CN107828890A - A kind of fluorescence quantitative PCR detection system and its application for nephroblastoma gene screening - Google Patents
A kind of fluorescence quantitative PCR detection system and its application for nephroblastoma gene screening Download PDFInfo
- Publication number
- CN107828890A CN107828890A CN201711236839.5A CN201711236839A CN107828890A CN 107828890 A CN107828890 A CN 107828890A CN 201711236839 A CN201711236839 A CN 201711236839A CN 107828890 A CN107828890 A CN 107828890A
- Authority
- CN
- China
- Prior art keywords
- quantitative pcr
- gene
- risk
- nephroblastoma
- pcr detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The present invention relates to technical field of biological, particularly, is related to a kind of fluorescent quantificationally PCR detecting kit, and further discloses its application for being used to detect the nephroblastoma.Fluorescence quantitative PCR detection system of the present invention, including the detection kit to specific site gene, and the score of nephroblastoma risk is calculated to the value-at-risk of nephroblastoma risk according to each site, and carry out crowd's classification is gone according to existing database, the nephroblastoma risk class of individual is obtained by personal score, so as to assess the risk of person under inspection, guiding excessive risk person makes the life better mode, and avoids risk factor and increase physical examination frequency.At the same time, the present invention is laid a good foundation by establishing Chinese population database to 3 selected gene polymorphism sites to establish the distinctive nephroblastoma assessment of Chinese population.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a fluorescent quantitative PCR detection kit, and further discloses application of the kit in detecting a wilms tumor gene.
Background
With the continuous development of scientific research, after the human genome project is completed, the later genome project is fully developed, and the application of biotechnology taking genetic engineering as the leading factor in the field of cancer research is widely concerned. There have been preliminary advances in the study of tumor susceptibility using genetic theory and methods. Commonly used methods for gene detection are: direct Sequencing (DS), ligase Detection Reaction (LDR), restriction fragment length polymorphism analysis (RFLP), denaturing High Performance Liquid Chromatography (DHPLC), and quantitative PCR, where direct sequencing with a DNA analyzer is a gold standard, but the above methods have problems of high cost, low accuracy, cumbersome operation, and poor reproducibility, respectively. Real-time fluorescent quantitative nucleic acid amplification detection system (Real-time)
qPCR (Quantitative PCR) detection System, also called real-time Quantitative gene amplification fluorescent detection System, wherein fluorescent groups are added into a PCR reaction System in fluorescent Quantitative PCR (real time PCR) detection, the whole PCR process is monitored in real time by using fluorescent signal accumulation, and finally, an unknown template is subjected to Quantitative analysis through a standard curve. Therefore, the technology can be used for efficiently and accurately detecting the motion gene.
Single Nucleotide Polymorphisms (SNPs) refer to genetic markers formed by variation of a Single Nucleotide on a genome, including transitions, transversions, deletions and insertions, and are abundant in quantity and polymorphism. SNP is a third generation genetic marker, and many phenotypic differences of human bodies, susceptibility to drugs or diseases and the like can be related to SNP, and SNP research is an important step of the application of human genome planning. This is mainly because SNP will provide a powerful tool for the discovery of high-risk groups, identification of disease-related genes, drug design and testing, and basic research in biology. SNPs are quite widely distributed in the genome, and studies have shown that they occur every 300 base pairs in the human genome. The abundant presence of SNP sites gives people the opportunity to find genomic mutations associated with various diseases, including tumors; from the experimental operation, the discovery of disease-related gene mutation by SNP is easier than that by pedigree; some SNPs do not directly cause expression of disease genes, but are important markers because they are adjacent to some disease genes. SNP also plays a great role in basic research, and a series of important achievements are obtained in the fields of human evolution, human population evolution and migration through the analysis of Y chromosome SNP. SNPs are widely present in the human genome, with an average of 1 in every 500 to 1000 base pairs, and the total number is estimated to be 300 ten thousand or more.
The fluorescent quantitative PCR technology has been described in more and more documents, and most documents disclose specific detection of a plurality of single fragments by the fluorescent quantitative PCR technology
The method, however, finds that the detection of a single fragment is not enough to meet the detection requirements in the process of carrying out fluorescent quantitative PCR detection on SNP sites by the inventor, and needs repeated detection for comprehensive detection with two or more SNP sites, and the steps are complicated and the operation time is long.
Nephroblastoma (Nephroblastoma) also known as Wilms' tumor was first reported by Rance in 1814 and was pathologically described in detail by Wilms in 1899, and was therefore named Wilms tumor. Is one of the most common malignant solid tumors in childhood, is mostly seen in children under 5 years old, and has the incidence rate of about 1/10000. The common metastatic sites of tumors are lung, lymph node and liver, and rarely occur in bone, bone marrow and brain. C Turnbull and E Perdeaux et al, 2012, showed that certain genetic loci are associated with Wilms' tumor, and that mutations at certain genetic loci may cause nephroblastoma to occur.
In the existing research on the nephroblastoma gene, the sites are strong association sites obtained based on the research on the large sample volume GWAS of European population, and when the sites are applied to Asian population, especially Chinese population, the site association is weak, and more accurate results are difficult to obtain through detection, so that the establishment of an evaluation system of Chinese population is very necessary.
Disclosure of Invention
The invention provides a fluorescent quantitative PCR detection kit for nephroblastoma gene screening, and further discloses application of the kit in the field of nephroblastoma gene screening.
In order to achieve the purpose, the invention provides the application of the fluorescent quantitative PCR detection system in preparing a nephroblastoma gene screening system.
The invention also discloses a fluorescent quantitative PCR detection system for screening the wilms' tumor genes, which comprises a fluorescent quantitative PCR detection kit for detecting the genes to be detected and a detection result contrast evaluation system; the detection result comparison and evaluation system comprises a detection result processing system corresponding to the site and a reference database; the fluorescent quantitative PCR detection kit comprises a fluorescent quantitative PCR detection reagent for detecting at least two wilms tumor related gene loci.
The related loci detected by the fluorescent quantitative PCR comprise locus rs3755132, locus rs807624 and locus rs 790356.
The structure of the sequences of the primers and the probes for detecting the gene locus of the nephroblastoma is shown in the following table:
the reference database takes the east Asia population genome data in the thousand human genomes as the level of common population, and the detection result is collected into the database in real time.
The detection result contrast evaluation system corresponds the fluorescence quantitative PCR detection result of the gene to be detected to the risk level, wherein the risk value P of the gene to be detected is the product of a plurality of detection gene loci, and the average risk value is P a And the average variance is S, and the risk level of the gene to be detected is judged according to the S:
p is greater than or equal to Pa +0.6S and is a high risk level;
the higher risk level is that P is more than or equal to Pa +0.2S and less than Pa + 0.6S;
Pa-0.2S is more than or equal to P and less than Pa +0.2S is a general risk level;
Pa-0.6S is more than or equal to P and less than Pa-0.2S is a lower risk level;
p < Pa-0.6S is a low risk level.
Further, the mean variance S is calculated as follows:
wherein i is the number of detection sites of the gene to be detected;
the average risk value Pa is the genome data of the east Asian population, and the calculation formula of Pa is as follows:
wherein the total number of people is N.
The invention also discloses application of the fluorescent quantitative PCR detection system in the field of nephroblastoma gene screening.
The invention also discloses a method for screening the gene of the nephroblastoma based on a fluorescent quantitative PCR method, which comprises the step of carrying out fluorescent quantitative PCR detection on the gene related to the nephroblastoma by using the fluorescent quantitative PCR detection system of the claim, wherein the sites for the fluorescent quantitative PCR detection comprise sites rs3755132, rs807624 and rs 790356.
Preferably, the method for detecting a wilms tumor gene based on a fluorescence quantitative PCR method comprises the following steps:
(1) Amplification of a sample to be detected: according to the structure of the gene locus to be detected, a single fluorescence labeling probe is adopted, a primer and a probe sequence of a sample to be detected are designed, and PCR amplification is carried out;
(2) Sample detection: detecting the amplified sites through a melting curve peak pattern graph to obtain a detection result of the corresponding sites;
(3) Processing according to the detection result, obtaining the risk value of the gene to be detected after counting the risk points of each site, and corresponding to the risk level in the reference database;
(4) And comprehensively obtaining the gene risk and the related processing result according to the corresponding grade of the detection result.
The invention has the following beneficial effects:
the fluorescence quantitative PCR detection system comprises a detection kit for genes at specific sites, calculates the risk score of the nephroblastoma according to the risk value of each site to the nephroblastoma risk, carries out population classification according to the existing database, and obtains the individual nephroblastoma risk level through the individual score, thereby evaluating the disease risk of a detected person, guiding a high-risk person to improve the life style, avoiding induction factors and increasing the physical examination frequency. Meanwhile, the invention establishes a Chinese population database for the selected 3 gene polymorphic sites, thereby laying a foundation for establishing specific nephroblastoma evaluation of Chinese population.
The fluorescent quantitative PCR detection system can evaluate the risk related to the wilms' tumor of the detected person. The detection kit provided by the invention has the advantages of strong specificity, high detection rate, high efficiency and low cost, can comprehensively detect and analyze whether a detected population carries the nephroblastoma susceptibility gene, evaluates the risk of suffering from the nephroblastoma, screens the susceptible population from a common population, gives an individualized guide suggestion, changes bad living habits and achieves the purpose of prevention.
Drawings
Fig. 1 shows the result of the test for the test sample site rs3755132 according to the embodiment;
FIG. 2 shows the result of sequencing the rs3755132 sample site according to the embodiment;
FIG. 3 is a diagram illustrating the results of an rs807624 test on the site of a test sample according to an embodiment;
FIG. 4 shows the result of the rs807624 test on the site of the test sample according to the embodiment;
FIG. 5 is a diagram illustrating the results of an rs790356 assay at a test sample site according to an embodiment;
FIG. 6 shows the results of the rs790356 assay at the test sample site according to the embodiment;
FIG. 7 is a flow chart of the evaluation based on the test results of the test samples.
Detailed Description
In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with figures are described in further detail below.
Example 1
In this embodiment, a nephroblastoma fluorescence quantitative PCR detection kit is used to detect a nephroblastoma-related gene, wherein 3 polymorphic sites on three nephroblastoma-related genes are detected, including rs3755132, rs807624, and rs790356 sites, for a total of 3 sites. The primers and the probes designed specifically are utilized to optimize an amplification system and conditions, and the detection of 3 polymorphic sites on three genes is completed simultaneously in the same system.
In this example, a single fluorescence-labeled probe was used to perform480, and finally detecting rs3755132, rs807624 and rs790356 sites through a melting curve peak pattern.
Specifically, in the dual fluorescence quantitative PCR detection method of the rs3755132, rs807624 and rs790356 loci, the design of primers and probes for the rs3755132, rs807624 and rs790356 loci is shown in table 1 below.
TABLE 1 primer and Probe design
Reagent reaction systems shown in the following tables 2-4 are respectively designed for the rs3755132, rs807624 and rs790356 loci:
TABLE 2 locus rs3755132 system
TABLE 3 locus rs807624 system
TABLE 4 locus rs790356 system
The rs3755132, rs807624 and rs790356 loci were subjected to PCR amplification, and PCR reaction program (cycle) setting parameters were designed as shown in table 3 below.
TABLE 5 PCR reaction parameter settings
And carrying out PCR amplification on the rs3755132, rs807624 and rs790356 loci according to the designed PCR parameters of the primers and the kit, and detecting the amplification result, wherein the detection results are respectively shown in figures 1-6.
In the test results shown in FIGS. 1 to 6:
the experimental result of the rs3755132 detection sample point position is TT, and the reaction chain is AA;
detecting the sequencing result of the sample site rs3755132 as AA;
detecting the result of the rs807624 test of the sample site as TT;
detecting the sequencing result of the sample site rs807624 as TT;
the detection sample site rs790356 has the experimental result of GG;
detecting that the sequencing result of the rs790356 sample site is GG;
and the sequencing is used for rechecking, so that the experimental method is proved to have accuracy and reliability.
Example 2
The 3 sites in example 1 are from C Turnbull and E Perdeaux, etc., which have been published and used for GWAS study to find three susceptible sites directly related to wilms' tumor and calculate risk value of risk allelic type, OR value, of the three sites. GWAS studies have found that genetic variation in the 2p24 and 11q14 genes may be associated with nephroblastoma development. To investigate the relationship between genetic variation and nephroblastoma, C Turnbull and E Perdeaux et al identified the genes of 1879 million normal individuals in 757 patients with nephroblastoma by comparison. The two genes 2p24 and 11q14 have strong relevance to the onset of nephroblastoma.
The 3 sites were evaluated, and the different genotypes and their risk values (OR) were: the OR values of GG-TG-TT genotypes at the locus rs3755132, rs807624 and rs790356 of the 2p24 gene are respectively 2.19-1.48-1; the OR values of the TT-GT-GG genotypes of the rs807624 locus are respectively 1.77-1.33-1; the OR values of GG-AG-AA genotypes at the rs790356 locus of the 11q14 gene locus are respectively 2.04-1.43-1.
Since the incidence of nephroblastoma is less than 10%, the OR value approximates the RR value, i.e. the risk value. The risk value of each locus is calculated according to the genotype, namely the risk value of the homozygous risk allele is the square of the OR value, the risk value of the heterozygous risk allele is the OR value, the homozygous non-risk allele is 1, each SNP locus has a susceptibility value according to the detected genotype for a subject, and the score is defined as S, so that the susceptibility value of the individual nephroblastoma of the subject is P, and the P value is the product of the OR values of the two genotypes:
according to the gene detection result, the risk of the individual nephroblastoma is evaluated, and a nephroblastoma susceptibility database of Chinese population is established.
The genome data of east Asia population in thousands of genomes is taken as the common population level, and the total population is defined as N. The average genotype of east Asia population in the genome of thousands of people is set as the average score of population:
wherein the total number of the crowd is N.
And calculating the mean variance，
Classifying the nephroblastoma risk values of east Asia population according to Pa and S, and corresponding the individual nephroblastoma risk value P of the examined person to the population classification, wherein the population classification has five levels, namely five risk levels of high-slightly high-general-slightly low-low, and specifically comprises the following steps:
p is greater than or equal to Pa +0.6S and is a high risk level;
pa +0.2S is less than or equal to P and less than Pa +0.6S, which is a slightly higher risk level;
the general risk level is that P is more than or equal to Pa-0.2S and less than Pa +0.2 SC;
the risk level is slightly lower when the P is more than or equal to Pa-0.6S and less than the Pa-0.2S;
p < Pa-0.6S is a low risk level.
Based on the risk level of the wilms' tumor sites divided by the east Asia population, the high risk level is the P value more than or equal to 0.25, the higher risk is the P value more than or equal to 0.22 and less than 0.25, the general risk is the P value more than or equal to 0.19 and less than 0.22, the lower risk is the P value more than or equal to 0.15 and less than 0.19, and the low risk is the P value less than 0.15.
As shown in FIG. 7, the individual susceptibility values, i.e., the individual risk values, of wilms were obtained by multiplying the OR values of the two terms according to the results of the gene tests. Correspondingly obtaining the individual risk level of the nephroblastoma by a grading method, and comprehensively obtaining the risk of the nephroblastoma of the examinee according to the level corresponding to the P value of the examinee, thereby providing an individual health management scheme.
Example 3
The results of the following test subjects are shown in table 6 below.
The rs3755132 genotype of a 2p24 region of a certain subject is TT, and the corresponding OR value is 1; the rs807624 genotype of the 2p24 region is GT, corresponding to an OR value of 1.33; the rs790356 genotype of the 2p24 region is AG, corresponding to an OR value of 1.43. The OR values mentioned above are from literature studies at NCBI.
The subject's individual osteosarcoma susceptibility value P =1 × 1.33 × 1.43=1.9019 was calculated.
TABLE 6 Gene test results of the subjects
| rs3755132 | rs807624 | rs790356 | |
| Subject of the invention | TT | GT | AG |
| HG00403 | TT | GT | GG |
| HG00404 | TG | TT | GG |
| HG00406 | TT | TT | GG |
There are 504 in thousand people's genome databaseThe average genotype P of the loci of the east Asian population is calculated by the same calculation as that of the other east Asian population, such as the human HG00403 with P =1 × 1.33 × 2.04 =2.7132 a =3.56, mean variance =1.43.
The subject P<P a -0.6s =3.56-0.6 x 1.43, so the wilms risk rating is low, so the wilms risk rating of the subject is lower than or equal to the general risk rating, but does not represent that the subject must not suffer from such a disease, thus suggesting that the subject continues to maintain optimistic mood, and a healthy lifestyle, a routine physical examination every year.
The sequence of the above embodiments is only for convenience of description and does not represent the advantages and disadvantages of the embodiments.
Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, and not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Sequence listing
<110> Shenzhen Mei Yuan clinical laboratory institute Limited
<120> fluorescent quantitative PCR detection system and method for detecting wilms tumor gene
<130> MY17018P
<160> 9
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> unknown
<220>
<230> rs 3755132F-terminal primer
<400> 1
cttctcagagcagtccttacg 21
<210> 2
<211> 22
<212> DNA
<213> unknown
<220>
<230> rs 3755132R terminal primer
<400> 2
gctatgatggtgtcactgtact 22
<210> 3
<211> 25
<212> DNA
<213> unknown
<220>
<230> rs3755132 probe sequence
<400> 3
ttctcagagtagttccctgaaatgc 25
<210> 4
<211> 22
<212> DNA
<213> unknown
<220>
<230> rs 807624F terminal primer
<400> 4
ctctccagtcacaaattccatc 22
<210> 5
<211> 21
<212> DNA
<213> unknown
<220>
<230> rs 807624R end primer
<400> 5
ccaatgcagatcaagctgaat 21
<210> 6
<211> 23
<212> DNA
<213> unknown
<220>
<230> rs807624 probe sequence
<400> 6
cctgagattgagtgtattaccct 23
<210> 7
<211> 21
<212> DNA
<213> unknown
<220>
<230> rs 790356F-terminal primer
<400> 7
aaggcagagaaactacggatt 21
<210> 8
<211> 22
<212> DNA
<213> unknown
<220>
<230> rs 790356R end primer
<400> 8
tcagaggaagattggaacagaa 22
<210> 9
<211> 24
<212> DNA
<213> unknown
<220>
<230> rs790356 probe sequence
<400> 9
tgcttcatcaagtgattactggtt 24
Claims (10)
1. The fluorescent quantitative PCR detection system is used for preparing a nephroblastoma gene screening system.
2. A fluorescent quantitative PCR detection system for screening wilms' tumor genes is characterized in that the detection system comprises a fluorescent quantitative PCR detection kit for detecting genes to be detected and a detection result contrast evaluation system; the detection result comparison and evaluation system comprises a detection result processing system corresponding to the site and a reference database;
the fluorescent quantitative PCR detection kit comprises a fluorescent quantitative PCR detection reagent for detecting at least two wilms tumor related gene loci.
3. The fluorescent quantitative PCR detection system for nephroblastoma gene screening of claim 2, characterized in that the relevant sites for fluorescent quantitative PCR detection include the rs3755132, rs807624 and rs790356 sites.
4. The fluorescence quantitative PCR detection system for nephroblastoma gene screening of claim 3, wherein the primer and probe sequence structure for detecting the nephroblastoma gene site is shown in the following table:
5. the fluorescent quantitative PCR detection system for wilms' tumor gene screening according to any one of claims 2-4, wherein the reference database takes the genome data of east Asian population in thousand human genomes as the common population level, and the detection result is collected into the database in real time.
6. According to claim2-5, wherein the detection result contrast evaluation system corresponds the fluorescence quantitative PCR detection result of the gene to be detected to a risk level, wherein the risk value P of the gene to be detected is the product of a plurality of detection gene sites, and the average risk value P is P a And the average variance is S, and the risk level of the gene to be detected is judged according to the average variance:
p is greater than or equal to Pa +0.6S and is a high risk level;
pa +0.2S is more than or equal to P and less than Pa +0.6S is a higher risk level;
the general risk level is that P is more than or equal to Pa-0.2S and less than Pa + 0.2S;
the lower risk level is that P is more than or equal to Pa-0.6S and less than Pa-0.2S;
p < Pa-0.6S is a low risk level.
7. The fluorescent quantitative PCR detection system for nephroblastoma gene screening of claim 4, wherein:
the mean variance S is calculated as follows:
wherein i is the number of detection sites of the gene to be detected;
the average risk value Pa is the genome data of the east Asian population, and the calculation formula of Pa is as follows:
wherein the total number of people is N.
8. Use of the fluorescent quantitative PCR detection system of any one of claims 2-7 in the field of nephroblastoma gene screening.
9. A method for screening wilms tumor genes based on a fluorescence quantitative PCR method, which is characterized by comprising the step of carrying out fluorescence quantitative PCR detection on wilms tumor related genes by using the fluorescence quantitative PCR detection system of any one of claims 2-7, wherein the sites for fluorescence quantitative PCR detection comprise rs3755132, rs807624 and rs790356 sites.
10. The method for detecting a wilms tumor gene based on the fluorescent quantitative PCR method according to claim 9, comprising the steps of:
(1) And (3) amplification of a sample to be detected: according to the structure of the gene locus to be detected, a single fluorescence labeling probe is adopted, and a primer and a probe sequence of a sample to be detected are designed for PCR amplification;
(2) Sample detection: detecting the amplified sites through a melting curve peak pattern graph to obtain a detection result of the corresponding sites;
(3) Processing according to the detection result, counting the risk points of each site to obtain the risk value of the gene to be detected, and corresponding to the risk level in the reference database;
(4) And comprehensively obtaining the gene risk and the related processing result according to the corresponding grade of the detection result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711236839.5A CN107828890A (en) | 2017-11-30 | 2017-11-30 | A kind of fluorescence quantitative PCR detection system and its application for nephroblastoma gene screening |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711236839.5A CN107828890A (en) | 2017-11-30 | 2017-11-30 | A kind of fluorescence quantitative PCR detection system and its application for nephroblastoma gene screening |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107828890A true CN107828890A (en) | 2018-03-23 |
Family
ID=61646683
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711236839.5A Pending CN107828890A (en) | 2017-11-30 | 2017-11-30 | A kind of fluorescence quantitative PCR detection system and its application for nephroblastoma gene screening |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107828890A (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120142654A1 (en) * | 2010-12-06 | 2012-06-07 | Medizinische Hochschule Hannover | Prognostic marker for mamma carcinoma |
| CN102912018A (en) * | 2012-09-29 | 2013-02-06 | 童永清 | Kit for detecting expression index of mRNA (messager Ribose Nucleic Acid) of WT1 (Wilms Tumor 1) gene |
| CN103710436A (en) * | 2013-12-06 | 2014-04-09 | 吉林艾迪康医学检验所有限公司 | Method and primer for detection of polymorphic site of seventh exon of WT1 gene |
| CN104937112A (en) * | 2013-01-22 | 2015-09-23 | 大塚制药株式会社 | Quantification method for expression level of WT1 mRNA |
| CN106868126A (en) * | 2017-02-20 | 2017-06-20 | 深圳美因临床检验所有限公司 | Fluorescent quantificationally PCR detecting kit and detection method |
-
2017
- 2017-11-30 CN CN201711236839.5A patent/CN107828890A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120142654A1 (en) * | 2010-12-06 | 2012-06-07 | Medizinische Hochschule Hannover | Prognostic marker for mamma carcinoma |
| CN102912018A (en) * | 2012-09-29 | 2013-02-06 | 童永清 | Kit for detecting expression index of mRNA (messager Ribose Nucleic Acid) of WT1 (Wilms Tumor 1) gene |
| CN104937112A (en) * | 2013-01-22 | 2015-09-23 | 大塚制药株式会社 | Quantification method for expression level of WT1 mRNA |
| CN103710436A (en) * | 2013-12-06 | 2014-04-09 | 吉林艾迪康医学检验所有限公司 | Method and primer for detection of polymorphic site of seventh exon of WT1 gene |
| CN106868126A (en) * | 2017-02-20 | 2017-06-20 | 深圳美因临床检验所有限公司 | Fluorescent quantificationally PCR detecting kit and detection method |
Non-Patent Citations (2)
| Title |
|---|
| JUNJIRO OHSHIMA等: "Two Candidate Tumor Suppressor Genes, MEOX2 and SOSTDC1, Identified in a 7p21 Homozygous Deletion Region in a Wilms Tumor", 《GENES,CHROMOSOMES & CANCER》 * |
| 林彩侠等: "神经母细胞瘤、多形性胶质母细胞瘤、尤文肉瘤及肾母细胞瘤中全基因组关联分析计量和热点研究", 《肿瘤学杂志》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106868126B (en) | Fluorescent quantitative PCR detection kit and detection method | |
| Padmanabhan et al. | Towards precision medicine for hypertension: a review of genomic, epigenomic, and microbiomic effects on blood pressure in experimental rat models and humans | |
| CN106834474B (en) | Utilize gene order-checking diagnosing fetal chromosomal aneuploidy | |
| EP3597769A1 (en) | Second generation sequencing-based method for simultaneously detecting microsatellite locus stability and genomic changes | |
| CN103403182B (en) | The heredity relevant to cancer or the detection of molecular distortion | |
| Lujan et al. | Ultrasensitive deletion detection links mitochondrial DNA replication, disease, and aging | |
| JP2022514879A (en) | Cell-free DNA terminal characteristics | |
| CN105143466A (en) | Maternal plasma transcriptome analysis by massively parallel RNA sequencing | |
| US20210407623A1 (en) | Determining tumor fraction for a sample based on methyl binding domain calibration data | |
| EP3859010A1 (en) | Second generation sequencing-based method for detecting microsatellite stability and genome changes by means of plasma | |
| CN113450871A (en) | Method for identifying sample identity based on low-depth sequencing | |
| JP2015089364A (en) | Cancer diagnostic method by multiplex somatic mutation, development method of cancer pharmaceutical, and cancer diagnostic device | |
| CN110004229A (en) | Application of the polygenes as EGFR monoclonal antibody class Drug-resistant marker | |
| CN107723370A (en) | A kind of fluorescence quantitative PCR detection system and its application for nasopharyngeal carcinoma gene screening | |
| CN116083562B (en) | SNP marker combination and primer set related to aspirin resistance auxiliary diagnosis and application thereof | |
| CN112342303A (en) | NGS-based human Y chromosome STR and SNP genetic marker combined detection system and detection method | |
| CN107828890A (en) | A kind of fluorescence quantitative PCR detection system and its application for nephroblastoma gene screening | |
| CN114517223B (en) | Method for screening SNP loci and application thereof | |
| CN107988364A (en) | A kind of fluorescence quantitative PCR detection system and its application for gallbladder cancer gene screening | |
| WO2022231449A1 (en) | Circulating noncoding rnas as a signature of autism spectrum disorder symptomatology | |
| CN108342483B (en) | Group of genes for molecular typing of non-hyper-mutant colorectal cancer and application thereof | |
| CN107893107A (en) | A kind of fluorescence quantitative PCR detection system and its application for melanoma gene screening | |
| CN113355401A (en) | NGS-based CNV analysis and detection method for glioma chromosomes | |
| CN107746882A (en) | A kind of fluorescence quantitative PCR detection system and its application for osteosarcoma gene screening | |
| KR20100069670A (en) | 3.4 kb mitochondrial dna deletion for use in the detection of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180323 |
|
| RJ01 | Rejection of invention patent application after publication |