CN107828917A - For detecting the wild malicious primer and probe of PRV, PCR kit for fluorescence quantitative and method, application - Google Patents
For detecting the wild malicious primer and probe of PRV, PCR kit for fluorescence quantitative and method, application Download PDFInfo
- Publication number
- CN107828917A CN107828917A CN201711233609.3A CN201711233609A CN107828917A CN 107828917 A CN107828917 A CN 107828917A CN 201711233609 A CN201711233609 A CN 201711233609A CN 107828917 A CN107828917 A CN 107828917A
- Authority
- CN
- China
- Prior art keywords
- primer
- prv
- probe
- detection
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
It is used to detect the primer and probe of the wild poison of PRV, PCR kit for fluorescence quantitative and method, application the invention discloses a kind of, wherein, the nucleotide sequence of primer is as follows：Sense primer：5'CGGCTTCGACGTCTGGTT 3', anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；The sequence of probe is as follows：5' FAM‑CCGGAGAAACCGGAAG‑MGB 3'.The beneficial effects of the invention are as follows：The fluorescent quantitative PCR detection method built using primer and probe of the present invention, with the advantage such as high specificity, high sensitivity, reproducible, quick, easy and reliable technical tool is provided for the early stage quick detection of the wild poison of PRV, and its epidemiology survey and prevention and control China PRV prevalence.
Description
Technical field
The present invention relates to virus PCR detection technique field, more particularly to a kind of primer for being used to detect PRV
And probe, PCR kit for fluorescence quantitative and method, application.
Background technology
Porcine pseudorabies（Pseudorabies, PR）It is by PR viruses（PRV）A kind of caused deadly infectious disease, pig are
Unique natural reservoir (of bird flu viruses), it is long-term storage and the discharge person of virus.PRV can infect the pig of all age group, mainly cause gestation
Sow abortion, stillborn foetus, mummy tire, suckling pig high mortality and boar infertility.The disease is worldwide widely distributed, with
The application of the vaccines such as Bartha-K61 and differential diagnostic method, PRV has been purified in some American-European countries.But from
Start within 2011, PR epidemic situations are broken out on the pig farm that Bartha-K61 vaccines were immunized in the multiple provinces in China in succession, give China's pig industry
Cause serious economic loss.
With the continuous development of large scale of pig farm and the appearance of new popular strain variant, PRV generation and popular day
Become serious, constantly endanger China's pig industry.At present, the PRV open countries poison of many large-scale pig farms in China is positive, many medium and small rule
The pig farm of mould and small plant's infection conditions are more bad, and this control for causing this sick becomes more complicated.PRV routine at present
Detection method includes virus isolation and Identification, indirect immuno-fluorescence assay (IFA), serum neutralization test (SN), polymerase
Chain reaction (PCR) etc..These conventional methods are used for when PRV wild virus infections detect in specificity, sensitiveness and the side such as ageing
Face Shortcomings, particularly embody particularly evident in virus infection early diagnosis.Real-time fluorescence quantitative PCR is by Standard PCR
It is combined with fluorescence probe detection technique, has the advantages that high specificity, sensitivity are higher, reproducible, and it is easy to operate,
Used time is short, and pollution is few, by analysis software can automatically quantitative analysis, it is as a result more accurate and visual, suitable for large batch of virus
Qualitative and quantitative detection, the important method of pathogen detection has been increasingly becoming it.
GE genes are PRV major virulence factor of determinations, and OIE's defined gene-deleted vaccine
Missing gene.The fluorescent quantitative PCR detection method established based on gE gene orders can distinguish gene-deleted vaccine and connect
Kind and wild virus infection.This research, which is intended to establish, a kind of distinguishes the specific glimmering of pseudorabies street strain and Gene deletion mutation
Fluorescent Quantitative PCR method, for PRV early stage quick detection, and its epidemiology survey and prevention and the prevalence for controlling China PRV
Quick, easy and reliable technical tool is provided.
The content of the invention
It is the quick detection of the wild poison of PRV in order to provide a kind of detection reagent for fast and accurately detecting the wild poison of PRV
And its epidemiology survey and prevention and quick, the easy and reliable technical tool of prevalence offer for controlling China PRV, this hair
It is bright to provide a kind of specific primer and probe, PCR kit for fluorescence quantitative and side for being used to detect the wild poison of PRV
Method, application.
In order to realize foregoing invention purpose, the invention provides one kind to be used for PRV specific detection primer
And probe, wherein：
The nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'。
In order to preferably realize foregoing invention purpose, present invention also offers a kind of fluorescence for being used to detect PRV to determine
PCR detection reagents are measured, the reagent includes following components：Reaction mixture, water and for PRV specific detection
Use primer and probe；
The nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'。
Wherein, the reaction mixture is the Premix Ex Taq of TaKaRa companies production（Probe qPCR）.
The water is the RNase-free Water of TaKaRa companies production.
A kind of PCR kit for fluorescence quantitative for preparing detection PRV, to contain any one of claim 2-4 institutes
The kit for the fluorescence quantitative PCR detection reagent stated.
The primer and probe or the reagent or the kit, in detection PRV or prepare detection pig puppet
Application in Rabies Virus Detection product.
In order to preferably realize foregoing invention purpose, it is used to detect the glimmering of PRV present invention also offers a kind of
Fluorescent Quantitative PCR detection method, the detection method include：
（1）Design and synthetic primer and probe；
Wherein, the nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'；
（2）The extraction of viral DNA and prepare positive plasmid standard items；
（3）The optimization of quantitative fluorescent PCR reaction condition is carried out, establishes fluorescence quantitative PCR detection system；
（4）Virus is detected using fluorescence quantitative PCR detection system.
Wherein, the step（2）Specially：
Extract the DNA of viscera tissue homogenate, viral cultures and serum respectively with the common extraction reagent kit of DNA/RNA nucleic acid, be dissolved in 20 μ
L RNase-free water, gained DNA can be directly used for quantitative fluorescent PCR or put -20 DEG C saving backup；
It is primer by standard PCR amplification PRV gE target gene using Primer F/R, connects after the recovered kits of product
PMD19-T carriers are connect, conversion is extremelyE.coliDH5 α Escherichia coli, it is plasmid to obtain positive colony plasmid by sequencing
Standard items；After determining DNA concentration, copy number is converted into, and be diluted to 1010copies•μL-1, -20 DEG C of preservations, made with preceding dilution
For plasmid standard.
The step（3）In, the reaction condition after optimization is： 95℃5min；94 DEG C of 15sec, 55 DEG C of 35sec, 40 are followed
Ring.
The step（3）In, the quantitative fluorescent PCR reaction system is 25 μ L altogether, containing 12.5 μ 2 × Premix of L Ex
Taq（Probe qPCR）, 10 μ L RNase-free water, 0.5 μ L Probe（10μM）, 0.5 μ L Primer F（10μM）,
0.5μL Primer R（10μM）, the μ L of plasmid standard 1.
The beneficial effects of the invention are as follows：The primer and probe of the present invention is according to PRV in GenBank
（Pseudorabies virus, PRV）A pair of the specific primers and a specificity T aqMan-MGB that sequences Design goes out are visited
Pin, establish a kind of TaqMan-MGB fluorescent quantitations that specific detection can be quickly and accurately carried out to PRV wild virus infections
PCR detection method, pass through the optimization to reaction condition and reaction system so that this method is 9.2 × 101~9.2 × 109
copies•μL-1There is good linear relationship, sensitivity reaches 9.2 × 10 in the range of template1copies•μL-1, it is Standard PCR
100 times of method.And compared with conventional PCR method, this method can be monitored in real time to its result, without further carrying out
Gel electrophoresis analysis.Quantitative fluorescent PCR reaction is carried out after measuring samples are extracted into DNA, can be in 2h rapidly and accurately to sample
PRV in product is detected, and can carry out qualitative detection, and can accurate quantitative analysis.Further, shown by experiment, utilize this
The fluorescent quantitation PRV detection methods of invention primer and probe structure, there is the advantage such as high specificity, high sensitivity, reproducible,
Quick, simplicity is provided for PRV early stage quick detection, and its epidemiology survey and prevention and the popular of control China PRV
With reliable technical tool.
Brief description of the drawings
Fig. 1 is the schematic diagram of PRV target gene PCR amplifications in the embodiment of the present invention 5；Wherein, M：DL2000
Marker；1-2：PRV；3：Negative control.
Fig. 2 is PRV TaqMan-MGB quantitative fluorescent PCR dynamic curve diagrams in the embodiment of the present invention 5；Wherein, 1-9 points
Wei not 9.2x109-9.2x101copies•μL-1Standard items.
Fig. 3 is PRV TaqMan-MGB quantitative fluorescent PCR canonical plottings in the embodiment of the present invention 5.
Fig. 4 is the schematic diagram of PRV TaqMan-MGB quantitative fluorescent PCR specific test results in the embodiment of the present invention 5；
Wherein, 1：Standard items；2-10 is respectively CSFV, PRRSV, PEDV, TGEV, RV, PPV, PCV2 and negative control.
Fig. 5 is the schematic diagram of PRV Standard PCR sensitivity tests results in the embodiment of the present invention 5；Wherein, M：DL2000
Marker；1-7：Dilution factor is 1.12 × 107-1.12×101copies•μL-1Template DNA.
Embodiment
The present invention is according to PRV in GenBank（PRV）GE gene orders design a pair of specific primers and one
Bar specificity T aqMan-MGB probes, establish a kind of quickly and accurately can carry out specific detection to PRV wild virus infections
TaqMan-MGB fluorescent quantitative PCR detection methods.Pass through the optimization to reaction condition and reaction system so that this method is 9.2
×101~9.2 × 109 copies•μL-1There is good linear relationship in the range of template, sensitivity reaches 9.2 ×
101copies•μL-1, it is 100 times of conventional PCR method.And compared with conventional PCR method, this method can be carried out to its result
Monitoring in real time, without further carrying out gel electrophoresis analysis.
For the technical characterstic for illustrating this programme can be understood, below by embodiment, this programme is illustrated.
The primer of embodiment 1 and probe
The embodiments of the invention provide one kind to be used for the wild malicious specific detection primer of PRV and probe, wherein：
The nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'；
The fluorescence quantitative PCR detection reagent of embodiment 2
It is described the embodiments of the invention provide a kind of fluorescence quantitative PCR detection reagent for being used to detect the wild poison of PRV
Reagent includes following components：Reaction mixture, water and for the wild malicious specific detection primer and probe of PRV；Its
In,
The nucleotide sequence of primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'。
Reaction mixture is the Premix Ex Taq of TaKaRa companies production（Probe qPCR）；Water is TaKaRa companies
The RNase-free Water of production.
The PCR kit for fluorescence quantitative of embodiment 3
The embodiments of the invention provide a kind of PCR kit for fluorescence quantitative for preparing the wild poison of detection PRV, it is specially
Kit containing the fluorescence quantitative PCR detection reagent of embodiment 2.
The fluorescent quantitative PCR detection method of embodiment 4
The embodiments of the invention provide a kind of fluorescent quantitative PCR detection method for being used to detect the wild poison of PRV, detection
Method includes：
（1）Design and synthetic primer and probe；
Wherein, the nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'；
（2）The extraction of viral DNA and prepare positive plasmid standard items；
（3）The optimization of quantitative fluorescent PCR reaction condition is carried out, establishes fluorescence quantitative PCR detection system；
（4）Virus is detected using fluorescence quantitative PCR detection system.
Wherein, the step（2）Specially：
Extract the DNA of viscera tissue homogenate, viral cultures and serum respectively with the common extraction reagent kit of DNA/RNA nucleic acid, be dissolved in 20 μ
L RNase-free water, gained DNA can be directly used for quantitative fluorescent PCR or put -20 DEG C saving backup；
It is primer by standard PCR amplification PRV gE target gene using Primer F/R, connects after the recovered kits of product
PMD19-T carriers are connect, conversion is extremelyE.coliDH5 α Escherichia coli, it is plasmid to obtain positive colony plasmid by sequencing
Standard items；After determining DNA concentration, copy number is converted into, and be diluted to 1010copies•μL-1, -20 DEG C of preservations, made with preceding dilution
For plasmid standard.
The step（3）In, the reaction condition after optimization is： 95℃5min；94 DEG C of 15sec, 55 DEG C of 35sec, 40 are followed
Ring.
The step（3）In, the quantitative fluorescent PCR reaction system is 25 μ L altogether, containing 12.5 μ 2 × Premix of L Ex
Taq（Probe qPCR）, 10 μ L RNase-free water, 0.5 μ L Probe（10μM）, 0.5 μ L Primer F（10μM）,
0.5μL Primer R（10μM）, the μ L of plasmid standard 1.
Embodiment 5 is applied
A kind of primer and probe or fluorescence quantitative PCR detection reagent or PCR kit for fluorescence quantitative are present embodiments provided, is used
It is specific as follows in the application of the wild malicious specific detection of PRV：
1 materials and methods
1.1 instruments and reagent
E.coli DH5 α are purchased from TaKaRa companies；CFX96 quantitative real time PCR Instruments are purchased from Bio-Rad companies；Uv-spectrophotometric
Meter is purchased from Thermo companies；Plasmid extraction kit is purchased from AxyGen companies；Extraction reagent kit is purchased from DNA/RNA nucleic acid altogether
Invitrogen companies；Premix Ex Taq（Probe qPCR）Purchased from TaKaRa companies；PMD19-T carriers are purchased from TaKaRa
Company.
1.2 design primer and probes
Specific primer pair and TaqMan-MGB fluorescence probes are specific as follows：
The sequence of primer pair is as follows：
Sense primer is Primer F:5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer is Primer R: 5' GCCATAGTTGGGTCCATTCG 3'；
Probe sequence is Probe: 5' FAM-CCGGAGAAACCGGAAG-MGB 3'.
The fluorescent reporter group of probe 5' ends mark is FAM, and 3' ends mark fluorescent quenching group is Non-
Fluorescent quencher and Minor Groove Binder (MGB).
It is prepared by the extraction of 1.3 viral DNAs and plasmid standard
With DNA/RNA nucleic acid, extraction reagent kit extracts viscera tissue homogenate, viral cultures and blood respectively by its operational manual altogether
Clear DNA, is dissolved in that 20 μ L RNase-free water, gained DNA can be directly used for quantitative fluorescent PCR or to put -20 DEG C of preservations standby
With.
Pass through standard PCR amplification PRV gE target gene, the recovered kits of product by primer of Primer F/R
PMD19-T carriers are connected afterwards, and conversion is extremelyE.coliDH5 α Escherichia coli, obtaining positive colony plasmid by sequencing is
Plasmid standard.After determining DNA concentration, copy number is converted into, and be diluted to 1010copies•μL-1, -20 DEG C of preservations, with preceding dilute
Release as plasmid standard.
The optimization of 1.4 quantitative fluorescent PCR reaction conditions
Using plasmid standard as template, Standard PCR reaction is carried out under different annealing temperature, amplified production passes through Ago-Gel
Electrophoresis is analyzed, it is determined that optimal primer annealing temperature.Application matrix method is entered to the primer and probe concentration of quantitative fluorescent PCR
Row optimization, to obtain optimal reaction system and reaction condition.
The foundation of 1.5 quantitative fluorescent PCR standard curves
It is 9.2x10 by 10 times of doubling dilutions of plasmid standard to concentration range1-9.2x109copies•μL-1.Each dilution factor
If 3 repetitions, fluorescence quantitative PCR detection is carried out, draws standard curve.
1.6 specific test
CSFV is extracted respectively（CSFV）, porcine reproductive and respiratory syndrome virus（PRRSV）, Porcine epidemic diarrhea virus
（PEDV）, transmissible gastro-enteritis virus（TGEV）, rotavirus（RV）, pig parvoviral（PPV）And porcine circovirus 2 type
（PCV2）Deng the nucleic acid of virus, the spy for carrying out detection checking this method to above-mentioned nucleic acid using the fluorescence quantifying PCR method of foundation
The opposite sex.
1.7 sensitivity tests
By 10 times of doubling dilution to least concentrations it is 1.12x10 by positive DNA1copies•μL-1, it is anti-to carry out quantitative fluorescent PCR
Should.Simultaneously using the DNA as template, Standard PCR reaction is carried out, upstream and downstream primer is respectively 5'CCGCGGGCCGTGTTCTTTGT
3' and 5'CGTGGCCGTTGTGGGTCAT 3'.The μ L of amplified production 10 are taken, are analyzed with 1.5% agarose gel electrophoresis,
Compare the difference of the two sensitiveness.
1.8 replica test
The replica test in 4 batches between batch is carried out respectively with the standard items plasmid of 5 kinds of concentration and is counted according to Ct values
Calculate the coefficient of variation.
The detection of 1.9 pairs of clinical samples
By new hope six and dynamic guarantor's suspicious 60 parts of PRV clinical samples of central collection, fluorescence quantitative PCR detection and routine are carried out respectively
PCR is detected, comparative analysis result.
2 results
The preparation of 2.1 plasmid standards
Pass through standard PCR amplification PRV gE target gene by primer of Primer F/R（Fig. 1）, the recovered kits of product
PMD19-T carriers are connected afterwards, and conversion is extremelyE.coli DH5 α Escherichia coli, obtaining positive colony plasmid by sequencing is
Plasmid standard.After determining DNA concentration, copy number is converted into, and be diluted to 1010copies•μL-1, -20 DEG C of preservations, with preceding dilute
Release as plasmid standard.
The optimization of 2.2 quantitative fluorescent PCR reaction conditions
By the optimization to annealing temperature and primer and concentration and probe concentration, the peak optimization reaction of fluorescence quantifying PCR method is finally determined
Condition.Quantitative fluorescent PCR reaction system is 25 μ L altogether, containing 12.5 μ L 2 × Premix Ex Taq（Probe qPCR）, 10 μ L
RNase-free water, 0.5 μ L Probe（10μM）, 0.5 μ L Primer F（10μM）, 0.5 μ L Primer R（10μM）,
The μ L of plasmid standard 1.Reaction condition is： 95℃5min；94 DEG C of 15sec, 55 DEG C of 35sec, 40 circulations.
The foundation of 2.3 quantitative fluorescent PCR standard curves
It is 9.2x10 to take concentration1-9.2x109copies•μL-1Standard items plasmid for template carry out fluorescent quantitative PCR simultaneously
Establish standard curve.From Fig. 2 and Fig. 3, linear relationship is good, and standard curve is successfully established, and is detected available for clinical sample.
2.4 specific test
CSFV, PRRSV, PEDV, TGEV, RV, PPV and PCV2 are detected with the fluorescence quantifying PCR method established, detected
Result is feminine gender, and these viral amplification curves are horizontal line, not up to detect threshold value（Fig. 4）, result of the test shows this
Method has good specificity.
2.5 sensitivity tests
The DNA profiling least concentration that fluorescence quantifying PCR method can detect is 9.2x101copies•μL-1（Fig. 2）, and Standard PCR
The template least concentration that can be detected is 1.12 × 104copies•μL-1（Fig. 5）, result of the test shows established fluorescent quantitation
The sensitiveness of PCR method is 100 times of conventional PCR method or so.
2.6 replica test
Carry out the replica test in batch between batch respectively with the standard items of 5 kinds of various concentrations.Result of the test shows, batch
The coefficient of variation of the interior replica test between batch is respectively less than 1.5%（Table 1）, show this method have good repeatability with it is steady
It is qualitative.
The PCR TaqMan-MGB quantitative fluorescent PCR replica test results of table 1
2.7 clinical sample testing results
To 60 parts of the suspicious PRV clinical samples of collection, fluorescence quantitative PCR detection and Standard PCR detection are carried out respectively.Testing result
Show, fluorescence quantifying PCR method positive rate（58.3%）Compare conventional PCR method（46.7%）It is higher（Table 2）.To clinical sample
Testing result show that fluorescent quantitation method has higher sensitiveness, be more suitable for the clinical detection of the wild poison of PRV, especially feel
When dye early stage viral level is relatively low.
The clinical sample testing result of table 2
To sum up, by it is above-mentioned by the primer of the present invention, probe application in the wild malicious specific detection of PRV and sample
As a result, it is possible to find out, using the primer of the present invention, the fluorescent quantitative PCR detection method of probe structure, with other swine disease virus nothings
Cross reaction, there is good specificity, sensitiveness is 100 times of conventional PCR method, and this method extracts measuring samples
Quantitative fluorescent PCR reaction is directly carried out after DNA, utilizes established fluorescence quantifying PCR method can be in 2h rapidly and accurately
PRV wild virus infections are detected, and qualitative detection, and can accurate quantitative analysis can be carried out.With high sensitivity, specificity
By force, the advantage such as reproducible, it is the laboratory diagnosis of PRV and investigates PRV in China swinery
Popularity provides fast and accurately detection means.
Presently preferred embodiments of the present invention is the foregoing is only, is not intended to limit the invention, it is all in the spirit and principles in the present invention
Within, any modification, equivalent substitution and improvements made etc., it should be included in the scope of the protection.
Claims (10)
1. for the wild malicious specific detection primer of PRV and probe, it is characterised in that
The nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'。
2. the fluorescence quantitative PCR detection reagent for detecting the wild poison of PRV, it is characterised in that the reagent include with
Lower component：Reaction mixture, water and for PRV specific detection primer and probe；
The nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'。
3. the fluorescence quantitative PCR detection reagent according to claim 2 for being used to detect the wild poison of PRV, its feature
It is, the reaction mixture is the Premix Ex Taq of TaKaRa companies production（Probe qPCR）.
4. the PCR detection reagents for being used to detect the wild poison of PRV according to Claims 2 or 3, it is characterised in that
The water is the RNase-free Water of TaKaRa companies production.
A kind of 5. PCR kit for fluorescence quantitative for preparing the wild poison of detection PRV, to contain any one of claim 2-4
The kit of described fluorescence quantitative PCR detection reagent.
6. primer as claimed in claim 1 and probe or as described in claim any one of 2-4 detection reagent or as right will
5 kits are sought, answering in the wild poison of detection PRV or the wild poison detection product of preparation detection PRV
With.
7. the fluorescent quantitative PCR detection method for detecting the wild poison of PRV, it is characterised in that the detection method bag
Include：
（1）Design and synthetic primer and probe；
Wherein, the nucleotide sequence of the primer is as follows：
Sense primer：5'CGGCTTCGACGTCTGGTT 3',
Anti-sense primer：5' GCCATAGTTGGGTCCATTCG 3'；
The probe sequence is as follows：
5' FAM-CCGGAGAAACCGGAAG-MGB 3'；
（2）The extraction of viral DNA and prepare positive plasmid standard items；
（3）The optimization of quantitative fluorescent PCR reaction condition is carried out, establishes fluorescence quantitative PCR detection system；
（4）Virus is detected using fluorescence quantitative PCR detection system.
8. the fluorescent quantitative PCR detection method according to claim 7 for being used to detect the wild poison of PRV, its feature
It is, the step（2）Specially：
Extract the DNA of viscera tissue homogenate, viral cultures and serum respectively with the common extraction reagent kit of DNA/RNA nucleic acid, be dissolved in 20 μ
L RNase-free water, gained DNA can be directly used for quantitative fluorescent PCR or put -20 DEG C saving backup；
It is primer by standard PCR amplification PRV gE target gene using Primer F/R, connects after the recovered kits of product
PMD19-T carriers are connect, conversion is extremelyE.coliDH5 α Escherichia coli, it is plasmid to obtain positive colony plasmid by sequencing
Standard items；After determining DNA concentration, copy number is converted into, and be diluted to 1010copies•μL-1, -20 DEG C of preservations, made with preceding dilution
For plasmid standard.
9. the fluorescent quantitative PCR detection method for being used to detect the wild poison of PRV according to claim 7 or 8, its
It is characterised by, the step（3）In, the reaction condition after optimization is： 95℃5min；94 DEG C of 15sec, 55 DEG C of 35sec, 40
Circulation.
10. the fluorescence quantitative PCR detection side for being used to detect the wild poison of PRV according to claim any one of 7-9
Method, it is characterised in that the step（3）In, the quantitative fluorescent PCR reaction system is 25 μ L altogether, containing 12.5 μ L 2 ×
Premix Ex Taq（Probe qPCR）, 10 μ L RNase-free water, 0.5 μ L Probe（10μM）, 0.5 μ L
Primer F（10μM）, 0.5 μ L Primer R（10μM）, the μ L of plasmid standard 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711233609.3A CN107828917A (en) | 2017-11-30 | 2017-11-30 | For detecting the wild malicious primer and probe of PRV, PCR kit for fluorescence quantitative and method, application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711233609.3A CN107828917A (en) | 2017-11-30 | 2017-11-30 | For detecting the wild malicious primer and probe of PRV, PCR kit for fluorescence quantitative and method, application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107828917A true CN107828917A (en) | 2018-03-23 |
Family
ID=61647095
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711233609.3A Pending CN107828917A (en) | 2017-11-30 | 2017-11-30 | For detecting the wild malicious primer and probe of PRV, PCR kit for fluorescence quantitative and method, application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107828917A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113136456A (en) * | 2021-04-25 | 2021-07-20 | 武汉科前生物股份有限公司 | Fluorescent quantitative PCR detection kit for identifying porcine pseudorabies virus gene deletion vaccine strain and wild strain |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831506A (en) * | 2010-04-14 | 2010-09-15 | 中国农业科学院哈尔滨兽医研究所 | Kit for authenticating deletion of vaccine strain and wild strain of PRVgE |
| CN103509877A (en) * | 2012-06-18 | 2014-01-15 | 武汉中博生物股份有限公司 | Fluorescence quantitative PCR kit used for detecting PRV, and application thereof |
| CN104388594A (en) * | 2014-12-09 | 2015-03-04 | 中国农业科学院兰州兽医研究所 | Taqman Real-time PCR kit for detecting porcine pseudorabies virus |
| CN104561374A (en) * | 2014-12-18 | 2015-04-29 | 河南省动物疫病预防控制中心 | Detection reagent and method for identifying porcine pseudorabies virus vaccine strain and wild strain |
| CN105624330A (en) * | 2014-11-28 | 2016-06-01 | 北京亿森宝生物科技有限公司 | Taqman-MGB fluorescent quantitative PCR kit and method for detecting 12 common viruses and bacteria of pig at same time |
-
2017
- 2017-11-30 CN CN201711233609.3A patent/CN107828917A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101831506A (en) * | 2010-04-14 | 2010-09-15 | 中国农业科学院哈尔滨兽医研究所 | Kit for authenticating deletion of vaccine strain and wild strain of PRVgE |
| CN103509877A (en) * | 2012-06-18 | 2014-01-15 | 武汉中博生物股份有限公司 | Fluorescence quantitative PCR kit used for detecting PRV, and application thereof |
| CN105624330A (en) * | 2014-11-28 | 2016-06-01 | 北京亿森宝生物科技有限公司 | Taqman-MGB fluorescent quantitative PCR kit and method for detecting 12 common viruses and bacteria of pig at same time |
| CN104388594A (en) * | 2014-12-09 | 2015-03-04 | 中国农业科学院兰州兽医研究所 | Taqman Real-time PCR kit for detecting porcine pseudorabies virus |
| CN104561374A (en) * | 2014-12-18 | 2015-04-29 | 河南省动物疫病预防控制中心 | Detection reagent and method for identifying porcine pseudorabies virus vaccine strain and wild strain |
Non-Patent Citations (2)
| Title |
|---|
| LESTER J PÉREZ等: "A multiple SYBR Green I-based real-time PCR system for the simultaneous detection of porcine circovirus type 2, porcine parvovirus, pseudorabies virus and Torque teno sus virus 1 and 2 in pigs", 《J VIROL METHODS》 * |
| 田云: "伪狂犬病病毒野毒荧光定量PCR 检测方法的建立", 《广东畜牧兽医科技》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113136456A (en) * | 2021-04-25 | 2021-07-20 | 武汉科前生物股份有限公司 | Fluorescent quantitative PCR detection kit for identifying porcine pseudorabies virus gene deletion vaccine strain and wild strain |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110760617B (en) | Real-time fluorescent PCR primer probe combination and kit for detecting African swine fever virus wild virus | |
| CN111020062A (en) | Triple real-time fluorescent quantitative PCR kit for detecting African swine fever wild strain and gene deletion strain | |
| CN107236824A (en) | A kind of fluorescent quantitation RT PCR kits and application for porcine reproductive and respiratory syndrome virus specific detection | |
| CN106048094B (en) | Dual real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit, primers and probe for porcine pseudorabies wild strains and gene-deleted strains | |
| CN108504778B (en) | Kit that is a kind of while detecting porcine circovirus 2 type and porcine pseudorabies virus and application | |
| CN107653348A (en) | For detecting the primer and probe of the type of pig circular ring virus 3, PCR kit for fluorescence quantitative and method, application | |
| CN103725794B (en) | Detect fluorescent quantitation RT PCR primers, probe and its method for PRRSV | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN108315483A (en) | A kind of combination for distinguishing the primer and probe of duck tembusu virus street strain and vaccine strain | |
| CN112795704A (en) | RAA primer pair, probe and kit for detecting porcine pseudorabies virus and application of RAA primer pair, probe and kit | |
| CN107460255A (en) | A kind of RT LAMP primers group, kit and application for detecting pig fourth type coronavirus | |
| CN105907890A (en) | Primers, probe and method for rapidly distinguishing HP-PRRS (High pathogenic porcine reproductive and respiratory syndrome) vaccine strain GDr180 from HP-PRRS wild strain | |
| CN109913591A (en) | A type Sai Nika virus fluorescent quantitative RT-PCR detection method and kit based on TaqMan probe method | |
| CN102212617B (en) | Primer pair, probe and kit for detecting classical swine fever virus wild strain | |
| CN105200162A (en) | HRM detection method for rapidly distinguishing HP-PRRS live vaccine JXA1-R strains and wild strains and primer of HRM detection method | |
| CN103725793A (en) | Multiple fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) and application thereof | |
| CN109234464A (en) | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of Seneca Valley virus | |
| CN108048600A (en) | A kind of fluorescent quantitative PCR detection method of infectious bovine rhinotrachetis virus | |
| CN105154584A (en) | HRM (high-resolution melting) label-free probe method, primer and probe for quickly differentiating PRRSV (porcine reproductive and respiratory syndrome virus) classical strains and mutant strains | |
| CN105779650A (en) | Triple fluorescent quantitative PCR primer, probe and kit for identifying pseudorabies virus strains | |
| CN107686865A (en) | Detect primer pair, probe, kit and the method for I type bovine herpes virus | |
| CN107828917A (en) | For detecting the wild malicious primer and probe of PRV, PCR kit for fluorescence quantitative and method, application | |
| CN109234465A (en) | For detecting the primer and probe, PCR kit for fluorescence quantitative and methods and applications of A type porcine rotavirus | |
| CN106119421A (en) | Fluorescent quantitation detection primer, probe and the test kit of pig blue-ear disease QYYZ strain | |
| CN107974516A (en) | For detecting primer and probe, the PCR kit for fluorescence quantitative and methods and applications of porcine circovirus 2 type |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180323 |