CN107829146A

CN107829146A - Primer group for constructing 16SrRNA gene amplicon sequencing library and construction method

Info

Publication number: CN107829146A
Application number: CN201711227482.4A
Authority: CN
Inventors: 伍泳彰; 陈杰
Original assignee: Guangzhou Sagene Biotech Co ltd
Current assignee: Hunan Saizhe Zhizao Technology Co ltd
Priority date: 2017-11-29
Filing date: 2017-11-29
Publication date: 2018-03-23
Anticipated expiration: 2037-11-29
Also published as: CN107829146B

Abstract

The invention discloses a quadruple-tag primer group for constructing a 16S rRNA gene amplicon sequencing library, which consists of a first-step PCR double-tag primer pair and a second-step PCR double-tag primer pair; the sequence of an upstream primer of the first-step PCR dual-label primer pair is any one of SEQ ID NO. 1-8, and the sequence of a downstream primer is any one of SEQ ID NO. 9-20; the sequence of the upstream primer of the second PCR double-label primer pair is any one of SEQ ID NO 21-44, and the sequence of the downstream primer is any one of SEQ ID NO 45-68. According to the quadruple label primer group provided by the invention, the balanced base sequence is added, the diversity of the library is increased, the sequencing quality is improved, only a small amount of PhiX libraries need to be mixed during on-line sequencing, and staggered sequencing is carried out, so that the waste of sequencing flux is reduced, and the sequencing quality is ensured.

Description

A kind of primer sets and structure for being used to build 16S rRNA gene amplicon sequencing libraries Method

Technical field

The present invention relates to microbial gene high throughput sequencing technologies field, in particular it relates to which a kind of be used to build 16S The primer sets and construction method of rRNA gene amplicon sequencing libraries.

Background technology

With updating for sequencing technologies, microbial gene high throughput sequencing technologies have reached its maturity.Amplicon is sequenced It is a kind of targeting sequence measurement in the Genetic polymorphism region (such as 16S, 18S, ITS gene) to preserving biological heredity information, , it is necessary to first carry out target amplification to target area during Jian Ku, then PCR primer is carried out again to build storehouse sequencing.16S RRNA sequencings can be assessed multi-sample microbial species group composition lower cost, hardly be polluted by host genome Influence, but there is also following deficiency：(1) sequencing information amount region is less, in the information identification with biological meaning and explains Shortcomings；(2) need target PCR amplifications and Multi-example mixing to build storehouse before sequencing is tested, be easily introduced caused by empirical factor Result error；(3) amplicon of two-region or multi-region sequencing region is longer, and wall scroll sequence is required in bioanalysis and is disposably surveyed It is logical, it is impossible to carry out experiment and interrupt, therefore the selection to microarray dataset is more limited to, and meets that the instrument of both-end sequencing only has at present Illunima Hiseq2500 and illunima Miseq；(4) sequencing of microorganism amplification sublibrary is all the area of unified gene Domain, library fragments are long, diversity is low, often result in sequencing data low quality, two current big Mainstream Platforms, optical system The sequencing of the Ion Torrent platforms of illunima platforms and semiconductor system all suffers from hardware challenge.

In order to solve the sequencing of 16S rRNA gene amplicons in accuracy, cost, sample throughput, the quality of data etc. The problem of, to promote the research to complicated microbiologic population, the work that researcher is done is mainly reflected in following three aspect：(1) The high saltation zone selections of 16S rRNA：For conventional environment, tissue micro-biological samples selection 16S rRNA V4 areas as target It is most, it singly distinguishes resolution highest, but can only obtain single area's information；The earliest long long platform of sequenator Roche 454 of reading was once The article for V1~V3 areas is repeatedly delivered, but has been withdrawn from the market, current sequenator, which is unable to reach, once surveys logical V1~V3 More than the 600bp in area；There are numerous researchers to carry out collocation use using hypervariable region V3, V4 areas at present, but V3~V4 positions Point is 314~806, length about 500~550bp, and only Miseq PE300 sequencings type can meet that sequencing requires at present, and often It is low to be often faced with the long sequencings of the reads 3 ' end mass of long reading, causes read1 and read2 not splice, the wind that data are scrapped Danger；Through the long-term checking of researcher, V4~V5 areas and V3~V4 have same hypervariable region resolution ratio, particularly suitable for routine Environment, tissue micro-biological samples, category or kind can be identified.V4~V5 site is 515~907, length about 392bp, can It is widely used in the illumina hiseq2500PE250 platforms that flux is larger, cost is low, and speed is fast, FDA certifications have and faced The illumia MiSeq PE300 microarray datasets of bed product development meaning.(2) storehouse strategy aspect is built：The sequencing of 16S amplicons is often adopted Carry out mixed pond and build the method in storehouse being sequenced with tagging to multiple samples, at present main stream approach mainly have PCR primer build storehouse method, One step TRAP and two-step amplification method.Wherein, PCR primer builds storehouse method：Contain about 6 using the single-ended or both-ends at 5 ' ends or 3 ' ends~ The universal primer of the target of 8bp label (index) expands to genome, purifies target amplified production, using Qubit or QPCR methods are quantified, and will carry out building a common DNA library after about 20~40 sample mixed in equal amounts, this method primer compared with Short, the fidelity effect of PCR amplifications is good, but experimental procedure is cumbersome, and needs the DNA by multistep to build storehouse link, time length, cost It is high.One step TRAP：Synthesized together using containing the single-stranded sequence measuring joints with label and universal primer, in the same of target amplification When, required joint will be sequenced on PCR primer band, you can directly obtain library, it is easy to operate, speed is fast, cost is low, but band The wall scroll primer of upper complete sequence measuring joints be up to 90bp, PCR amplifications link easily cause amplification efficiency it is low (as amplification fails, Total amount is relatively low), there is primer dimer, miscellaneous band, result even in sample distortion during data analysis, expanded at present on a step The research of method is although more, but can not effectively solve the problem.Two-step amplification method：It is single-stranded containing part using 5 ' ends and 3 ' ends The universal primer of joint sequence carries out first step PCR amplifications, the product for the specific amplified that then can succeed to the first step, using containing The primer of label and complete single-stranded joint carries out second step amplification, you can obtains library, this two-step method does not need common DNA library Structure, speed is fast, cost is low, facilitating different sample rooms, flexibly mixed pond, individual samples flexibly mend survey.The design of primers group of two-step method Most, quantity, position such as label, the length of the single-stranded joint sequence in part, length of second step PCR joints etc. are closed, can be caused Different users are to building the deviation of storehouse effect, and such as design of primers and experiment reaction condition are inappropriate, two-wheeled PCR can cause amplification inclined It is good, expand mistake amplification.(3) response parameter is tested：Experiment parameter and sample type, build storehouse strategy, laboratory reagent preference has Close, the parameter of a set of suitable particular experiment need to be combined into.

In addition to above-mentioned three aspects, it is low in the presence of an amplicon library diversity toward contact to reduce cost and large scale sequencing Upper machine problem.The conventional microorganism amplification sublibrary using platform Hiseq2500 and MiSeq, gene different zones are because reading long span Degree is big, influences library and quantifies, thus can not mix machine, and amplicon term single gene single area can only be taken to expand, it appears text Storehouse complexity is extremely low.5 circulations, four kinds of bases of sequencing keep off 25%, otherwise can cause to be sequenced before being sequenced such as illunima Failure；In sequencing procedure, some sequencing length site only measures single base, because fluorescence information number is without power contrast, can cause Sequencing quality is low；25~50% PhiX balances library need to be added, but its presence can greatly waste sequencing throughput.

Therefore, in view of the above-mentioned problems, there is an urgent need to existing 16S rRNA gene amplicons sequencing library construction method Optimize improvement, solve the problems such as series complexity is low, to provide a kind of efficient quick, accurate and flexible, low cost, full The method of the 16S rRNA gene amplicons sequencing library structure of the extensive sample of foot.

The content of the invention

The present invention is in order to overcome the above-mentioned deficiency of prior art, there is provided one kind is used to build the survey of 16S rRNA gene amplicons The quadruple Tag primer group in preface storehouse, the characteristics of making full use of two generation sequencing technologies, and the amplification Ziwen of microbiologic population's composition Planting modes on sink characteristic, the intrinsic limitation of microarray dataset is broken through, to solve the problems such as series complexity is low.

Another object of the present invention is to provide any of the above-described quadruple Tag primer group in structure 16S rRNA genes Application in variable region V4~V5 areas amplicon sequencing library.

Another object of the present invention is to provide a kind of method of structure 16S rRNA gene amplicon sequencing libraries.

To achieve these goals, the present invention is achieved by following scheme：

A kind of quadruple Tag primer group for being used to build 16S rRNA gene amplicon sequencing libraries, the quadruple label draw Thing group is by the double Tag primers pair of first step PCR and the double Tag primers of second step PCR to forming；

The sequence of the sense primer of the double Tag primers pair of first step PCR is SEQ ID NO:Any in 1~8 Bar, the sequence of anti-sense primer is SEQ ID NO:Any bar in 9~20；The double Tag primers pair of second step PCR it is upper The sequence for swimming primer is SEQ ID NO:Any bar in 21~44, the sequence of anti-sense primer is SEQ ID NO:In 45~68 Any bar；

The N and V of the double Tag primer centerings of first step PCR represent the balance base by 0~6 base composition；Its In, N is selected from any of following 7 kinds of upstreams balance base, and V is selected from any of following 7 kinds of downstreams balance base：

Sequence number	Upstream balance base (5 ' -3 ')	Downstream balance base (5 ' -3 ')
			1	Blank	Blank
2	T	A
			3	GT	TC
4	CGA	CTA
			5	TGTA	GATG
6	TGCGA	TCTCA
			7	GAGTGG	TTCTCT

The present invention, with reference to the sequence characteristic of target gene, devises quadruple Tag primer using two-step PCR as storehouse strategy is built Group, the double Tag primers of first step PCR PCR1 sense primers and PCR1 anti-sense primers to being made up of, according to 5 ' ends to 3 ' ends Order include PCR1 joint sequences, PCR1 sequence labels, balance base sequence, target primer.Each sample target fragments are surveyed There are 49 kinds of balance base composition modes before sequence, starting point is sequenced between the library of different samples to change, it is each to greatly increase sequencing Cycles base homogeneity and complexity.

The PCR1 sequence labels can not have that the base of continuous more than 3 is identical by 8 base compositions between label, and will Each base ratio is sought close to 25%；Preferably, the PCR1 sequence labels are any of 8 kinds of upstream PCR1 labels in table 2 Or any of 12 kinds of labels of downstream PCR 1, totally 96 kinds of combinations.

The PCR1 joint sequences are the complete Read1 and Read2 parts of correspondence of sequence measuring joints, positioned at out of sequence measuring joints End is arrived after surveying first base of index labels in direction；Preferably, the PCR1 joint sequences are by 33 base compositions PCR1 upstream joints or PCR1 downstream taps.

The target primer is in 16S rRNA V4, V5 areas genome conserved region, then in universal primer 515F or 907R On the basis of extend two bases backward；Preferably, the 9th base of universal primer 515F is arranged to M, the M represents degeneracy alkali Base A/C, most preferably specific and compatible can be obtained to common environment and human microorganism's sample.

The double Tag primers of second step PCR PCR2 sense primers and PCR2 anti-sense primers to being made up of, according to 5 ' ends Order to 3 ' ends includes PCR2 joint sequences, PCR2 sequence labels, PCR2 complementary primers.

The PCR2 sequence labels can not have that the base of continuous more than 3 is identical by 8 base compositions between label, and will Each base ratio is sought close to 25%；Preferably, the PCR2 sequence labels are any of 24 kinds of upstream PCR2 labels or 24 Any of kind label of downstream PCR 2, totally 576 kinds of combinations.

The PCR2 joint sequences are P5 joint sequences or P7 joint sequences, and it is flat can be compatible with all illumina sequencings Platform.

The PCR2 complementary primers are selected to survey the index labels first in direction out of sequence measuring joints by 20 base compositions Individual base is to the 20th base, and the method (non-total length PCR1 joint sequences) matched with Partial joints can be with first step PCR Product fully matches, and and can shortens the entire length of second step PCR primer, improves primer efficiency.

Preferably, the quadruple Tag primer group shares 96 × 576=555296 kind combinations, can mark 55296 Sample, improve the sequencing throughput in library.

Preferably, the synthesis mode of the double Tag primers pair of first step PCR is ULTRAPAGE way of purification.

Preferably, the sequence of the sense primer of the double Tag primers pair of first step PCR is SEQ ID NO:69~76 In any bar, the sequence of anti-sense primer is SEQ ID NO:Any bar in 77~88.

The present invention is also claimed above-mentioned quadruple Tag primer group and expanded in structure 16S rRNA gene variable regions V4~V5 areas Increase the application in sub- sequencing library.

A kind of method of structure 16S rRNA gene amplicon sequencing libraries, including following step is also claimed in the present invention Suddenly：

S1. the extraction of sample to be tested genome and quality control；

S2. first step PCR reacts：Using S1 sample to be tested genome as template, the first step described in claim 1 is utilized For the double Tag primers of PCR to carrying out pcr amplification reaction and detecting amplified production, being chosen at 480bp or so has the expansion of single band Increase production thing and carry out next step reaction；

S3. second step PCR reacts：Using the amplified production chosen in S2 as template, the second step described in claim 1 is utilized For the double Tag primers of PCR to carrying out pcr amplification reaction and detecting amplified production, being chosen at 551bp or so has the expansion of single band Increase production thing and carry out next step reaction；

S4. library is quantitative and purifies：Quantitative, mixed pond is carried out to the amplified production chosen in S3, and is purified；

S5. 5%PiX libraries, upper machine sequencing are added into the 16S rRNA gene amplicon sequencing libraries built；

The condition of first step PCR reaction is：98℃30s；98 DEG C of 10s, 68 DEG C of 15s, 72 DEG C of 45s, 2 circulations；98 DEG C 10s, 55 DEG C of 15s, 72 DEG C of 45s, 20 circulations；72℃10min；4 DEG C of preservations；

The condition of second step PCR reaction is：98℃30s；98 DEG C of 10s, 65 DEG C of 15s, 72 DEG C of 45s, 2 circulations；98 DEG C 10s, 55 DEG C of 15s, 72 DEG C of 45s, 6 circulations；72℃10min；4 DEG C of preservations.

Preferably, the system of the first step PCR reactions is：5 μ 5 × PCR of L buffer solutions, 2 μ L 2.5mM dNTP mixing Liquid, 0.25 μ L 2.5U/ μ L archaeal dna polymerases, 2.5 μ L, 1 μM of PCR1 sense primer, 2.5 μ L, 1 μM of PCR1 anti-sense primer, 1~ 5 μ L 1ng/ μ L or 10ng/ μ L sample genomes, add ddH₂O is supplemented to 25 μ L.

Preferably, the system of the second step PCR reactions is：5 μ 5 × PCR of L buffer solutions, 2 μ L 2.5mM dNTP mixing Liquid, 0.25 μ L 2.5U/ μ L archaeal dna polymerases, 2.5 μ L, 1 μM of PCR2 sense primer, 2.5 μ L, 1 μM of PCR2 anti-sense primer, 1~ 5 μ L contain the PCR1 products of single target band, add ddH₂O is supplemented to 25 μ L.

Preferably, the concentration of sample genome is 1ng/ μ L in the first step PCR reaction systems, and volume is 2 μ L；It is described Second step PCR reaction systems include the PCR1 products that 2 μ L contain single target band.

Compared with prior art, the invention has the advantages that：

(1) present invention adds balance base sequence in quadruple Tag primer group, increased using two-step PCR as storehouse strategy is built Library diversity is added, has greatly improved sequencing quality, the PhiX texts that mixing 5% is even lower are only needed when upper machine is sequenced Storehouse；Dexterously enter line misregistration sequencing using the microorganism amplicon sequence characteristic of itself simultaneously, considerably reduce sequencing throughput Waste, ensure that sequencing quality.

(2) preferable specificity is shown during PCR1 sequence labels amplification provided by the present invention, primer free dimer is miscellaneous Band produces；PCR2 products can directly carry out qPCR quantitatively and then mixed Chi Shangji, with single PCR primer first through magnetic beads for purifying, then Individually quantitative qPCR effect is consistent, significantly simplify the post processing link for building library behind storehouse, reduces experimental cost, shorten Time.

(3) the illunima microarray datasets MiSeq of the compatible main flow at present of quadruple Tag primer group provided by the present invention PE300 and HiSeq PE250, and the DNA sequencing adapter-primer of Ion Torent platforms need to be only replaced, it is applicable to Ion Torrent platforms, it can be ensured that read disposable survey of long reads for every and lead to, the automation of quadruple label splits data exactly.

(4) method provided by the present invention, first using high annealing temperature, is obtained high special by optimizing PCR reaction conditions Property target fragment, then expanded with low temperature thermal oxidation, it is only necessary to expected total amount can be amplified with high fidelity compared with low-circulation number.

(5) present invention optimizes library constructing method simultaneously, has the advantages of cost-effective, efficient quick, flexible and convenient, Reaction time was foreshortened in one day, you can is completed from extracting genome DNA to library construction, suitable for extensive 96 orifice plate flowing water Line operates, and is adapted to large-scale promotion.

Brief description of the drawings

Fig. 1 is the schematic diagram that two-step PCR builds storehouse；Adapter- joint sequences, index- sequence labels, Spacer- are put down Weigh base sequence, Target- target primers, Read- complementary primer sequences.

Fig. 2 is the base homogenization schematic diagram that Spacer balances base.

Fig. 3 is the first step PCR primer electrophoresis detection result of sample segment in 122 fecal specimens in embodiment 2.

Fig. 4 is the second step PCR primer electrophoresis detection result of sample segment in 116 fecal specimens in embodiment 2.

Fig. 5 is machine sequencing data and label quality statistical result on 116 fecal specimens MiSeq in embodiment 2.

Fig. 6 is each data volume ratio distribution results of 116 fecal specimens labels in embodiment 2.

Fig. 7 is 10 fecal specimens first step PCR electrophoresis detection results in the control group 1 of comparative example 1.

Fig. 8 is 12 fecal specimens first step PCR electrophoresis detection results in the control group 2 of comparative example 1.

Fig. 9 is the simple process figure that two-step PCR builds storehouse.

Embodiment

The present invention is made with reference to Figure of description and specific embodiment and further being elaborated, the embodiment It is served only for explaining the present invention, is not intended to limit the scope of the present invention.Test method used in following embodiments is such as without spy Different explanation, is conventional method；Used material, reagent etc., unless otherwise specified, for the reagent commercially obtained And material.

The design of the quadruple Tag primer of embodiment 1

First, the double Tag primers of first step PCR are to design

1st, target design of primers

Using V4~V5 areas of 16S rRNA genes as target, target primer pair, including target upstream primer Primer- are designed F, downstream targets primer Primer-R, the amplification for target sequence.Specific design requires：(1) it is located at gene conserved region, by Change between different bacterial species less；(2) base is balanced, primer specific, can accurately amplify target band.

Based on design requirement and flora 16S genome databases correction primer is represented, it is such as positive with the common Gram of excrement Bacterium clostridium difficile Clostridioides difficile 630, complete genome (ACCESSION：CP010905) and Gram negative bacterium Escherichia coli Escherichia coli 16S ribosomal RNA, complete sequence (ACCESSION：J01859).The present invention is through a large amount of checkings, and optimal to select a pair of target primer sequences as follows：

Primer name Primer Sequence (5 ' -3 ')

Target-Primer-F GTGCCAGCMGCCGCGGTAA

Target-Primer-R CCGTCAATTCCTTTGAGTTT

Wherein, M represents degeneracy base A/C；

This primer is detected through PCR and qPCR, can be with the common environment of specific amplified and human microorganism's sample 16S targets Gene order, degenerate primer have preferable compatibility to species.

2nd, base sequence design is balanced

Base sequence (also known as Heterogeneity Spacer) is balanced, is sequenced between the library for changing different samples Beginning site, by 0~6 fixed base composition, occupied before aim sequence sequencing, play balance and the effect of position drop. Specific design requires：(1) can not be with target primer, library joint (PCR1 joint sequences, PCR1 sequence labels, PCR2 joints Sequence, PCR2 sequence labels) have it is identical or complementary in four bases；(2) it is identical can not to there are continuous three bases；(3) select Suitable length is selected, the long primer length that can increase of balance base causes target amplification failure, and combination drop is small, then does not reach alkali Base uniforms effect.

Through the design of primers Model Matching with the present invention, the balance base by 0~6 base composition is represented with N and V；Its In, N is selected from any of following 7 kinds of upstreams balance base, and V is selected from any of following 7 kinds of downstreams balance base, excellent altogether The balance base composition of 49 kinds of different base numbers is selected, as shown in table 1., can not in the case where balance base composition is enough Reuse.

Table 1 preferably balances base sequence table

The upper machine of microorganism amplicon sequencing in single region is carried out by illunima platforms needs the PhiX of mixing 50% to balance Library can normally be sequenced.Sublibrary is expanded using the microorganism of present invention balance base, it is only necessary to 5%PhiX libraries are mixed, For Q30 in conventional MiSeq sequencing qualities standard i.e. up to more than 75%, the sequencing quality that sequence is resurveyed with conventional animals and plants is consistent. The present invention adds balance base sequence in quadruple Tag primer, is sequenced simultaneously by multiple balance base compositions, ingenious land productivity With the microorganism amplicon sequence characteristic of itself, enter line misregistration sequencing, greatly reduce the waste of sequencing throughput, ensure that sequencing Quality.

3rd, PCR1 sequence labels design

PCR1 sequence labels are used for the target product of different samples or the mark in library, to distinguish source.Suitable for same Storehouse, or the multiple label in different libraries are built in multiple target products mixing in library, to increase the resolution degree of sample, are reduced embedding Fit generation.Specific design requires：(1) can not be identical or complementary with target primer, in order to avoid influence primer hairpin structure； (2) can not have that the base of continuous more than 3 is identical between label, and require each base ratio close to 25%；(3) label be 6~ 12bp is convenient, long then to increase primer length burden, and too short then resolution ratio is relatively low.

It is of the invention preferably to go out 8 upstream PCR1 labels, 12 labels of downstream PCR 1, as shown in table 2.PCR1 labels 8 × 12 Tag combination be applied to 96 hole PCR plates operations of mass experiment, the upper machine sequence verification through 6bp, 8bp, 12bp, read a length of 8bp can accurately carry out accurate match to all samples, and data are split, and meet resolution requirement.Preferable PCR1 labels exist When target expands, preferable specificity is shown, the miscellaneous band of primer free dimer produces.

The preferred PCR1 sequence labels of table 2

4th, PCR1 joint sequences design

PCR1 joint sequences contain part sequence measuring joints sequence, are the region of PCR1 amplified productions and PCR2 Primers complementaries, For in second step PCR, PCR primer to be connected into upper complete sequence measuring joints by PCR method.Specific design requires： (1) matched with second step PCR interior survey Read1 (complementary primer) or Read2 parts, series are formed by second step PCR institutes The sequence measuring joints type of selection determines；(2) PCR1 joint sequences will be of convenient length, and the base composition ratio of overall primer, with Exempt to influence target amplification and second step PCR expanding effect.

The present invention preferably goes out following a pair of PCR1 joint sequences according to design of primers model is considered：

Primer name Primer Sequence (5 ' -3 ')

PCR1F-Adapter ACACTCTTTCCCTACACGACGCTCTTCCGATCT

PCR1R-Adapter GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC

PCR1 joint sequences are preferably the complete Read1 and Read2 parts of correspondence of sequence measuring joints, positioned at out of sequence measuring joints End is arrived after surveying first base of PCR1 sequence labels in direction.This selection can fully take into account the length of second step PCR primer, divide Cutpoint and amplification efficiency, make most short PCR2 primers, under low circulation, efficient fidelity amplification.

5th, the assembling of PCR1 primers and synthesis

PCR1 primers are the double Tag primers pair of first step PCR, including PCR1 joint sequences, PCR1 sequence labels, flat Weigh base sequence, target primer each component optimum combination.Overall design requirements of the present invention and verified through long-term experiment, decision design Go out 8 PCR1 sense primers (as shown in table 3), 12 PCR1 anti-sense primers (as shown in table 4).

38 PCR1 upstream primer sequences of table

4 12 PCR1 downstream primer sequences of table

The synthesis requirement of above-mentioned primer is ULTRAPAGE way of purification, without base modification.

Preferably, the sequence of PCR1 sense primers is SEQ ID NO in table 5:Any bar in 69~76, PCR1 draw in downstream The sequence of thing is SEQ ID NO in table 6:Any bar in 77~88.

The preferably 8 PCR1 upstream primer sequences of table 5

The preferably 12 PCR1 downstream primer sequences of table 6

2nd, the double Tag primers of second step PCR are to design

1st, PCR2 complementary primers design

PCR2 complementary primers are used to go up PCR primer connection with PCR1 joint sequence complementary portions, dependence complementary portion Whole sequence measuring joints.Specific design requires：(1) it is part or all of consistent with PCR1 joint sequences, the composition of series Determined by the second step PCR joint categories selected；(2) PCR2 complementary primer sequences should be of convenient length, and consider second step PCR's Expanding effect.

The present invention preferably goes out following a pair of PCR2 complementary primer sequences according to design of primers model is considered：

Primer name Primer Sequence (5 ' -3 ')

PCR2F-Read1-Primer ACACTCTTTCCCTACACGAC

PCR2R-Read2-Primer GTGACTGGAGTTCAGACGTG

PCR2F-Primer selections survey first base of index labels in direction to the 20th alkali out of sequence measuring joints Base, PCR2R-Primer selections are surveyed first base of index labels in direction to the 20th base out of sequence measuring joints, used The method (non-total length PCR1 joint sequences) of Partial joints matching, so can fully be matched with first step PCR primer, and can contracting The short entire length of second step PCR primer, improve primer efficiency.

2nd, PCR2 sequence labels design

The library that PCR2 sequence labels are used for different sample sources is distinguished, and typically has single-ended (i7index) or both-end (i5 Index and i7 index).Specific design requires：(1) can not have that the base of continuous more than 3 is identical between label, and require each Base ratio is close to 25%；(2) label is 6~12bp than conveniently, the long burden for then increasing primer length is too short, differentiates Rate is relatively low.

The inventive method preferably goes out 24 upstream PCR2 i5 index labels, 24 i7 index labels of downstream PCR 2, As shown in table 7.The tag combination of PCR2 labels 24 × 24 is applied to 96 hole PCR plate operations of mass experiment, can meet 576 Combinatorial libraries while upper machine.8bp is that the length that instrument identification is read is sequenced in Optimum i llunima, is verified through computer experiment, label Sample can accurately be split.

In table 7, label base sequence that " the index sequences " of upper tag designs for the present invention, " machine on i5 index SampleSheet " is the index sequences that SampleSheet files are inserted when upper machine is sequenced, consistent with primer compound direction；Under The label base sequence that " the index sequences " of vernier label designs for the present invention, " machine SampleSheet " is upper machine on i7 index The index sequences of SampleSheet files are inserted during sequencing, are reverse complemental with primer compound direction.

The preferred PCR2 sequence labels of table 7

3rd, PCR2 joint sequences design

PCR2 sequence measuring joints sequences are for sequence complementary on instrument chip to be sequenced with illunima, with illunima public affairs It is consistent with P7 joint sequences to take charge of the P5 joint sequences announced, all illumina microarray datasets can be compatible with.

The inventive method preferably goes out following P5 joint sequences and P7 joint sequences：

Primer name Primer Sequence (5 ' -3 ')

PCR2F-P5-Adapter AATGATACGGCGACCACCGAGATCTACAC

PCR2R-P7-Adapter CAAGCAGAAGACGGCATACGAGAT

After primer combines, upper machine sequence verification, when preceding 25cycles pre-read and 600cycles are completely read, Can normally it identify.

4th, the assembling of PCR2 primers and synthesis

PCR2 primers are the double Tag primers pair of second step PCR, including PCR2 joint sequences, PCR2 sequence labels, PCR2 complementary primer each component optimum combinations.The inventive method overall design requirements and verified through long-term experiment, decision design goes out 24 PCR2 sense primers (as shown in table 8), 24 PCR2 anti-sense primers (as shown in table 9).

8 24 PCR2 upstream primer sequences of table

9 24 PCR2 downstream primer sequences of table

The double Tag primers of first step PCR provided by the present invention are to sharing the combination of 8 × 12=96 kinds, second step PCR two Weight Tag primer is to sharing the combination of 24 × 24=576 kinds, and the double Tag primers of second step PCR are to can be accurate according to design requirement Then continue to increase.Such as quadruple label common combination, can 55296 samples of mark, improve the sequencing throughput in library.

In order to reach the orderly use of primer, balance base optimum combination different in size, base balance is given full play of, Increase the effect of library diversity.It is as follows should to observe criterion for the combination of sample and primer before upper machine：

(1) due to when double label sequencings are read, the downstream label (index) of sequence measuring joints is first read, then reads sequencing Joint upper tag (index), quadruple sequence label of the invention equally follow this principle.Double label (i.e. first inside Walk the double labels of PCR), use is first ranked up to PCR1R-index, then PCR1F-index is sorted.Double label outside (i.e. the double labels of second step PCR), use is first ranked up to PCR2R-index, then PCR2F-index is sorted.

(2) ensuring PCR1F-index, PCR1R-index, PCR2F-index, PCR2R-index 4 weight labels must not weigh It is multiple to use, and in the case of PCR2F-index, PCR2R-index abundance, this outermost end sequencing index is it is not recommended that reuse. The citing of sample segment combination is as shown in table 10：

The sample segment combination of table 10 is illustrated

Sequence number	Sample ID	PCR1F primers	PCR1R primers	PCR2F primers	PCR2R primers
						1	FB0001	PCR1F-V4-01	PCR1R-V5-01	PCR2F-P5-01	PCR2R-P7-01
2	FB0002	PCR1F-V4-01	PCR1R-V5-02	PCR2F-P5-01	PCR2R-P7-02
						3	FB0003	PCR1F-V4-01	PCR1R-V5-03	PCR2F-P5-01	PCR2R-P7-03
4	FB0004	PCR1F-V4-01	PCR1R-V5-04	PCR2F-P5-01	PCR2R-P7-04
						5	FB0005	PCR1F-V4-01	PCR1R-V5-05	PCR2F-P5-01	PCR2R-P7-05
6	FB0006	PCR1F-V4-01	PCR1R-V5-06	PCR2F-P5-01	PCR2R-P7-06
						7	FB0007	PCR1F-V4-01	PCR1R-V5-07	PCR2F-P5-01	PCR2R-P7-07
8	FB0008	PCR1F-V4-01	PCR1R-V5-08	PCR2F-P5-01	PCR2R-P7-08
						9	FB0009	PCR1F-V4-01	PCR1R-V5-09	PCR2F-P5-01	PCR2R-P7-09
10	FB0010	PCR1F-V4-01	PCR1R-V5-10	PCR2F-P5-01	PCR2R-P7-10
						11	FB0011	PCR1F-V4-01	PCR1R-V5-11	PCR2F-P5-01	PCR2R-P7-11
12	FB0012	PCR1F-V4-01	PCR1R-V5-12	PCR2F-P5-01	PCR2R-P7-12
						13	FB0013	PCR1F-V4-02	PCR1R-V5-01	PCR2F-P5-01	PCR2R-P7-13
14	FB0014	PCR1F-V4-02	PCR1R-V5-02	PCR2F-P5-01	PCR2R-P7-14
						15	FB0015	PCR1F-V4-02	PCR1R-V5-03	PCR2F-P5-01	PCR2R-P7-15
16	FB0016	PCR1F-V4-02	PCR1R-V5-04	PCR2F-P5-01	PCR2R-P7-16
						17	FB0017	PCR1F-V4-02	PCR1R-V5-05	PCR2F-P5-01	PCR2R-P7-17
18	FB0018	PCR1F-V4-02	PCR1R-V5-06	PCR2F-P5-01	PCR2R-P7-18
						19	FB0019	PCR1F-V4-02	PCR1R-V5-07	PCR2F-P5-01	PCR2R-P7-19
20	FB0020	PCR1F-V4-02	PCR1R-V5-08	PCR2F-P5-01	PCR2R-P7-20
						21	FB0021	PCR1F-V4-02	PCR1R-V5-09	PCR2F-P5-01	PCR2R-P7-21
22	FB0022	PCR1F-V4-02	PCR1R-V5-10	PCR2F-P5-01	PCR2R-P7-22
						23	FB0023	PCR1F-V4-02	PCR1R-V5-11	PCR2F-P5-01	PCR2R-P7-23
24	FB0024	PCR1F-V4-02	PCR1R-V5-12	PCR2F-P5-01	PCR2R-P7-24
						25	FB0025	PCR1F-V4-03	PCR1R-V5-01	PCR2F-P5-02	PCR2R-P7-01
26	FB0026	PCR1F-V4-03	PCR1R-V5-02	PCR2F-P5-02	PCR2R-P7-02
						27	FB0027	PCR1F-V4-03	PCR1R-V5-03	PCR2F-P5-02	PCR2R-P7-03
28	FB0028	PCR1F-V4-03	PCR1R-V5-04	PCR2F-P5-02	PCR2R-P7-04
						29	FB0029	PCR1F-V4-03	PCR1R-V5-05	PCR2F-P5-02	PCR2R-P7-05
30	FB0030	PCR1F-V4-03	PCR1R-V5-06	PCR2F-P5-02	PCR2R-P7-06
						31	FB0031	PCR1F-V4-03	PCR1R-V5-07	PCR2F-P5-02	PCR2R-P7-07
32	FB0032	PCR1F-V4-03	PCR1R-V5-08	PCR2F-P5-02	PCR2R-P7-08
						33	FB0033	PCR1F-V4-03	PCR1R-V5-09	PCR2F-P5-02	PCR2R-P7-09
34	FB0034	PCR1F-V4-03	PCR1R-V5-10	PCR2F-P5-02	PCR2R-P7-10
						35	FB0035	PCR1F-V4-03	PCR1R-V5-11	PCR2F-P5-02	PCR2R-P7-11
36	FB0036	PCR1F-V4-03	PCR1R-V5-12	PCR2F-P5-02	PCR2R-P7-12

Embodiment 2

A kind of method of structure 16S rRNA gene amplicon sequencing libraries, is mainly included the following steps that：Sample genome Extraction and quality control, any quadruple Tag primer group in embodiment 1, first step PCR reactions and product detection are added, the Two step PCR react and product detection, and library quantifies and magnetic beads for purifying, is added in 16S rRNA gene amplicon sequencing libraries Machine is sequenced on 5%PiX libraries.Each sample is required to by the double Tag primers of first step PCR to carrying out target amplification, second The double Tag primers of PCR are walked to carrying out completion sequence measuring joints, altogether after the completion of two-wheeled PCR, detection is qualified, you can obtain complete 16S rRNA gene amplicon sequencing libraries.Comprise the following steps that：

1st, excrement genome extracts

(1) genome extracts

The genomic DNA of human faecal mass is extracted by kit (OMEGA cat.D4015).In order to ensure to be removed from office in fecal specimens Blue formula positive bacteria can be cracked fully, and be unlikely to serious degradation of dna again, in operating procedure 3 after 70 DEG C are incubated 10min, Temperature increases to 85 DEG C.

(2) genome quality control

Micro ultraviolet specrophotometer and 1% agarose gel electrophoresis detectable concentration are used to the genomic DNA after extraction And purity.DNA is in OD₂₆₀There are notable absworption peak, OD in place₂₆₀/OD₂₈₀Ratio is 1.8~2.0, and concentration is more than 10ng/ μ L.Electrophoresis mesh Mark band is about having single clear band at 15kb, in below 500bp without obvious continuous degradation fragment, illustrate genomic DNA It is up-to-standard.

2nd, first step PCR (PCR1) reactions and product detection

(1) PCR1 reaction systems

According to the method for step 1, patient's excrement of 122 angiocardiopathies provided Hospital of Southern Medical University The extraction and quality control of DNA sample are carried out, PCR each composition of reaction system is sequentially added on ice, it is as shown in table 11, of short duration Directly enter performing PCR reaction after centrifugation, and set the negative control using water as template to be used as experiment Quality Control.

The PCR1 amplification reaction systems of table 11

Note：PCR1F-V4-N*, PCR1R-V5-N* are the combination according to the sample and primer of table 10, first corresponding to selection Walk the double Tag primer titles of PCR.

The present invention have studied the influence that template concentrations are reacted PCR1, and excrement genomic DNA addition is 1 in reaction system ~5 μ L, concentration be 1ng/ μ L or addition be 1~5 μ L, concentration be 10ng/ μ L, consider specimen material obtain difficulty or ease journey Degree, the homogenization operation of PCR specificity, PCR primer yield, second step PCR starting templates, the template of the present invention preferably reaction system Initial amount is 2 μ L, concentration is 1ng/ μ L.Require that genomic DNA concentration is more than 10ng/ μ L simultaneously, so more convenient can accurately sentence The concentration and quality of disconnected sample.All samples are uniformly diluted to 1ng/ μ L, can reduce mortifier and host's base in environmental sample Because of the pollution of group, be advantageous to strengthen PCR specificity, be easy to subsequently to uniform library and quantify.

The system preferably has the PCR of hi-fi and high amplification efficiency concurrently with archaeal dna polymerase (being purchased from Takara Bio), with The Binding Capacity of the reaction density of optimization, it is possible to achieve to the hi-fi of extensive target sequence, high sensitivity, high specific, The amplification of high success rate.Reaction system cumulative volume reacts Tag primer for 25 μ L, containing 200 μM of each dNTP, 0.04 μM, its Relatively low concentration of substrate and the collocation of suitable reaction volume, more can guarantee that the stabilization and efficiency of system.

(2) PCR1 amplification reaction conditions

PCR heat lids are opened in advance, after heat lid reaches 98 DEG C, are quickly put into sample to reactive tank, are started reaction.Reactant System is as shown in table 12：

The PCR1 amplification reaction conditions of table 12

1) preferred annealing temperature：It is averaged according to 8 PCR1F-V4-N sense primers, 12 PCR1R-V5-N anti-sense primers TM values are 73 DEG C, by TM value ± 10 DEG C, as annealing region.Using grads PCR method, come using 3 group of 40 pipe same sample The PCR reaction systems in source, by PCR reactive tanks, from left to right, sorted successively from A to L, each hole temperature since most 73 DEG C according to It is secondary to successively decrease 0.5 DEG C, to 53 DEG C.98 DEG C of reaction system, 30s are pressed by PCR reaction systems；(98 DEG C, 10s；73~53 DEG C, 15s；72 DEG C, 45s, 22cycles), 72 DEG C, 10min.The PCR effects of different annealing temperature are analyzed, it is found that primer specificity is most at 68 DEG C Good, yield is higher at 55 DEG C.

Therefore, the present invention preferably first step PCR reaction systems, the high temperature anneal temperatures of 2 circulations are first carried out, can obtain compared with For the template of specificity matching, annealed under the conditions of 55 DEG C, required total amount can be stably obtained in compared with low-circulation number.

2) period and extension of time：Verified through many experiments, 45s can fully extended complete target fragments, and time It is not long.20 circulations can obtain target fragments electrophoresis detection level, and greatly remove the pollution of host genome.

Extension of time is long, and period is excessive, can increase the generation of reaction time and non-specific band, influence second step PCR reacts.

(3) PCR1 product detections

The μ L of PCR1 products 2 directly are taken, are detected using 1% agarose gel electrophoresis, the electrophoresis 40min under 120V, observe mesh Band whether about having single target amplified band at 480bp, meet that the qualified samples of requirement continue second step PCR Amplification.

For variety classes bacterium because of spore, its 16S V4~V5 area may have an insertion and deletion, and bases longs allow ± Fluctuated in the range of 50bp.Purpose band length calculation method：Primer sites (907~515bp)+balance base (0~6bp)+ PCR1 both-ends index (8+8bp)+outer extension connector (33+33bp) ≈ 480bp.

Sample segment first step PCR primer electrophoresis detection result is as shown in figure 3, swimming lane numeral is 122 excrement samples in figure The partial results of position One_step PCR product.Can be seen that 122 first step PCR primers from quality inspection result, meet it is contemplated that What 480bp or so had a single target band has 116.Speculate sample segment, degraded due to bacterial genomes or pressed down containing PCR Thing reason processed cause amplification failure, it is necessary to again extraction or purified genomic dna.Testing result illustrates, the of the inventive method One_step PCR can amplify expected target band, and qualification rate builds the qualified water of storehouse method up to 95.08% far beyond One_step PCR It is flat.

3rd, second step PCR (PCR2) reactions and product detection

(1) target product PCR2 reaction systems

Qualified 116 products are selected in first step PCR primer as template, PCR reactant is sequentially added on ice It is each composition, directly enters performing PCR reaction as shown in table 13, after of short duration centrifugation.And set using water as template negative control as Test Quality Control.Preferable PCR reaction systems parameter and 16S rRNA V4~V5 targets amplification PCR system are basically identical, contain list The PCR primer of one target band needs not move through purifying, directly takes 2 μ L to can be used as starting template.

The target product PCR2 reaction systems of table 13

Note：PCR2F-P5-N*, PCR2R-P7-N* are the combination according to the sample and primer of table 10, second corresponding to selection Walk the double Tag primer titles of PCR.

(2) PCR2 amplification reaction conditions

PCR heat lids are opened in advance, after heat lid reaches 98 DEG C, are quickly put into sample to reactive tank, are started reaction.Reactant System is as shown in table 14：

The PCR2 amplification reaction conditions of table 14

1) preferred annealing temperature：TM values according to 24 PCR2F-P5-N sense primers, PCR2R-P7-N anti-sense primers are 71 DEG C, by TM value ± 10 DEG C, as annealing region.Using grads PCR method, the PCR in 3 group of 40 pipe same sample source is used Reaction system, by PCR reactive tanks, from left to right, sorted successively from A to L, each hole temperature is successively decreased for 73 DEG C successively since most 0.5 DEG C, to 53 DEG C.98 DEG C of reaction system, 30s are pressed by PCR reaction systems；(98 DEG C, 10s；73~53 DEG C, 15s；72 DEG C, 45s, 8cycles), 72 DEG C, 10min.The PCR effects of different annealing temperature are analyzed, primer specificity is best when drawing 65 DEG C, at 55 DEG C Yield is higher.

Therefore, the present invention preferably second step PCR system, the high temperature anneal temperature of 2 circulations is first carried out, can obtained more special The template of opposite sex matching, anneals under the conditions of 55 DEG C, can stably obtain required total amount in compared with low-circulation number.

2) period and extension of time：Verified through many experiments, 45s can fully extended complete target fragments, and time Not long, 6 low circulations can obtain library total amount 200ng or so after purification, and this PCR link almost removes host gene completely Group pollution.Extension of time is long, and period is excessive, can increase the generation of reaction time and non-specific band, cause sequencing quality Decline.

(3) PCR2 product detections

2 μ L PCR2 products are directly taken, are detected using 1% agarose gel electrophoresis, the electrophoresis 40min under 120V, observation Whether purpose band is about having single target amplified band at 551bp, carrying out library to the qualified samples for meeting to require quantifies And purifying.

Purpose band length calculation method：First step PCR primer (480bp)+P5 ends upstream joints (30bp)+P7 ends upstream Joint (25bp)+PCR2 both-ends index (8+8bp)+interior survey Partial joints (20+20bp, are not counted in) ≈ 551bp.

Sample segment second step PCR primer electrophoresis detection result is as shown in figure 4, swimming lane numeral is 116 excrement samples in figure The partial results of product second step PCR primer.Can be seen that 116 second step PCR primer 551bp or so from quality inspection result has Single target band, without the miscellaneous band of obvious disperse.Expected target band, qualification rate can be amplified by illustrating the second step PCR of the present invention Up to 100%, realize under the conditions of compared with low-circulation number, energy stable matching first step PCR acomplementary connector sequence, in amplification, even Connect complete sequence measuring joints.Also indicate that, the high special combination target fragments of first step PCR of the invention, obtain purer simultaneously Template, and then improve second step PCR specific amplification.

4th, library is quantitative and purifies

Qualified sample is detected to second step PCR primer, uses qPCR libraries absolute quantitation kit (VAHTS Library Quantification Kit for Illumina, purchased from Vazyme) quantified, after quantitative, by whole plate qPCR Quantitative library quantity, such as 36 carry out equivalent and mix pond.

Using the single or multiple libraries behind mixed pond, magnetic bead (VAHTS DNA Clean are purified than DNA using sample volume Beads, purchased from Vazyme) ratio be (0.65~0.75) X parameter purified, be preferably in a proportion of 0.7X.

As a result show, second step PCR primer directly carries out qPCR quantitatively and then mixes Chi Shangji, is first passed through with single PCR primer Magnetic beads for purifying, then independent qPCR quantitative effects are consistent.This step, which is greatly simplified, builds the post processing link in library behind storehouse and drops Low experimental cost, time greatly shorten, and make from sample gene group DNA to library construction, library is completed in quantitative one day, and turning into can Energy.

5th, machine is sequenced on library

Using Miseq microarray datasets, sublibrary is expanded to 116 16S rRNA, adds machine sequencing on 5%PiX libraries. Machine sequencing data and label quality statistical result on 116 fecal specimens MiSeq are as shown in figure 5, arrow head part represents in figure Read2 (I), Read3 (I) be second step PCR i5 index, i7 index, its Q30 (Q30 represents error rate as 0.1%) matter Value is respectively 93.44%, 92.44%；Each data volume ratio distribution results of 16 fecal specimens labels are as shown in fig. 6, in figure Index1 (i7), Index2 (i5) are second step PCR i5 index, i7 index；%Reads Identified (PF) table Show the ratio that can recognize that and come (passing filtering filtering after), its each combination tag ratio is close to identical, 116 groups Label is closed, and ratio is close to 1%.As a result show, on overall sequencing quality, i5 index, i7 index are normally identified, sequencing Quality is good, and the quality of each combination tag and library quantitative result are more accurate, homogeneous.

Upper machine result shows that sequencing quality is good, and all samples can be distinguished correctly, and each sample data volume ratio connects It is near homogeneous.Thus illustrate, a kind of method of structure 16S rRNA gene amplicon sequencing libraries provided by the present invention is successfully built It is vertical.

Comparative example 1

2 two groups of Standard PCR reaction conditions of control group 1 and control group are set, as shown in Table 15, using in embodiment 2 first Sample, primer combination, PCR1 reaction systems and the PCR1 product detection methods in PCR (PCR1) target amplification method are walked, is carried out Control group PCR1 reacts.

The control group PCR1 reaction conditions of table 15

10 fecal specimens first step PCR electrophoresis detections results are as shown in fig. 7, can from quality inspection result in control group 1 Go out：10 first step PCR primers, which meet expected 480bp or so, in control group 1 single target band, and specificity is stronger, Without miscellaneous band, but single slice is weaker, and concentration is relatively low, illustrates that 68 DEG C of first step PCR annealing temperatures can amplify target compared with high specific Band is marked, but yield also needs to further improve.

12 fecal specimens first step PCR electrophoresis detections results are as shown in figure 8, can from quality inspection result in control group 2 Go out：12 first step PCR primers, which meet expected 480bp or so, in control group 2 single target band, and yield is higher, but The left right edges of 1000bp have the miscellaneous band of weak disperse, illustrate 55 DEG C of first step PCR annealing temperatures can higher total amount amplify target band, But specificity also needs to further improve.

Sequence table

<110>Guangzhou Sai Zhe biotech inc

<120>A kind of primer sets and construction method for being used to build 16S rRNA gene amplicon sequencing libraries

<160> 88

<170> SIPOSequenceListing 1.0

<210> 1

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 1

acactctttc cctacacgac gctcttccga tctctctcta tngtgccagc mgccgcggta 60

a 61

<210> 2

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 2

acactctttc cctacacgac gctcttccga tcttatcctc tngtgccagc mgccgcggta 60

a 61

<210> 3

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 3

acactctttc cctacacgac gctcttccga tctagagtag angtgccagc mgccgcggta 60

a 61

<210> 4

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 4

acactctttc cctacacgac gctcttccga tctgtaagga gngtgccagc mgccgcggta 60

a 61

<210> 5

<211> 60

<212> DNA

<213>Microorganism (microorganism)

<400> 5

acactctttc cctacacgac gctcttccga tctactgcat angtgccagc mgccgcggta 60

<210> 6

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 6

acactctttc cctacacgac gctcttccga tctaaggagt angtgccagc mgccgcggta 60

a 61

<210> 7

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 7

acactctttc cctacacgac gctcttccga tctctaagcc tngtgccagc mgccgcggta 60

a 61

<210> 8

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 8

acactctttc cctacacgac gctcttccga tctgcgtaag angtgccagc mgccgcggta 60

a 61

<210> 9

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 9

gtgactggag ttcagacgtg tgctcttccg atctaaggcg avccgtcaat tcctttgagt 60

tt 62

<210> 10

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 10

gtgactggag ttcagacgtg tgctcttccg atccgtacta gvccgtcaat tcctttgagt 60

tt 62

<210> 11

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 11

gtgactggag ttcagacgtg tgctcttccg atcaggcaga avccgtcaat tcctttgagt 60

tt 62

<210> 12

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 12

gtgactggag ttcagacgtg tgctcttccg atctcctgag cvccgtcaat tcctttgagt 60

tt 62

<210> 13

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 13

gtgactggag ttcagacgtg tgctcttccg atcggactcc tvccgtcaat tcctttgagt 60

tt 62

<210> 14

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 14

gtgactggag ttcagacgtg tgctcttccg atctaggcat gvccgtcaat tcctttgagt 60

tt 62

<210> 15

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 15

gtgactggag ttcagacgtg tgctcttccg atcctctcta cvccgtcaat tcctttgagt 60

tt 62

<210> 16

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 16

gtgactggag ttcagacgtg tgctcttccg atccagagag gvccgtcaat tcctttgagt 60

tt 62

<210> 17

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 17

gtgactggag ttcagacgtg tgctcttccg atcgctacgc tvccgtcaat tcctttgagt 60

tt 62

<210> 18

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 18

gtgactggag ttcagacgtg tgctcttccg atccgaggct gvccgtcaat tcctttgagt 60

tt 62

<210> 19

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 19

gtgactggag ttcagacgtg tgctcttccg atcaagaggc avccgtcaat tcctttgagt 60

tt 62

<210> 20

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 20

gtgactggag ttcagacgtg tgctcttccg atcgtagagg avccgtcaat tcctttgagt 60

tt 62

<210> 21

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 21

aatgatacgg cgaccaccga gatctacaca acgtgataca ctctttccct acacgac 57

<210> 22

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 22

aatgatacgg cgaccaccga gatctacaca aacatcgaca ctctttccct acacgac 57

<210> 23

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 23

aatgatacgg cgaccaccga gatctacaca tgcctaaaca ctctttccct acacgac 57

<210> 24

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 24

aatgatacgg cgaccaccga gatctacaca gtggtcaaca ctctttccct acacgac 57

<210> 25

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 25

aatgatacgg cgaccaccga gatctacaca ccactgtaca ctctttccct acacgac 57

<210> 26

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 26

aatgatacgg cgaccaccga gatctacaca cattggcaca ctctttccct acacgac 57

<210> 27

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 27

aatgatacgg cgaccaccga gatctacacc agatctgaca ctctttccct acacgac 57

<210> 28

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 28

aatgatacgg cgaccaccga gatctacacc atcaagtaca ctctttccct acacgac 57

<210> 29

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 29

aatgatacgg cgaccaccga gatctacacc gctgatcaca ctctttccct acacgac 57

<210> 30

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 30

aatgatacgg cgaccaccga gatctacaca caagctaaca ctctttccct acacgac 57

<210> 31

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 31

aatgatacgg cgaccaccga gatctacacc tgtagccaca ctctttccct acacgac 57

<210> 32

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 32

aatgatacgg cgaccaccga gatctacaca gtacaagaca ctctttccct acacgac 57

<210> 33

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 33

aatgatacgg cgaccaccga gatctacaca acaaccaaca ctctttccct acacgac 57

<210> 34

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 34

aatgatacgg cgaccaccga gatctacaca accgagaaca ctctttccct acacgac 57

<210> 35

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 35

aatgatacgg cgaccaccga gatctacaca acgcttaaca ctctttccct acacgac 57

<210> 36

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 36

aatgatacgg cgaccaccga gatctacaca agacggaaca ctctttccct acacgac 57

<210> 37

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 37

aatgatacgg cgaccaccga gatctacaca aggtacaaca ctctttccct acacgac 57

<210> 38

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 38

aatgatacgg cgaccaccga gatctacaca cacagaaaca ctctttccct acacgac 57

<210> 39

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 39

aatgatacgg cgaccaccga gatctacaca cagcagaaca ctctttccct acacgac 57

<210> 40

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 40

aatgatacgg cgaccaccga gatctacaca cctccaaaca ctctttccct acacgac 57

<210> 41

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 41

aatgatacgg cgaccaccga gatctacaca cgctcgaaca ctctttccct acacgac 57

<210> 42

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 42

aatgatacgg cgaccaccga gatctacaca cgtatcaaca ctctttccct acacgac 57

<210> 43

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 43

aatgatacgg cgaccaccga gatctacaca ctatgcaaca ctctttccct acacgac 57

<210> 44

<211> 57

<212> DNA

<213>Microorganism (microorganism)

<400> 44

aatgatacgg cgaccaccga gatctacaca gagtcaaaca ctctttccct acacgac 57

<210> 45

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 45

caagcagaag acggcatacg agatgataga cagtgactgg agttcagacg tg 52

<210> 46

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 46

caagcagaag acggcatacg agatgccaca tagtgactgg agttcagacg tg 52

<210> 47

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 47

caagcagaag acggcatacg agatgcgagt aagtgactgg agttcagacg tg 52

<210> 48

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 48

caagcagaag acggcatacg agatgctaac gagtgactgg agttcagacg tg 52

<210> 49

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 49

caagcagaag acggcatacg agatgctcgg tagtgactgg agttcagacg tg 52

<210> 50

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 50

caagcagaag acggcatacg agatggagaa cagtgactgg agttcagacg tg 52

<210> 51

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 51

caagcagaag acggcatacg agatggtgcg aagtgactgg agttcagacg tg 52

<210> 52

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 52

caagcagaag acggcatacg agatgtacgc aagtgactgg agttcagacg tg 52

<210> 53

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 53

caagcagaag acggcatacg agatgtcgta gagtgactgg agttcagacg tg 52

<210> 54

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 54

caagcagaag acggcatacg agatgtctgt cagtgactgg agttcagacg tg 52

<210> 55

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 55

caagcagaag acggcatacg agatgtgttc tagtgactgg agttcagacg tg 52

<210> 56

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 56

caagcagaag acggcatacg agattaggat gagtgactgg agttcagacg tg 52

<210> 57

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 57

caagcagaag acggcatacg agattatcag cagtgactgg agttcagacg tg 52

<210> 58

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 58

caagcagaag acggcatacg agattccgtc tagtgactgg agttcagacg tg 52

<210> 59

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 59

caagcagaag acggcatacg agattcttca cagtgactgg agttcagacg tg 52

<210> 60

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 60

caagcagaag acggcatacg agattgaaga gagtgactgg agttcagacg tg 52

<210> 61

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 61

caagcagaag acggcatacg agattggaac aagtgactgg agttcagacg tg 52

<210> 62

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 62

caagcagaag acggcatacg agattggctt cagtgactgg agttcagacg tg 52

<210> 63

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 63

caagcagaag acggcatacg agattggtgg tagtgactgg agttcagacg tg 52

<210> 64

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 64

caagcagaag acggcatacg agatttcacg cagtgactgg agttcagacg tg 52

<210> 65

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 65

caagcagaag acggcatacg agataactca ccgtgactgg agttcagacg tg 52

<210> 66

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 66

caagcagaag acggcatacg agataagaga tcgtgactgg agttcagacg tg 52

<210> 67

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 67

caagcagaag acggcatacg agataaggac acgtgactgg agttcagacg tg 52

<210> 68

<211> 52

<212> DNA

<213>Microorganism (microorganism)

<400> 68

caagcagaag acggcatacg agataatccg tcgtgactgg agttcagacg tg 52

<210> 69

<211> 60

<212> DNA

<213>Microorganism (microorganism)

<400> 69

acactctttc cctacacgac gctcttccga tctctctcta tgtgccagcm gccgcggtaa 60

<210> 70

<211> 60

<212> DNA

<213>Microorganism (microorganism)

<400> 70

acactctttc cctacacgac gctcttccga tcttatcctc tgtgccagcm gccgcggtaa 60

<210> 71

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 71

acactctttc cctacacgac gctcttccga tctagagtag atgtgccagc mgccgcggta 60

a 61

<210> 72

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 72

acactctttc cctacacgac gctcttccga tctgtaagga ggtgtgccag cmgccgcggt 60

aa 62

<210> 73

<211> 63

<212> DNA

<213>Microorganism (microorganism)

<400> 73

acactctttc cctacacgac gctcttccga tctactgcat acgagtgcca gcmgccgcgg 60

taa 63

<210> 74

<211> 64

<212> DNA

<213>Microorganism (microorganism)

<400> 74

acactctttc cctacacgac gctcttccga tctaaggagt atgtagtgcc agcmgccgcg 60

gtaa 64

<210> 75

<211> 65

<212> DNA

<213>Microorganism (microorganism)

<400> 75

acactctttc cctacacgac gctcttccga tctctaagcc ttgcgagtgc cagcmgccgc 60

ggtaa 65

<210> 76

<211> 66

<212> DNA

<213>Microorganism (microorganism)

<400> 76

acactctttc cctacacgac gctcttccga tctgcgtaag agagtgggtg ccagcmgccg 60

cggtaa 66

<210> 77

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 77

gtgactggag ttcagacgtg tgctcttccg atctaaggcg accgtcaatt cctttgagtt 60

t 61

<210> 78

<211> 61

<212> DNA

<213>Microorganism (microorganism)

<400> 78

gtgactggag ttcagacgtg tgctcttccg atccgtacta gccgtcaatt cctttgagtt 60

t 61

<210> 79

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 79

gtgactggag ttcagacgtg tgctcttccg atcaggcaga aaccgtcaat tcctttgagt 60

tt 62

<210> 80

<211> 63

<212> DNA

<213>Microorganism (microorganism)

<400> 80

gtgactggag ttcagacgtg tgctcttccg atctcctgag ctcccgtcaa ttcctttgag 60

ttt 63

<210> 81

<211> 64

<212> DNA

<213>Microorganism (microorganism)

<400> 81

gtgactggag ttcagacgtg tgctcttccg atcggactcc tctaccgtca attcctttga 60

gttt 64

<210> 82

<211> 65

<212> DNA

<213>Microorganism (microorganism)

<400> 82

gtgactggag ttcagacgtg tgctcttccg atctaggcat ggatgccgtc aattcctttg 60

agttt 65

<210> 83

<211> 66

<212> DNA

<213>Microorganism (microorganism)

<400> 83

gtgactggag ttcagacgtg tgctcttccg atcctctcta ctctcaccgt caattccttt 60

gagttt 66

<210> 84

<211> 67

<212> DNA

<213>Microorganism (microorganism)

<400> 84

gtgactggag ttcagacgtg tgctcttccg atccagagag gttctctccg tcaattcctt 60

tgagttt 67

<210> 85

<211> 62

<212> DNA

<213>Microorganism (microorganism)

<400> 85

gtgactggag ttcagacgtg tgctcttccg atcgctacgc taccgtcaat tcctttgagt 60

tt 62

<210> 86

<211> 63

<212> DNA

<213>Microorganism (microorganism)

<400> 86

gtgactggag ttcagacgtg tgctcttccg atccgaggct gtcccgtcaa ttcctttgag 60

ttt 63

<210> 87

<211> 64

<212> DNA

<213>Microorganism (microorganism)

<400> 87

gtgactggag ttcagacgtg tgctcttccg atcaagaggc actaccgtca attcctttga 60

gttt 64

<210> 88

<211> 65

<212> DNA

<213>Microorganism (microorganism)

<400> 88

gtgactggag ttcagacgtg tgctcttccg atcgtagagg agatgccgtc aattcctttg 60

agttt 65

Claims

1. a kind of quadruple Tag primer group for being used to build 16S rRNA gene amplicon sequencing libraries, it is characterised in that described Quadruple Tag primer group is by the double Tag primers pair of first step PCR and the double Tag primers of second step PCR to forming；

The sequence of the sense primer of the double Tag primers pair of first step PCR is SEQ ID NO:Any bar in 1~8, under The sequence for swimming primer is SEQ ID NO:Any bar in 9~20；The sense primer of the double Tag primers pair of second step PCR Sequence be SEQ ID NO:Any bar in 21~44, the sequence of anti-sense primer is SEQ ID NO:Any in 45~68 Bar；

The N and V of the double Tag primer centerings of first step PCR represent the balance base by 0~6 base composition；Wherein, N Selected from any of following 7 kinds of upstreams balance base, V is selected from any of following 7 kinds of downstreams balance base：

2. quadruple Tag primer group described in claim 1 is in structure 16S rRNA gene variable regions V4~V5 areas amplicon sequencing text Application in storehouse.

A kind of 3. method of structure 16S rRNA gene amplicon sequencing libraries, it is characterised in that comprise the following steps：

S1. the extraction of sample to be tested genome and quality control；

S2. first step PCR reacts：Using S1 sample to be tested genome as template, the first step PCR described in claim 1 is utilized Double Tag primer to carrying out pcr amplification reaction and detecting amplified production, produce by the amplification that being chosen at 480bp or so has single band Thing carries out next step reaction；

S3. second step PCR reacts：Using the amplified production chosen in S2 as template, the second step PCR described in claim 1 is utilized Double Tag primer to carrying out pcr amplification reaction and detecting amplified production, produce by the amplification that being chosen at 551bp or so has single band Thing carries out next step reaction；

The condition of first step PCR reaction is：98℃30s；98 DEG C of 10s, 68 DEG C of 15s, 72 DEG C of 45s, 2 circulations；98℃ 10s, 55 DEG C of 15s, 72 DEG C of 45s, 20 circulations；72℃10min；4 DEG C of preservations；

The condition of second step PCR reaction is：98℃30s；98 DEG C of 10s, 65 DEG C of 15s, 72 DEG C of 45s, 2 circulations；98℃ 10s, 55 DEG C of 15s, 72 DEG C of 45s, 6 circulations；72℃10min；4 DEG C of preservations.

4. according to the method for claim 3, it is characterised in that the system of first step PCR reaction is：5μL5×PCR Buffer solution, 2 μ L 2.5mM dNTP mixed liquors, 0.25 μ L 2.5U/ μ L archaeal dna polymerases, 2.5 μ L, 1 μM of PCR1 sense primer, 2.5 1 μM of μ L PCR1 anti-sense primers, 1~5 μ L 1ng/ μ L or 10ng/ μ L sample genomes, add ddH₂O is supplemented to 25 μ L.

5. according to the method for claim 3, it is characterised in that the system of second step PCR reaction is：5μL5×PCR Buffer solution, 2 μ L 2.5mM dNTP mixed liquors, 0.25 μ L 2.5U/ μ L archaeal dna polymerases, 2.5 μ L, 1 μM of PCR2 sense primer, 2.5 1 μM of μ L PCR2 anti-sense primers, 1~5 μ L contain the PCR1 products of single target band, add ddH₂O is supplemented to 25 μ L.

6. according to the method for claim 3, it is characterised in that sample genome in the first step PCR reaction systems Concentration is 1ng/ μ L, and volume is 2 μ L；The second step PCR reaction systems include the PCR1 productions that 2 μ L contain single target band Thing.