ-glucuronidaseGene dsRNA sucrose solution is negative control； By comparing the change of target gene expression quantity in treatment group and control group ladybug, and the biology change of statistics ladybug is observed, To evaluate dsRNA genotoxic potential.

4. according to any described method of claims 1 to 3, it is characterised in that the ladybug is harmonia axyridia, coccinella septempunctata And/or 12 star ladybug.

5. according to any described method of claims 1 to 3, it is characterised in that final concentration of the 10 of the sucrose solution~ 15%。

6. according to the method for claim 3, it is characterised in that the concentration of Macquer's salt is 50~100 in the positive control ng/μl。

7. according to any described method of claims 1 to 3, it is characterised in that measure is at 23 DEG C, 50% RH, illumination 14 L:Carried out in 10 D incubator.

8. according to any described method of claims 1 to 3, it is characterised in that the survey of the expression quantity change of the target gene The method of determining is：Ladybug sample is taken respectively within 3,5,7,9 days after feeding dsRNA is started, target gene table is carried out using RT-qPCR Up to the analysis of amount change.

9. according to any described method of claims 1 to 3, it is characterised in that the biology is survival rate and development duration.

10. any methods described of claim 1~9 is in evaluation external source dsRNA to the application in terms of ladybug toxic effect.