CN107858354B - MiRNA related to blast disease resistance and application thereof - Google Patents

Abstract

The invention discloses miRNAs related to blast disease resistance, which have a nucleotide sequence shown as SEQ ID NO:1, wherein the expression quantity of the miRNAs is negatively related to the expression quantity of rice blast resistance genes Pik2-H4, and a new rice blast resistance variety can be constructed by inhibiting the expression of the miRNAs.

Description

MiRNA related to blast disease resistance and application thereof

Technical Field

The invention relates to miRNAs, in particular to miRNAs related to rice blast resistance and application of the miRNAs in rice blast resistance.

Background

Rice (Oryza sativa L.) is of the most important grain crops in the world, about 50% of people in the world use rice as staple food, with the increase of the population, the demand of the grain will increase year by year, the rice blast caused by the rice blast fungus (Magnaporthe oryzae) is of the main limiting factor of the rice production, the grain production in the world is seriously threatened, the yield loss caused by the rice blast in the world reaches 11% -30% every year, the rice blast can occur in the whole growth period of the rice, and the huge loss is often caused in the rice area.

However, due to the genetic complexity and the changeability of the microspecies of the rice blast fungus, newly bred disease-resistant varieties lose resistance due to the formation of dominant microspecies which can infect the varieties after being extrapolated -5 years, so that the utilization value of the varieties is lost, so that different strategic tactics are proposed to cultivate rice varieties with durable resistance, is that disease-resistant genes with different resistance spectrums are polymerized into rice varieties by using Molecular markers to prevent the disease resistance from deteriorating, the selection pressure of a single is reduced, and the step is carried out by using Molecular-assisted selection (MAS) to breed, therefore, searching and using a new source with spectrums and durable resistance, cultivating new resistant varieties by combining a new technology, and combining a reasonable cultivation layout is a main way for solving the problem of that the service life of rice blast resistant varieties is short.

The miRNA is a endogenous micromolecule non-coding RNA with the length of 19-24 bases, is a negative regulatory factor in eukaryotic gene expression, can regulate the expression of plant genes in a mode of completely or partially matching with target gene mRNA molecules, and can be used for guiding mRNA shearing or inhibiting translation and the like, and is involved in biological processes such as regulation of various aspects of plant growth and development and adverse environment stress response in research on plant miRNA, more miRNAs are identified in model plants Arabidopsis thaliana and rice, a plurality of miRNAs related to rice growth and development, adverse environment stress and the like are identified by constructing miRNA cDNA library, large-scale sequencing, bioinformatics and the like, more than 700 rice miRNA sequences are found in miRBase database, miR160 et al, miR a, miR 67164 and miR168a are remarkably induced to be expressed by rice blast bacteria, miR396, miR827 and miR1 and the like, miR169, miR172, miR 35398 and miR b in disease-resistant materials and pathogenic materials are expressed as miRNA (miR Y, miR) of rice blast bacteria, miR breech, miR 12, miR 35398, miR 12, miR 12, miR-9 gene expression of rice straw blight gene and miR 12, miR-apple gene and miR 12, and miR 12 can be involved in disease-resistant materials such as a resistance of a target plant gene expression of a plant gene, and a plant gene expression of a plant gene, and a resistance of a plant gene, and a resistance of a gene, and a resistance of a plant gene such as a resistance of a gene, a gene of a gene, a pathogen such as a gene, a gene of a gene, a gene of a resistance of a gene, a gene of a Solanum, a gene, a Solanum, a gene, a Solanum, a gene, a resistance of a gene, a resistance of a, a resistance of a gene, a gene of a gene, a resistance of a gene, and a gene, a gene.

The research shows that the regulation of miRNA and the disease-resistant reaction ways of various levels have important relation, and the miRNA can regulate and control key target genes in certain disease-resistant ways to resist the invasion of pathogenic bacteria, on the contrary, pathogenic bacteria are used for resisting, and the bacteria can also be like virus , so effector molecule proteins are evolved to inhibit miRNA passages and weaken the disease resistance of plants.

Disclosure of Invention

In order to solve the technical problems, the invention provides miRNAs related to rice blast resistance and derived from rice, and provides application of the miRNAs in cultivation of new rice blast resistance varieties, and expression of target genes Pik2-H4 is improved by inhibiting the expression of the miRNAs, so that the resistance of the rice to rice blast bacteria is improved.

The miRNA related to the rice blast resistance is marked as T46 and has a sequence shown as SEQ ID NO. 1.

The invention also provides a precursor sequence of the rice blast resistance related miRNA, which has a sequence shown as SEQ ID NO. 2.

The miRNA or the precursor sequence thereof can regulate and control rice blast-resistant gene expression. Experiments prove that when rice is infected by rice blast germs, the expression quantity of the miRNA shows a down-regulation trend.

The target gene of the miRNA, namely the rice blast resistance gene is NBS-LRR resistance genes which are located at Pik sites, wherein the Pik2-H4 is NBS-LRR resistance genes, and the Pik sites comprise Pik1 and Pik2 genes which are unavailable for mediating rice blast resistance .

The invention also provides application of the miRNA or the precursor sequence thereof in cultivating rice blast resistance rice. Since the target gene of T46 is Pik2-H4, the expression level of T46 is inversely related to the expression level of Pik 2-H4. When the R gene mediates disease resistance reaction, a large amount of Pik2-H4 expression is needed to enable the rice to express disease resistance. The Pik2-H4 is expressed at a high level continuously, and the rice shows autoimmunity and even high resistance, so that after the T46 is over-expressed, the expression level of Pik2 is reduced, and the rice loses resistance; conversely, if T46 is knocked out, the target gene expression is at a higher level, indicating higher resistance. The disease resistance of transgenic plants after overexpression of T46 or knockout of precursors of T46 in rice shows that the rice is more susceptible to diseases due to overexpression of T46, and the rice has better resistance to rice blast due to the fact that knockout of T46 inhibits the expression of T46 genes.

The invention utilizes the fluorescent quantitative PCR result to show that miRNA-T46 is regulated by rice blast germs, the expression amount shows a down-regulation trend, the target gene Pik2-H4 shows an up-regulation expression trend after the rice blast germs are infected, the two show negative correlation, the step proves the regulation relation between T46 and Pik2-H4, which shows the important function of T46 in the rice blast resistance regulation process, the invention transforms the over-expression vector of rice T46 into agrobacterium tumefaciens infected Pik-H4NIL tissue, the result of disease resistance analysis of the obtained transgenic plant shows that the over-expression T46 obviously reduces the rice blast resistance of the rice, and the step shows the important regulation function of T46 on Pik2-H4, which lays an important foundation for the follow-up research.

According to the invention, a CRISPR/Cas9 knockout vector for knockout of miRNA-T46 is constructed, and the vector plasmid is transformed into a callus of Agrobacterium tumefaciens infected Pik-H4NIL to obtain a positive plant. And detecting positive plants by using fluorescent quantitative PCR and verifying the knocked-out plants by using DNA sequencing. The disease resistance analysis of the obtained transgenic rice shows that the transgenic rice plant can obviously improve the resistance to rice blast and has better application prospect.

Drawings

FIG. 1 is an analysis result of real-time fluorescent quantitative PCR on the expression pattern of miRNA-T46 infected by Magnaporthe grisea, and the result shows that the expression of miRNA-T46 in H4 is obviously reduced, which indicates that the miRNA-T46 plays an important role in the rice blast resistance process;

FIG. 2 is an expression pattern of target genes Pik2-H4 after rice is infected by Magnaporthe grisea, results show that the change of expression levels of Pik2-H4 is negatively correlated, and the step proves that miRNA-T46 negatively regulates target genes Pik 2-H4;

FIG. 3 is a schematic diagram of the cleavage and cleavage sites of miRNA-T46 on the target gene Pik2-H4, the cleavage sites being located in the 3' untranslated region;

FIG. 4 shows the determination of disease resistance of transgenic material with over-expression (T46-OX) and deletion of T46(T46-ko), and the results show that the over-expression of miRNA-T46 promotes the infection of rice blast bacteria, while the deletion has higher disease resistance.

Detailed Description

The invention provides miRNA-T46 related to rice blast resistance, which is obtained from rice small RNA sequencing and has a sequence shown in SEQ ID NO. 1.

The invention utilizes two anti-infection rice materials (H4 and Zhongdi soft occupation) to research and prove that the target gene of T46 is Pik2 (the nucleotide sequence is shown as SEQ ID NO: 3), wherein H4 contains Pik2-H4 resistance genes, so that T46 is very likely to target and regulate Pik 2-H4. to verify the assumption of , the invention adopts PCR to detect the expression condition of T46 in the rice material after the rice blast germ is inoculated, and the result shows that the expression quantity of T46 is generally expressed as the trend of rising first and then falling in H4, the expression quantity is lowest 24 hours after inoculation, the expression quantity difference of T46 is obvious at each time point after inoculation, which is just opposite to the expression quantity change of the target genes Pik2-H4, the step shows that the expression quantities of T46 and Pik2-H4 are in Zhongdi soft occupation, while the expression quantity of T46 is also changed as the trend of rising first and falling first and then not obvious.

The invention also provides a precursor sequence Pre-T46 of the miRNA in the technical scheme, the sequence is shown as SEQ ID NO. 2, the miRNA is also induced and expressed by rice blast, the miRNA has a similar expression mode with T46, the research on the expression regulation of Pre-T46 reflects the change of the expression level of T46 to a certain extent in , and the research on Pre-T46 reflects the expression condition of the corresponding product miRNA.

The invention also provides application of the miRNA or the precursor sequence thereof in cultivating rice blast resistance rice. By knocking out miRNA-T46 or a precursor sequence thereof in the rice, the expression of miRNA-T46 or the precursor sequence thereof in the rice is inhibited, so that the rice blast resistance of the rice is improved, and a new rice variety with high rice blast resistance is cultivated.

The present invention will be described in detail with reference to examples for better understanding the objects, technical solutions and advantages of the present invention, but they should not be construed as limiting the scope of the present invention.

Example 1

Real-time fluorescent quantitative PCR analysis of function of miRNA-T46 in rice blast resistance

Primer design for RNA reverse transcription and real-time quantitative PCR

Designing a Stem-loop primer according to a precursor sequence predicted by a miRNA sequence as follows:

(1) RT primer sequence (SEQ ID NO:4)

5’-CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCCCTCAT-3’

(2) miRNA-T46 forward primer (SEQ ID NO:5)

5’-GCCGCGAAGAACTGTTACAG-3’

(3) miRNA-T46 reverse primer (SEQ ID NO:6)

5’-AACTGGTGTCGTGGAGT-3’

(4) Pik2-H4 Forward primer (SEQ ID NO:7)

5’-TGAACTTCCACGATTGGATCCAC-3’

(5) Pik2-H4 reverse primer (SEQ ID NO:8)

5’-ACATGGTTCTTGAATACATCATGTC-3’

2. Cultivation of materials and infection of rice blast

The test rice material is a middle-two soft occupation (ZE) and a mutant H4 strain of the middle-two soft occupation subjected to space-carried mutagenesis, H4 is a spectrum and high-resistance rice high-quality germplasm resource obtained through ground breeding, has high resistance to rice blast, and is disclosed in the document 'cloning of rice blast-resistant protein Pik2-H4 genes and screening of interaction proteins' J ]. eastern agricultural science, 2004, (04): 156. 160 >.

Planting H4 in greenhouse and middle-two soft-layer, uniformly spraying gelatin solution of rice blast spore GD0193 on the surface of leaf by high-pressure spraying method in three-leaf period (conidium concentration is 5 × 10)⁵And/ml), inoculating seedlings, keeping the seedlings moist for 24 hours in a dark room at 25 ℃, keeping the moisture under a shady shed, investigating the disease condition after 7 days, and taking a picture.

3. The extraction method of the total RNA of the rice by using Trizol reagent comprises the following steps:

RNA is extracted from rice leaves 0h, 12h, 24h, 48h and 72h after inoculation. The specific method comprises the following steps: taking 100mg of rice seedlings with medium-second soft occupation and H4 four-leaf stage, freezing the rice seedlings with liquid nitrogen, grinding the rice seedlings into powder in a mortar, transferring the powder into a 1.5mL centrifuge tube filled with 1mL of Trizol (Invitrogen company), uniformly mixing, standing for 5min, adding 200 mu l of chloroform, uniformly mixing, standing for 5min, centrifuging for 15min at 4 ℃ of 10000g, and collecting an upper aqueous phase into a new 1.5mL centrifuge tube; adding 500 μ l precooled isopropanol, mixing, standing at room temperature for 20min, centrifuging at 4 deg.C and 10000g for 15min, discarding supernatant, collecting precipitate, washing with 75% alcohol to remove impurities, volatilizing alcohol, dissolving in ultrapure water without RNase, and freezing at-80 deg.C.

4. Reverse transcription and reverse transcription system

Ordinary quantitative reverse transcription: mu.g of total RNA sample stored at-80 ℃ was sampled and 1. mu.l of Oligo (dT) was added₁₆) (10mM) using RNA freeWater was mixed to a total volume of 12. mu.l, mixed and placed in a water bath at 65 ℃ for 5min, immediately placed on ice, and 4. mu.l of 5 XT buffer, 2. mu.l of dNTP (10mM), 1. mu.l of RNase inhibitor (10U/. mu.l) and 1. mu.l of ReverTra Ace were added to the EP tube and mixed, the EP tube was placed in a PCR apparatus, and the reaction procedures were set to 30 ℃ for 10min, 42 ℃ for 60min, 99 ℃ for 5min and 25 ℃ for 5min to obtain th strand single cDNA, which was stored in a refrigerator at-20 ℃.

Reverse transcription of miRNA: mu.g of DNase-treated RNA was taken, 1.5. mu.l of primer mixture (0.25. mu.l of RT primer, 0.25. mu.l of dNTP and 1. mu.l of DEPC. were added and centrifuged slightly, incubated at 65 ℃ for 5min, immediately placed on ice for 3 min. 1. mu.l of superscript III was prepared as a mixture, 1.8. mu.l of mixture was added to each tube, centrifuged, and placed on a PCR instrument following the procedure of 16 ℃ for 30min, 50 ℃ for 30min, 85 ℃ for 5min, 25 ℃ for 1min, the reverse transcription product was placed at-20 ℃ overnight, or immediately subjected to quantitative analysis.

5. Real-time fluorescent quantitative PCR and result analysis:

(1) real-time quantitative PCR reaction system

The quantitative reagent of Novovoxam company is selected to quantify miRNA, and the reaction system is as follows: 10 μ L of AceQ qPCRSYBR Green Master Mix, 0.8 μ L of 10 μ M primer (the primer sequences shown by sequence 5 and sequence 6 when detecting miRNA-T46; and the primer sequences shown by sequence 7 and sequence 8 when detecting Pik 2-H4), 0.4 μ L of ROX Reference Dye1, and 0.2 μ L of cDNA and 6 μ L of sterile water form a 20 μ L reaction system for quantitative detection. The quantitative PCR instrument was set up for 40 cycles at 95 ℃ for 5min, 95 ℃ for 10sec, 60 ℃ for 30 sec. U6RNA as an internal reference Gene, 2^-ΔΔCTThe method performs a relatively quantitative analysis. All reactions were performed in triplicate.

(2) Analysis of results Using 2^-ΔΔCtThe method carries out analysis of the results

Referring to FIGS. 1 and 2, the results of real-time fluorescent quantitative PCR analysis show that the expression of miRNA-T46 is regulated by Magnaporthe grisea, the expression level of miRNA-T46 shows a down-regulation trend after the Magnaporthe grisea is infected by Magnaporthe grisea, and Pik2-H4 shows an up-regulation expression trend after the Magnaporthe grisea is infected by Magnaporthe grisea, and the two trends show negative correlation. This shows that inhibition or overexpression of T46 in rice will affect the rice resistance to Magnaporthe grisea, and there is a regulatory relationship between miRNA-T46 and Pik 2-H4. Shows the important function of miRNA-T46 in the rice blast resistance regulation process.

Example 2

Verification of miRNA-T46 target Gene verification of cleavage site of T46 target Gene Pik2-H4 by 5' RACE method

1.5' RACE primer design as follows:

Reverse primer:(SEQ ID NO:9)

5’–CTTCGGCACTAAAGGTGCAAAGGATTACGCCAAGCTT–3’。

RNA extraction was performed as in example 1.

3.5' RACE experiment

(1) Connecting an RNA joint:

choose to use

RACE5 '/3' Kit (Clontech) RACE experiments were performed using the reverse transcription system as follows, according to the instructions: 1.0-10. mu.l of RNA, 1.0. mu.l of 5' -CDS Primer A, and 0-9. mu.l of sterile water, in a total of 11. mu.l, are mixed well. Putting the sample into a water bath kettle, carrying out water bath at 72 ℃ for 3min, taking out the sample, carrying out ice bath for 2min, cooling, adding 1 mu L of SMARTer II AOligonucleotide, and mixing uniformly.

(2) Reverse transcription into cDNA

The linker RNA was added to 4.0. mu.l of 5 Xfirst-Strand Buffer, 0.5. mu.l of DTT (100mM),

mu.l of dNTPs (20mM), 0.5. mu.l of RNase Inhibitor (40U/. mu.l) and 2.0. mu.l of SMARTSCRIBER reverse Transcriptase (100U), and 20. mu.l of the total reaction system were placed on a PCR instrument, and the procedures were as follows, 42 ℃ for 90min, 70 ℃ for 30min and 25 ℃ for 2min, to obtain th strand cDNA.

(3) PCR amplification

And (3) PCR system: 15.5. mu.l sterile water, 25.0. mu.l 2X SeqAmp Buffer, 1.0. mu.l SeqAmp DNApolymerase, 2.5. mu.l cDNA, 5. mu.l 10X UPM, 1. mu.l GSP1 (10. mu.M).

Wherein the two primer sequences contained in the UPM are as follows:

5’–CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT–3'(SEQ ID NO:10)；

5’–GCTTCTGCCCCATCACTAACTT-3’(SEQ ID NO:11)。

the PCR reaction is as follows: 30sec at 94 ℃, 30sec at 68 ℃ and 1min at 72 ℃ for 25 cycles.

(4) Purification of PCR products

The recovery is carried out according to the method of an Omega gel purification recovery kit, and the specific method is as follows: taking the PCR product to perform 0.8% gel electrophoresis, cutting off the target fragment to be recovered, and placing the target fragment in a 1.5ml centrifuge tube. An equal volume of binding buffer XP2 was added in an amount of 1 g/100. mu.l and water bath at 55 ℃ for 10min until the gel was completely dissolved. Transferring all dissolved liquid into a HiBindDNA recovery column, centrifuging for 1min at 10000g, pouring off waste liquid in the collection tube, and reloading the recovery column into the collection tube. Add 300. mu.l XP2 again and centrifuge at 10000g for 1 min. Add 700. mu.l SPW wash solution, centrifuge at 10000g for 1min, pour off waste liquid in the collection tube, repeat 2 times. 13000g of an empty Hibind DNA recovery column was centrifuged for 2min,

and (3) reloading the Hibind DNA recovery column into a new 1.5ml centrifuge tube, adding 30 mu l of eluent, standing at room temperature for 2min, centrifuging at 13000g for 2min to elute DNA fragments, removing the recovery column, and storing at-20 ℃.

(5) Cloning of RACE products

The mixed solution is prepared according to the following method: mu.l of Linear pRACE vector (supplied by SMARTer RACE5 '/3' Kit), 7. mu.l of PCR purified product, 2. mu.l of In-Fusion HD Master Mix. Recombination reaction of RACE product and vector: water bath at 50 ℃ for 15min, then placed on ice.

Mu.l of the recombinant reaction was added to 50X competent cells, ice-cooled for 15min, heat-shocked at 42 ℃ for 55sec, ice-cooled again for 2min, then added to 450ml of SOC, placed in a shaker at 37 ℃ and shaken at 160rpm for 1 h. The shaken EP was removed, centrifuged briefly, and the single colony on the overnight plate was picked and sampled for sequencing.

(6)5' RACE results analysis

The PCR reaction can amplify specific bands of about 250bp, as shown in FIG. 3. The specific product was cloned and sequenced as follows:

the result shows that the 5 'joint sequence of the Racer kit is a partial complementary binding site of T46 and Pik2-H4 and the 3' terminal sequence thereof, and the product is a degradation product of T46 after Pik2-H4 is cut. In the sequencing result of the selected clone, the cutting site is located between 11 th and 12 th bases of miRNA, and the rest clones are located at other bases of the binding site.

Example 3

Construction of transgenic rice with over-expression T46 and knockout T46

Using pOX as an overexpression vector, and driving the overexpression of miRNA-T46 by using a UBI promoter; the miRNA-T46 knockout is carried out by using CRISPR/Cas9 technology. The method comprises the following specific steps:

1. construction of overexpression vector of miRNA-T46

The primers required were as follows:

Pre-T46F(SEQ ID NO:12)：

5’-CGGGGTACCATAGGCATCCCAATCTTTAGC-3’,

Pre-T46R(SEQ ID NO:13)：

5’-CGCGGATCCTGACGAGCCGTTATAGATGAC-3’，

the length of the amplified fragment was 958 bp. This fragment was ligated to pOX vector using Kpn I and BamHI to obtain pOX-T46 vector.

2. Knock-out vector construction of T46 precursor

Two knock-out targets were constructed, with the following primers:

U3F(SEQ ID NO:14)：5’-ggcattaagaactgttacagatg-3’，

u3r(seq id no:15)：5’-aaaccatctgtaacagttcttaa-3’，

u6af(seq id no:16)：5’-gccgagatccctaacatctataa-3’，

u6ar(seq id no:17)：5’-aaacttatagatgttagggatct-3’。

after the two pairs of primers are respectively fused with each other by self, the two pairs of primers are respectively connected to a U3 promoter and a U6a promoter by a nested PCR method, then after the two pairs of primers are cut by BsaI and DNA fragments are recovered, the two pairs of primers are connected to a pYLCRISPR/Cas9-MT (I) vector recovered by BsaI cutting, and the pYLCRISPR/Cas9-MT (I) -T46 vector containing two knockout T46 precursor target spots is obtained.

3. Construction of transgenic Rice:

inducing callus with indica rice strain H4 and mature seeds of Zhongdi soft occupation, subculturing the callus 21 days later, subculturing times for 10 days, subculturing 2 times, selecting embryogenic callus with good state for the infection of agrobacterium tumefaciens EHA105 of a carrier, culturing for 3 days in total, screening resistant callus, regenerating transgenic plants by using 50mg/L hygromycin culture medium, screening times every 2 weeks, selecting resistant callus with good state, performing 2 weeks of pre-differentiation culture, performing 2 weeks of differentiation culture, transferring differentiated seedlings to rooting culture medium, obtaining transgenic plants, performing PCR detection on hygromycin gene Hpt, and performing PCR detection on target genes to obtain transgenic plants with over-expressed T46 or knocked-out T46 precursor.

Example 4

Disease resistance analysis of transgenic rice overexpressing T46 and knocking out T46

Disease resistance was tested on transgenic progeny positive plants, and the inoculation method was as in example 1.

As shown in FIG. 4, after inoculation of Magnaporthe grisea, the lesion spots of the T46 overexpression transgenic plants are increased, the disease resistance is obviously reduced, and the resistance of the knockout plants is obviously enhanced without obvious infection lesion spots.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> southern China university of agriculture

<120> rice blast resistance-related miRNA and application thereof

<160>17

<170>SIPOSequenceListing 1.0

<210>1

<211>21

<212>DNA

<213> Rice (Oryza sativa)

<400>1

aagaactgtt acagatgagg g 21

<210>2

<211>114

<212>DNA

<213> Rice (Oryza sativa)

<400>2

tacatatgac ccctcatctg taatgattct taatctatag ccgttacaga tgagatccct 60

aacatctata atggttgtag attaagaact gttacagatg aggggtcatc tata 114

<210>3

<211>4086

<212>DNA

<213> Rice (Oryza sativa)

<400>3

atggagttgg tggtaggtgc ttccgaagcc accatgaaat ctctcttggg caagctgggc 60

aatcttctag cccaggagta tgctctcatc agcggtatcc gtggtgacat ccagtacatc 120

aatgacgagc ttgccagcat gcaggccttc ctccgtgatc tcagcaacgt gccagagggt 180

cacagtcatg gccaccggat gaaggactgg atgaagcaga tccgagacat cgcctatgat 240

gttgaggact gtatcgatga ctttgcccac cgcctccctc aggattccat cagcgatgcc 300

aaatggtcct tcctactcac aaaaatctat gaactatgga catggtggcc acgtcgtgtg 360

attgcttcca acattgccca actcaaggta cgggcacaac agatcgcaga tcgacgtagt 420

agatacggag tgaacaaccc agaacacctt gacagtagca gcagtgccag gacccgtgct 480

gtcaattacg aaattgctga gtatcaggtc acaagccctc agatcattgg tataaaggag 540

cctgtgggga tgaagacggt catggaggag cttgaggttt ggttaactaa tcctcaagct 600

gaaaatgggc aagctgttct gtccatagtc ggttttggag gtgtgggaaa gactaccatt 660

gccacagcat tgtacagaaa agtcagtgat aaatttcagt gccgggcatc agtagctgtg 720

tctcagaact atgaccaagg caaagtcctc aatagtattc tgagtcaagt cagcaatcag 780

gagcagggca gcagcacaac aattagtgag aaaaagaacc tcacctcagg cgctaagagc 840

atgttgaaga cagccctgtc actgctcaga ggtaattgta tatgtcagcc agaaaatgat 900

ggaaaccctg ataatacacc aatcaggctg caggaaacaa cggacgatga tcaaaacccc 960

agaaaactgg aacagctcct ggccgaaaag agttatatcc tcttgattga tgacatttgg 1020

tctgccgaaa catgggagag tatcagatcg attttgccta aaaataataa aggcggtaga 1080

ataatagtga ctacaagatt tcaagctgtt ggttcaacat gctcccctct tgaaactgat 1140

cgtttgcata cagttgattt tctcaccgat gacgagtccc aaaacttatt caatacaagt 1200

atttgtgaat caaagataag aaaagatagc aacaaagtag acgagcaagt ccctgaggaa 1260

atatggaaaa tatgtggggg attgcctttg gccatagtca ccatggctgg tcttgtcgcc 1320

tgcaacccaa ggaaagcctg ctgcgattgg agtaaacttt gcaaatcatt atttccagag 1380

caagaaactc ctcttaccct cgatggtgtt acaaggatac tggattgttg ttacaatgat 1440

ttgcctgcgg atctgaagac ttgcttattg tacttgagta tatttccgaa gggttggaaa 1500

attagtagga aacgtttgtc ccggcgatgg atagctgaag gttttgctaa tgagaagcaa 1560

gggttaaccc aggaaagagt tgcagaggca tactttaatc aactcacaag aaggaactta 1620

gtacgtccca tggagcatgg cagcaatggg aaggtaaaaa cgtttcaagt tcatgacatg 1680

gttcttgaat acatcatgtc caaatcaatc gaagagaatt ttattactgt ggttggtgga 1740

cactggcaga tgactgcacc aagcaataaa gtccgtcgac tgtcgatgca aagcagtgga 1800

tccaatcgtg gaagttcaac aaaaggcctg aacttggctc aagtgagatc actgacggtg 1860

tttgggaacc tgaaccatat gccattccat tcattcaact atgggataat acaggtgctg 1920

gatcttgagg actggaaggg tttgaaagag agacatatga cggagatatg tcaaatgctt 1980

ttactcaagt atttgagcat ccgacgaaca gaaatttcca aaattccctc caagattcag 2040

aaacttgagt acttggaaac tcttgacata agggagacat atgtcaggga cctgcctaag 2100

tcaatagtcc agctaaaacg gatcattagc atacttggag ggaataaaaa cacacggaag 2160

gggctgaggt tgcctcaaga aaaaagtaag aagccaatta aaaacccgtc gcctcaagga 2220

aaaacaaagg agcccgcaaa gaaaggattc ttatcccaag aaaaaggtaa aggcgcaatg 2280

aaagcactcc gtgtactgtc agggattgag attgttgagg aatcatcaga agtagctgca 2340

ggccttcatc agttgacagg gctaaggaag cttgccatat acaagctcaa tataacaaag 2400

ggtggtgata ccttcaaaca attacagtcc tccattgagt accttggcag ctgtggtctg 2460

cagactctgg ccatcaatga tgagaattct gaatttatca actcactggg cgacatgccc 2520

gcgcctccaa gatatcttgt cgcccttgag ctgtctggca agttggagaa gctacccaag 2580

tggatcacca gcatcactac tctcaacaag ctaaccatat ctgtaacagt tcttaggact 2640

gaaactttgg agatcctcca cattttacct tcattgtttt ccctcacctt cgccttttca 2700

cttagtgcag cgaagcaggatcaggacata ataaaggaca tccttgagaa taataaattg 2760

gacagtgatg gggaaatcgt cattccagct gaaggattca agagtcttaa gctgcttcgc 2820

ttctttgcac ctttagtgcc gaagctcagc tttttggaca agaatgcaat gccagcactc 2880

gaaatcattg aaatgcggtt taaagacttc gaaggtctat ttggcatcga aatccttgaa 2940

aatctccgtg aggtgcatct caaagttagt gatggggcag aagcaataac caagttcctt 3000

gtaaatgatt tgaaggttaa tactgagaaa ccaaaagtat ttgttgatgg catcgtcact 3060

gcatgagaag taaaattgct gcaaatcgga gaacttacca atcatctgag gcttcccctc 3120

tattattact ctcttagaat atattgttat tattgctcac cttgcaaaat aaaataggga 3180

tggcatagca tattgctaca acgtaccatg gttccatcat agttgatttc acttgtcatt 3240

acagtgtctg ttcagttgtg ttttctatta ataaaaggga gatctccgca agaaaccatt 3300

attatactta tattcggtta ttgaactcta taaatgatgg gattgctata tttatggtgc 3360

cacaatttcc atgagtgcgg tatttttttt tctagcagtt ggctggtgtt aagatttgtg 3420

ctgccattgc tcctctatta ttggtgccca aaattacgct ttgcactatg ttcacagttg 3480

taaaacttac ctaaatttcg tgtattagta ctgtaatgtt gtgattttcg cgtccagtta 3540

tatttttttc tttgccagaa gtttgatttc aaggtatatc tggtaagctt cagccggatt 3600

cgttaagttt ttagtttaat cagctaaact tttaacagta tgcatgcact agtttctccc 3660

gttatcttat ccaatataat taatgggcta attggatcta tgccattaca aacatggcaa 3720

gattcagaaa aatgctacta caatttgtct attcatagct gtgctagtga aattttacaa 3780

aattggaacc gtgctattga tatcacgttt tccatccatc ttttcttttt tttccttttc 3840

ttctttatcc cgtcttcttc ccgcaccgac gagaggcgag tggcggcggg accggcaagc 3900

gatggcagga cctcggcgcc ctgggtgggc gagtgaggga gagctctccc aagtgtctgc 3960

gaagctctca tcttcgtttt cctcatcccc actttgctcc tcttccacta ctgctgttga 4020

agctagcggc cctctctcac cagatctggg cggagctcaa gcgaggcgcc accaccgacg 4080

atggag 4086

<210>4

<211>43

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ctcaactggt gtcgtggagt cggcaattca gttgagccct cat 43

<210>5

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gccgcgaaga actgttacag 20

<210>6

<211>17

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

aactggtgtc gtggagt 17

<210>7

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

tgaacttcca cgattggatc cac 23

<210>8

<211>25

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

acatggttct tgaatacatc atgtc 25

<210>9

<211>37

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

cttcggcact aaaggtgcaa aggattacgc caagctt 37

<210>10

<211>45

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

ctaatacgac tcactatagg gcaagcagtg gtatcaacgc agagt 45

<210>11

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gcttctgccc catcactaac tt 22

<210>12

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

cggggtacca taggcatccc aatctttagc 30

<210>13

<211>30

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cgcggatcct gacgagccgt tatagatgac 30

<210>14

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ggcattaaga actgttacag atg 23

<210>15

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

aaaccatctg taacagttct taa 23

<210>16

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gccgagatcc ctaacatcta taa 23

<210>17

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

aaacttatag atgttaggga tct 23

Claims (5)

1. miRNA related to rice blast resistance, characterized by the nucleotide sequence as shown in SEQ ID NO. 1.
2. 2. The precursor sequence of the rice blast resistance-related miRNA of claim 1, which is characterized by the nucleotide sequence shown in SEQ ID NO. 2.
3. 3. Use of the miRNA of claim 1 or the precursor sequence of claim 2 for regulating expression of rice blast resistance gene Pik 2-H4.
4. 4. Use of the miRNA of claim 1 or the precursor sequence of claim 2 for breeding rice blast resistant rice.
5. 5. The use of claim 4, wherein the miRNA of claim 1 or the precursor sequence of claim 2 is knocked out in rice to produce rice blast resistant rice.

Images