CN107827954B - VP53B and VP110 antibody and application thereof in preparation of medicine for preventing and treating white spot syndrome - Google Patents

Abstract

The invention relates to VP53B and VP110 antibodies and application thereof in preparation of a medicine for preventing and treating white spot syndrome. The invention obtains partial protein fragments of VP53B and VP110 by screening, produces polyclonal antibody, and adopts prawn White Spot Syndrome Virus (WSSV) envelope protein antibody neutralization experiment to confirm that the polyclonal antibody of VP53B and VP110 can obviously inhibit the oral infection capability of WSSV virus, especially the polyclonal antibody protection rate of VP53B is as high as 85%. In addition, the two polyclonal antibodies have a synergistic effect. The invention provides a new medicine for preventing and treating white spot syndrome of prawns, and can effectively prevent infection and spread of WSSV.

Description

VP53B and VP110 antibody and application thereof in preparation of medicine for preventing and treating white spot syndrome

Technical Field

The invention relates to the field of disease prevention and treatment of aquaculture, in particular to VP53B and VP110 antibodies and application thereof in preparation of a medicine for preventing and treating white spot syndrome.

Background

The white spot syndrome of prawns is a common explosive epidemic disease in the prawn breeding industry, and has the characteristics of wide spread host, high lethal speed, high lethal rate and the like. White Spot Syndrome Virus (WSSV) is the causative agent of White Spot syndrome virus. The host range specifically includes about 98 kinds of crustaceans including prawn, crayfish, etc. Symptoms following WSSV infection of the host include: anorexia usually occurs on water surface, and white spots, weakness of appendages, and fading of liver and pancreas appear on part of the body surface of the host. After WSSV infects the prawns, the prawns can be killed within three to seven days, and the death rate is close to 100 percent.

White spot syndrome causes huge losses to the world shrimp farming industry. Since the outbreak in china in the early nineties, white spot syndrome has been continuously outbreaked in asia, america, europe and other countries. Relevant statistics show that economic losses due to outbreaks of white spot syndrome have reached $ 80-150 billion, and that the losses have increased at a rate of $ 10 billion per year, accounting for one-tenth of the annual production of shrimp farming in the world. However, to date, there has been no relatively effective method to control WSSV.

With the progress of research on WSSV, the knowledge of WSSV has been deepened gradually. At present, the virus structure, the virus host range and the virus classification of WSSV virus are deeply understood.

Structural features and classification of WSSV virions: WSSV virus particles are long-rod-shaped, have no inclusion body, have a flagella-like attachment structure at the tail, and the function of the structure is not clear. The virus particle has a length of about 250nm-330nm and a width of about 80-120nm, and is double-stranded DNA virus. The structure of the virus particle comprises three parts from outside to inside, including a three-layer capsule membrane structure, a bridging structure and a nucleocapsid structure. Since the WSSV particle is similar in shape to baculovirus, it was originally thought to belong to baculovirus (Baculoviridae). Later, the international committee for virus classification divided it into unique species of the genus Whispovirus of the family Nimaviridae. The Whispovirus genus is a newly divided virus genus, and with the deep research on virus classification, more and more viruses are possibly divided into the genus, and potential virus species thereof include B virus, B1 virus, Tau virus, Baculo-A virus and Baculo-B virus.

The research on the role of WSSV envelope protein in virus infection progresses: the structural proteins of WSSV generally divide three proteins, i.e., envelope protein, bridging protein, and nucleocapsid protein, according to their difference in viral location. It is generally believed that the envelope protein of a virus often plays a significant role in the viral infection process by being able to act directly on the receptor-associated cell. Therefore, the research on WSSV envelope proteins has become a hot spot in the field of WSSV research. WSSV envelope proteins identified at present are more than 33, and comprise VP12B, VP13B, VP14, VP19, VP28, VP31, VP32, VP33, VP37, VP38A, VP39B, VP41A, VP41B, VP51A, VP51B, VP53A, VP53B, VP60A, VP68, VP90, VP110, VP124, VP180, VP187, VP281, VP466 and the like. Wherein, VP28 is about 60% of WSSV envelope protein and is the main envelope protein of WSSV. In contrast, the functional study of VP28 protein is also more intensive. The next most studied are VP14, VP19 and VP 37.

Although there have been preliminary studies and researches on WSSV envelope proteins, people find that some envelope proteins participate in the infection process of WSSV and find corresponding receptors in shrimp bodies, however, WSSV viruses are special, and almost no other viruses have homology with the WSSV viruses, which causes certain difficulties in the research of the structure and the functionality of the WSSV envelope proteins. So far, the functions of a plurality of envelope proteins of WSSV in the virus infection process are still unknown. Various WSSV envelope proteins are tried, whether the WSSV virus is a silent receptor protein or is embedded by a protein antibody, or the WSSV virus is directly used as an oral vaccine for immunization, and no ideal result is obtained in WSSV oral infection neutralization experiments. Therefore, the direct interaction between the protein of WSSV and the receptor needs to be further researched, so that the most critical envelope protein in the oral infection of WSSV can be found, and a corresponding small molecule drug can be prepared so as to block the protein, thereby achieving the purpose of inhibiting the oral infection of WSSV.

VP53B and VP110 are two envelope proteins of WSSV with molecular weights of 53kDa and 110kDa, respectively, and their functions are not completely clear. Related researches show that VP53B and VP110 can be combined with chitin binding protein in prawn body, and meanwhile, VP110 has certain combination effect with arginine kinase and actin. The VP53B open reading frame was wsv115, with a theoretical molecular weight of 108kDa and an actual molecular weight on the virion of 53 kDa. In 2007, Li confirmed that VP53B is a WSSV envelope protein by the iTRAQ technique. Proteomics analysis speculates that VP53B is associated with ion conduction pathways. In 2007 Chen discovered that VP53B could bind to PmCBP by means of yeast two-hybrid. And the PmCBP is obviously up-regulated in the later period of WSSV infection of the prawn, so that VP53B is speculated to participate in the WSSV infection process.

Patent document CN1831009A, published japanese patent No. 2006.09.13, clones polynucleotide sequences encoding WSSV membrane proteins VP68, VP28, and VP466 into plasmid vector pGEX4T-2, transfects into escherichia coli, induces expression of fusion proteins VP68, VP281, and VP466 of WSSV membrane proteins, immunizes mice with purified fusion proteins VP68, VP281, and VP466, respectively, prepares specific polyclonal antibodies against VP68, VP281, and VP466, and demonstrates that these antibodies have the ability to resist WSSV infection by an antiviral experiment performed by subcutaneous intramuscular injection.

In general, the effects of VP53B and VP110 in WSSV infection are not clear, and no reports about the preparation of a medicament for preventing and treating white spot syndrome by using VP53B and VP110 antibodies, especially an oral medicament, are found.

Disclosure of Invention

The invention aims to overcome the defects in the prior art, and provides VP53B, VP110, antibodies thereof and application of the antibodies in preparation of medicines for preventing and treating white spot syndrome.

In a first aspect, the invention provides an isolated polypeptide, the amino acid sequence of which comprises the sequence shown in SEQ ID No. 1.

In a second aspect, the invention provides application of the polypeptide in preparing a medicament for preventing and treating white spot syndrome.

In a third aspect, the invention provides an antibody specifically against VP53B of white spot syndrome virus, wherein the antibody is obtained by immunizing an animal with a polypeptide as described above.

As a preferred example, the antibody is a polyclonal antibody.

In a fourth aspect, the invention provides an application of the antibody in preparing a medicine for preventing and treating white spot syndrome.

In a fifth aspect, the invention provides a pharmaceutical composition for preventing and treating white spot syndrome, wherein the pharmaceutical composition comprises the antibody.

As a preferred example, the pharmaceutical composition further comprises an antibody specifically directed against the polypeptide shown in SEQ ID NO. 4.

As a preferred example, the dosage form of the pharmaceutical composition is an oral dosage form.

In a sixth aspect, the present invention provides a method of producing an antibody, said method comprising the step of immunizing an animal with a polypeptide as described above.

In a seventh aspect, the present invention provides a polynucleotide encoding a polypeptide as described above.

In the present application, the term "polypeptide" refers to a polymer of amino acid residues. Peptides, oligopeptides, dimers, polymers, and the like are included in this definition. The term also includes post-expression modifications of the polypeptide, such as glycosylation, acetylation, phosphorylation, and the like. The present application also includes analogs of the polypeptides, which preferably include substitutions that are conservative in nature, i.e., substitutions that occur in a class of amino acids with respect to their side chains. Specifically, amino acids are generally classified into four types: (1) acidic-aspartic acid and glutamic acid; (2) basic-lysine, arginine, histidine; (3) nonpolar-alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; (4) uncharged polarities glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Phenylalanine, tryptophan, and tyrosine are sometimes classified as aromatic amino acids. For example, it is reasonable to predict: replacement of leucine with isoleucine or valine alone, aspartic acid with glutamic acid, threonine with serine, or a similarly conserved amino acid with a structurally related amino acid, would not have a significant effect on biological activity. An isolated polypeptide of the present application may have 1 or several amino acid mutations, including 1, 2, 3, 4, 5, 6 or more amino acid insertions, deletions, and mutations, as long as the mutations do not alter the immunogenicity of the isolated polypeptide.

For the antibodies of the present application, the purified antigenic polypeptide can be used to immunize a mammal. Immunization can be carried out by conventional methods. For example, two adult male rabbits are injected with the antigen separately and immunized in two separate times, separated by about 1-2 months, with a total of 5mg of the antigen. And (3) performing ELISA detection on the titer of the antibody in the rabbit serum after the second immunization is finished, discharging the rabbit blood more than 250 ten thousand, and collecting the serum for purifying the antibody. Serum can be collected and the antibodies purified by methods conventional in the art. Polyclonal antibodies were prepared as above. Monoclonal antibodies can also be produced using the polypeptides of the present application, and such monoclonal antibodies can be prepared using hybridoma technology.

The invention has the advantages that:

1. to explore the effect of VP53B and VP110 on WSSV oral infection, the inventors screened partial protein fragments of VP53B and VP110 based on extensive experience and extensive experimental studies, produced polyclonal antibodies, incubated viral particles of WSSV respectively, and injected the antibody-virus complex orally into Procambrus clarkii, and examined the number of virus copies in the Procambrus clarkii by mortality observation and subsequent qPCR to confirm the protective effect of the protein polyclonal antibodies on the Procambrus clarkii. The research result after the parallel test shows that the protective effect of the VP110 polyclonal antibody is 44%, and the protective rate of the VP53B polyclonal antibody can reach 85%. The qPCR result shows that the virus copy number concentration in the live crayfish injected with the antibody virus is 10³The copy number concentration of the virus is 10% or less than that of the injected virus control group⁶-10⁷The differences between copies and mg are obvious, which indicates that the polyclonal antibodies of VP110 and VP53B can obviously inhibit the oral infection capability of WSSV virus. In particular, the protective rate of the polyclonal antibody of VP53B of the present invention is significantly higher than that of VP110 and other capsular proteins of the prior art. VP53B is likely to be a key protein in oral infection with WSSV.

2. When two polyclonal antibodies, namely VP53B and VP110, are incubated with WSSV at the same time, the protection rate can reach 90%, the oral infection capability of the WSSV in crayfish can be almost completely inhibited, and the two antibodies have synergistic effect.

In conclusion, the VP53B and VP110 polypeptide fragments can be used for producing medicines for preventing and treating white spot syndrome of prawns, so as to effectively prevent infection and spread of WSSV.

Drawings

FIG. 1 shows the results of the WSSV oral infection experiment embedded in VP53B antibody serum.

FIG. 2 shows the results of an oral infection experiment to verify whether rabbit serum has a neutralizing effect on VP 53B.

FIG. 3 shows the results of the VP53B antibody serum-embedded WSSV intramuscular injection experiment.

FIG. 4 shows the neutralization test results of WSSV embedded VP110 antibody by oral injection of crayfish.

FIG. 5 shows the neutralization test results of VP110 and VP53B antibody serum-embedded WSSV by oral injection of crayfish.

Detailed Description

The following detailed description of the present invention will be made with reference to the accompanying drawings.

In the research of the invention, Procambarus clarkii (Procambarus clarkii) is selected as a research object, and the in vivo neutralization experiment of WSSV envelope protein antibody shrimp is adopted to verify the function.

Procambarus clarkii is commonly called freshwater crayfish and is also one of the important infected objects of WSSV. Compared with prawns, the prawn culture medium has the advantages of easy laboratory domestication, easy acquisition (all seasons), and the like, and is often used as an important experimental object for researching WSSV.

The common methods adopted for researching the effect of WSSV envelope protein in virus infection are generally divided into three methods, including vaccine protection of recombinant protein, RNA interference gene silencing of corresponding receptor protein in shrimp bodies and preparation of WSSV envelope protein antibody for neutralization experiments in shrimp bodies. Specifically, the method comprises the following steps: the vaccine protection of the recombinant protein is mainly to express and purify a researched target protein through a eukaryotic or prokaryotic expression system, and after the recombinant protein is obtained, the recombinant protein is added into feed for feeding experimental shrimps according to a certain proportion. After the WSSV virus solution is orally fed or injected, the death and virus infection conditions of the shrimps in the experimental group are observed after a period of time to determine the protection effect and the protection rate of the recombinant protein. The using condition of the method for silencing the receptor protein in the shrimp body by RNA interference is that the envelope protein of WSSV is generally found to be possibly combined with a certain protein of the shrimp receptor, the target protein cannot be combined with the receptor by the expression of the protein in the shrimp body of gene silencing, and after a challenge test is carried out, the death rate of experimental groups of shrimps is observed to determine whether the target protein is the key protein infected by WSSV. The antibody neutralization experiment method also needs to perform protein expression purification on the protein to be researched, a monoclonal or polyclonal antibody is prepared through a protein sample, the WSSV virus particles are incubated and embedded by using the antibody so as to block the combination of the target protein and the receptor protein, the virus particles embedded by using the antibody are orally or intramuscularly injected into shrimp bodies, and whether the experimental target protein is the key protein infected by the WSSV or not is judged by observing the death rate of experimental group shrimps and the enrichment condition of the virus in the shrimp bodies. Compared with the first two methods, the third method is used for more pertinently and directly embedding the target protein, so that the target protein partially loses the biological activity, the research result is stable, and certain reliability is realized.

Example 1 functional study of the WSSV envelope protein VP53B

A series of software predictions and analyses were performed to find the most abundant fragment of VP53B epitope and polyclonal rabbit antisera and polyclonal antibodies were prepared using New Zealand rabbits. Specifically, the online software Bepipred 1.0Server and IEDB Analysis Resource are used for carrying out epitope prediction Analysis on VP53B, and a VP53B polypeptide fragment SRYKQRDPHTGLP (SEQ ID NO:1) is selected and synthesized to immunize New Zealand white rabbits to obtain anti-VP 53B polyclonal antibodies. The preparation of antibodies was performed by Shanghai Yongong Biotech Limited. And (3) verifying the specificity and sensitivity of the antibody by using methods such as Western blotting, ELISA and the like. As a result, the antibody has high specificity and sensitivity.

In order to verify that VP53B is a key factor for WSSV oral infection, VP53B multi-antibody embedded WSSV virus particles are adopted, crayfish is selected as an experimental object by respectively adopting oral and intramuscular injection modes, the death condition of experimental crayfish is observed, the virus content in the crayfish is detected by qPCR, the neutralization effect of VP53B multi-antibody in the crayfish is obtained, and whether VP53B is the key factor for WSSV oral infection is determined.

1 materials and methods

1.1 Experimental samples

Healthy crayfish were purchased from the Luchaogang aquaculture market in Pudong New district of Shanghai and Wujiang aquaculture market in Jiangsu Suzhou, respectively, from 2015 to 2016, 12 months, with a body length (7.5 + -0.4) cm and a body weight (15.3 + -1.5) g. 1.2 Experimental reagents

The marine animal tissue extraction kit, the plasmid miniextraction kit and the clone strain Top10 are purchased from Tiangen Biochemical technology limited company. PCR-related reagents (PCR mix buffer, double distilled water) were purchased from Takara. A100 bp DNA molecular scale, a lambda DNA molecular scale Loading Buffer, an LB solid medium added with ampicillin (the volume ratio of the ampicillin to the medium is 1:1000), an LB liquid medium and T4DNA ligase were purchased from Shanghai Biotechnology Limited. The VP53B polyclonal antibody rabbit serum (prepared by Shanghai Youlong Biotech Co., Ltd.) was used as a WSSV qPCR absolute quantitative standard plasmid (available in the laboratory). SYBRGreen Master qPCR fluorescent dyes were purchased from Roche. Other basic reagents were purchased from national pharmaceutical reagents and Shanghai Biotechnology Ltd. WSSV-TW virus (Taiwan strain) stock (from the laboratory of the Roman Master, Taiwan university of success).

1.3 methods

1.3.1 bulk detection of crayfish

WSSV body detection is carried out on the crayfishes by adopting a qPCR method. And adding the extracted crayfish genome (200ng) as a template into a qPCR reaction system to obtain a qPCR result so as to determine whether the crayfish is infected with WSSV. The qPCR primers are VP28-140F (SEQ ID NO: 2): AGGTGTGGAACAACACATCAAG/VP28-140R (SEQ ID NO: 3): TGCCAACTTCATCCTCATCA, each qPCR reaction system was 20 μ l: VP28-140F (10. mu.M) 0.6. mu.l, VP28-140R (10. mu.M) 0.6. mu.l, SYBR Green Master (ROX) 1. mu.l, ddH₂O2. mu.l, and 2. mu.l of the genome of the crayfish.

1.3.2 oral infection experiments

In the crayfish temporarily cultured in a laboratory for one week (the culture water temperature is about 25 ℃), 60 crayfish are selected to be intact in shape and good in vitality, and the crayfish with similar body types are divided into three groups: experimental group, positive control group and negative control group, each group has 20 pieces. The specific treatment modes of each group are as follows:

(1) experimental group

100. mu.l of 10⁷The WSSV virus solution of copies/μ l and 100 μ l of VP53B polyclonal antibody serum diluent (the dilution factor is 20000 times determined according to the ratio of the virus dose and the antibody dose in the intramuscular injection experiment of VP 28) were mixed, incubated in a metal bath at 28 ℃ and 300rpm for 60min, and 200 μ l of the incubation solution was orally injected into each crayfish using a pipette (the front end of the sterilized pipette tip was covered with a flexible tube to prevent physical damage to the crayfish mouth).

(2) Positive control group

Diluting the virus solution to 5X 10⁶The diluted virus solution (200. mu.l) was placed in a metal bath at 28 ℃ and 300rpm for 60min, and then orally injected into the crayfish.

(3) Negative control group

200. mu.l of TNE solution (0.05M Tris-HCl, 0.1M NaCl, 0.001M EDTA, pH 7.4) was placed in a metal bath at 28 ℃ and 300rpm for 60min, and then orally injected into the crayfish.

TABLE 1 VP53B oral infection Experimental groups

To exclude the neutralizing effect of rabbit serum on VP53B during antibody preparation, a neutralization experiment was specifically performed: the positive control group is WSSV-TW, the negative control group is TNE, the test group 1 is WSSV-TW + rabbit serum, and the test group 2 is WSSV-TW + VP53B polyclonal antibody. The test group 1 treatment mode was: 100. mu.l of 10⁷The WSSV virus solution (copies/μ l) was mixed with 100 μ l of a dilution of the polyclonal antibody serum without VP53B (dilution ratio was the same as that of the experimental group), incubated at 28 ℃ and 300rpm in a metal bath for 60min, and 200 μ l of the incubation solution was orally injected into each crayfish using a pipette gun (the tip of the sterilized pipette head was covered with a flexible tube to prevent physical damage to the mouth of the crayfish).

The experimental protocol used was as follows:

table 2 groups for verifying oral infection effect of rabbit serum on WSSV

The results were collected 18 days after observation: mortality of crayfish; qPCR quantifies the number of WSSV particles in the muscle of crayfish; the experiment was repeated three times.

1.3.3 intramuscular injection experiments

The test groups were similarly arranged with reference. The treatment method of each group of injection is similar to oral injection. The healthy crayfish is infected by intramuscular injection. The injection mode is that the fourth abdominal segment of the healthy crayfish is injected by a 29-gauge needle of a sterile injector. The treatment modes of each group are as follows:

table 3 VP53B intramuscular injection experimental groups

The results were collected 18 days after observation: mortality of crayfish; qPCR quantifies the number of WSSV particles in the muscle of crayfish.

2 results and analysis

2.1 examination of the crayfish itself

qPCR for ten crayfish (EFF-100.53%, R)²0.999) the bulk test result showed that the crayfish did not contain the WSSV virus and could be determined as not infected with the WSSV virus.

2.2 oral infection test results

Oral infection tests, the experiments were performed in triplicate. In the first oral infection experiment, the negative control group does not die of crayfish in the observation period of the experiment, the positive control group begins to die in the tenth day of the experiment, and then the death rate reaches 100% in the fifteenth day of the experiment. All dead crayfish were tested for WSSV, and 20 crayfish were tested for WSSV at a concentration of 1.34X 10⁷-1.73×10⁸copies/mg. The experimental group died 2 crayfish in the fourteenth day of the experiment and did not die in the following four days. Cumulative mortality was only 10% (figure 1).

In the second oral infection test, the negative control group has the same result as the first result, the positive control group begins to die in the eleventh day of the test, and then the death rate reaches 100% in the seventeenth day of the test. All dead crayfish were tested for WSSV, and 20 crayfish were tested for WSSV at a concentration of 2.14X 10⁷-1.72×10⁸copies/mg. The experimental group died 3 crayfish in the fourteenth day of the experiment, and no death occurred in the following four days, and the cumulative mortality rate was 15%.

The third experiment is similar to the second experiment, the accumulated death rate of the final experimental group is only 20 percent and is far lower than the 100 percent accumulated death rate of the positive control group, and the WSSV concentration of the surviving crayfish is 10 percent when the qPCR detection is carried out on the crayfish³The average concentration of the WSSV is below copies/mg and is far lower than that of the WSSV of a positive control group by 10⁷-10⁸copies/mg, which shows that the VP53B protein antibody has obvious protective effect, and further verifies that VP53B is a key factor for WSSV oral infection.

In the oral infection test of whether the rabbit serum has neutralization effect on VP53B, the negative control group is still the same as the first result, the positive control group starts to die at the tenth day of the test, and then the death rate reaches 100% at the seventeenth day of the test. All dead crayfish were tested for WSSV, and 20 crayfish were tested for WSSV at a concentration of 1.58X 10⁷-2.31×10⁸copies/mg. The test group 1 began to die on the eleventh day of the test, after which the mortality rate reached 100% on the eighteenth day of the test. All dead crayfish were tested for WSSV, and 20 crayfish were tested for WSSV at a concentration of 8.45X 10⁶-1.22×10⁸copies/mg. The experimental group 2 died 4 crayfish in total, and the cumulative mortality rate was only 20%. The WSSV test was carried out on 4 dead crayfish, and a small amount of WSSV (concentrations of 10 were found)³copies/mg or less). Indicating that rabbit serum has no protective effect on WSSV orally injected crayfish (FIG. 2).

2.3 results of intramuscular injection experiments

The negative control group did not die of crayfish during the experimental observation period,the positive control group began to die the second day of the experiment, after which the mortality reached 100% by the eighth day of the experiment. All dead crayfish were tested for WSSV, and 20 crayfish were tested for WSSV at a concentration of 1.44X 10⁷-1.17×10⁸copies/mg. The experimental group began to die the second day of the experiment, after which the mortality reached 100% by the seventh day of the experiment. All dead crayfish were tested for WSSV and 20 crayfish were tested for WSSV at a concentration of 5.48X 10⁶-1.62×10⁸copies/mg. Indicating that the VP53B antibody had no protective effect on the mode of intramuscular infection with WSSV (figure 3).

3 conclusion

Our experiments found that the WSSV virus embedded by the VP53B antibody basically loses the oral infection capability, which indicates that VP53B is a key factor of the oral infection of WSSV and plays a very important role in the oral infection. The antigenic determinant in VP53B blocked by the antibody is likely to play a crucial role in the binding of the antigen to the intestinal receptors of crayfish. In the intramuscular injection experiment, the VP53B antibody showed no protective effect, indicating that VP53B may not be involved in the proliferation and replication of the virus in the cell. Although VP53B accounts for a small proportion of the WSSV envelope, its polyclonal antibody shows superior protection to other viral envelope protein antibodies. However, in particular, how VP53B plays a role in WSSV infection, whether it helps the virus adhere to the surface of the shrimp intestinal cells or help the virus enter the shrimp cells, or other roles, further investigation is needed.

Example 2 functional study of the envelope protein VP110 of WSSV

Similar to VP53B, VP110 is also a protein present in WSSV envelope. Similar to the study of VP53B function, the same method was used to examine whether the virus embedded with VP110 polyclonal antibody still has the ability to infect crayfish orally, by combining VP110 polyclonal antibody with WSSV virus. Therefore, a fragment 150aa-600aa from the VP110N end is selected by our laboratory for prokaryotic expression and purification of protein, and small fragment protein is successfully purified. Antigenic determinant prediction analysis of VP110 was performed using online software BepipPre 1.0Server (http:// www.cbs.dtu.dk/services/BepipPre /) and IEDBanalysis Resource (http:// tools. iedb. org/main /). Selecting a section of VP110 polypeptide GEDPKPYCWS (SEQ ID NO:4) with high hydrophilicity, multiple surface possibility and antigenic determinants and most conservative, obtaining a polyclonal antibody of anti-VP 110 from New Zealand white rabbits immunized by Shanghai Youlong Biotechnology Limited, and verifying the antibody specificity and antibody titer by Western blotting and ELISA methods. This experiment will use this antibody for the embedding of WSSV virus.

1 materials and methods

1.1 Experimental samples

The experimental sample is detailed in 1.1 experimental sample.

1.2 reagents

VP110 polyclonal antibody (titer 1:243000), and the other reagents were the same as 1.2.

1.3 methods

1.3.1 oral infection test

In the crayfish temporarily cultured in the laboratory for one week (the culture water temperature is about 25 ℃), 45 crayfish with good shape and activity are selected and divided into three groups: experimental group, positive control group and negative control group, each group has 15 pieces. The specific treatment modes of each group are as follows:

(1) experimental group

100. mu.l of 10⁷The WSSV virus solution was mixed with 100. mu.l of VP110 polyclonal antibody in copies/μ l, incubated at 28 ℃ for 60min at 300rpm in a metal bath, and 200. mu.l of the incubation solution was orally injected into each crayfish using a pipette (the tip of the sterilized pipette was covered with a flexible tube to prevent physical damage to the crayfish mouth).

(2) Positive control group

Diluting the virus solution to 5X 10⁶The diluted virus solution (200. mu.l) was placed in a metal bath at 28 ℃ and 300rpm for 60min, and then orally injected into the crayfish. The results of the experiment were collected after 20 days of observation: mortality of crayfish; qPCR quantifies the number of WSSV particles in the muscle of crayfish.

(3) Negative control group

200. mu.l of TNE solution (0.05M Tris-HCl, 0.1M NaCl, 0.001M EDTA, pH 7.4) was placed in a metal bath at 28 ℃ and 300rpm for 60min, and then orally injected into the crayfish.

Table 4 VP110 oral infection experimental groups

The results of the experiment were collected after 20 days of observation: mortality of crayfish; qPCR quantifies the number of WSSV particles in the muscle of crayfish; the experiment was repeated three times.

2 results and analysis

2.1 VP110 challenge test results

In parallel three experiments, crayfish was orally infected with WSSV embedded in VP110 antibody, the cumulative mortality rates for crayfish in twenty days were 46%, 40% and 46%, respectively, the negative control group did not die, and the positive control group died all in fifteen days. According to the results of qPCR detection on dead crayfish muscles of the experimental group and the negative control group, the dead crayfish is found to be caused by WSSV virus infection, and the virus infection amount reaches about 10⁷To 10⁸copies/mg, which is similar to the previous experimental results, whereas relatively low loads of WSSV virus were found in the surviving crayfish in the experimental group by qPCR, with an infectious dose of 10⁴Below copies/mg, it was demonstrated that the VP110 antibody indeed partially inhibited the ability of WSSV to orally infect crayfish (fig. 4). However, the effect of the VP110 antibody on the ability to inhibit viral infection was much less pronounced in the mortality of the crayfish in the experimental group and in the viral load of the muscle of the surviving crayfish in the experimental group, compared to VP 53B.

Example 3 WSSV envelope protein VP53B and VP110 synergy assay

Experiments prove that the single proteins of VP110 and VP53B have obviously reduced capability of resisting the embedded virus through oral infection, and over 40 percent and 80 percent of crayfish survive through oral injection respectively. Therefore, the neutralization effect of the two protein polyclonal antibodies in the crayfish body is observed by using the VP110 and VP53B polyclonal antibody to co-embed the WSSV virus. 1 materials and methods

1.1 Experimental samples

The experimental sample is detailed in 1.1 experimental sample.

1.2 reagents

VP110 polyclonal antibody (titer 1:243000), and the other reagents were the same as 1.2.

1.3 methods

1.3.1 oral infection test

In the crayfishes which are temporarily cultured in the laboratory for one week, 45 crayfishes which are good in vitality and similar in body type are selected into three groups: experimental group, positive control group and negative control group, each group has 15 pieces. The treatment modes of each group are as follows:

(1) experimental group

100. mu.l of 10⁷The WSSV virus solution in copies/μ l was mixed with 100 μ l VP110 multi-antiserum diluent and 100 μ lVP53B multi-antiserum diluent (the dilution was 20000 times), incubated at 28 ℃ for 60min at 300rpm in a metal bath, and 300 μ l of the incubation solution was orally injected into each crayfish using a pipette gun (the sterilized tip of the pipette was covered with a flexible tube to prevent physical damage to the crayfish mouth).

(2) Positive control group

Diluting the virus solution to 3.3X 10⁶The copies/μ l was diluted to 300 μ l and placed in a metal bath at 28 ℃ and 300rpm for 60min, followed by oral injection into the crayfish. The experimental results were collected 24 days after observation: mortality of crayfish; qPCR quantifies the number of WSSV particles in the muscle of crayfish.

(3) Negative control group

Mu.l of TNE solution (0.05M Tris-HCl, 0.1M NaCl, 0.001M EDTA, pH 7.4) was placed in a metal bath at 28 ℃ and 300rpm for 60min, and then orally injected into the crayfish.

Table 5 VP110 and VP53B multi-antibody embedded WSSV oral injection experimental groups

The results were collected after 19 days of observation: mortality of crayfish; qPCR quantifies the number of WSSV particles in the muscle of crayfish.

2 results and analysis

The negative control group did not die of crayfish during the observation period of the experiment, and the positive control group began to die at the tenth day of the experiment and then died at the later daysThe mortality rate reaches 100% in the seventeenth day of the experiment. All dead crayfish were tested for WSSV, and 20 crayfish were tested for WSSV at a concentration of 1.86X 10⁷-1.28×10⁸copies/mg. The experimental group died 1 crayfish on day thirteen of the experiment and not six days later. Cumulative mortality was only 5% (figure 5).

Discussion of 3

In experiments in which the antibodies VP110 and VP53B were used to encapsulate WSSV virus particles, we found that the oral infection ability of antibody-treated viruses was significantly reduced, and the mortality rate of crayfish was only 5%, which was also better than the way in which viruses were treated with only one antibody VP110 or VP 53B. Compared with intramuscular injection and oral injection, oral infection is the main transmission mode of WSSV virus under natural conditions, so the research on the oral infection of WSSV has considerable practical significance, and under the combined action of VP110 antibody and VP53B antibody, the discovery that WSSV almost loses the oral infection capacity provides a new idea for future research and solution of white spot syndrome.

In the experimental design of the above examples, the injection volumes of 200 μ l and 300 μ l do not affect the infection of the virus to the body, and both are far beyond the dosage of the virus infection in nature, and we select 100 μ l of antibody for neutralization to find that the antibodies of VP53B and VP110 play a certain protective role, so that under the test of the same dosage, we find that when the two antibodies are embedded into the virus particles at the same time, the protective effects are additive, and do not resist each other or compete with the epitope, which can indicate that the effects are additive, but not the infection effect is reduced due to the concentration.

The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> Shanghai ocean university

<120> VP53B and VP110 antibody and application thereof in preparation of medicine for preventing and treating white spot syndrome of prawns

<130>/

<160>4

<170>PatentIn version 3.3

<210>1

<211>13

<212>PRT

<213> Artificial sequence

<400>1

Ser Arg Tyr Lys Gln Arg Asp Pro His Thr Gly Leu Pro

1 5 10

<210>2

<211>22

<212>DNA

<213> Artificial sequence

<400>2

aggtgtggaa caacacatca ag 22

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

tgccaacttc atcctcatca 20

<210>4

<211>10

<212>PRT

<213> Artificial sequence

<400>4

Gly Glu Asp Pro Lys Pro Tyr Cys Trp Ser

1 5 10

Claims (8)

1. An isolated polypeptide, wherein the amino acid sequence of the polypeptide is the sequence shown in SEQ ID NO. 1.

2. The use of the polypeptide of claim 1 in the preparation of a medicament for the prevention and treatment of white spot syndrome in prawns.

3. An antibody specifically against VP53B of white spot syndrome virus, which is obtained by immunizing an animal with the polypeptide of claim 1, wherein said antibody is a polyclonal antibody.

4. Use of the antibody of claim 3 for the preparation of a medicament for the prevention and treatment of white spot syndrome in prawns.

5. A pharmaceutical composition for preventing and treating white spot syndrome of prawns, comprising the antibody of claim 3.

6. The pharmaceutical composition of claim 5, further comprising a polyclonal antibody obtained by immunizing an animal with the polypeptide of SEQ ID NO. 4.

7. The pharmaceutical composition of claim 5, wherein the pharmaceutical composition is in the form of an oral dosage form.

8. A polynucleotide encoding the polypeptide of claim 1.

Images