CN107815510A - The detection method of the type of COxsackie A groups 10 virus in hand-foot-and-mouth disease mixed infection - Google Patents

Abstract

The invention discloses the detection method of the type of COxsackie A groups 10 viral (CV A10) in a kind of infection of hand-foot-and-mouth disease or mixed infection, this method is by extracting viral RNA, RT PCR amplifications are carried out with enterovirus universal primer 224 and 222, then nested PCR amplification is carried out with primer AN89 and AN88, if it is non-CV A10 serotypes through comparing, further according to CV A10 sequences Designs special CV A10 sense primers CVA10TF and anti-sense primer CVA10TR, nested PCR amplification is carried out by template of RT PCR primers, PCR primer is taken to carry out 1% agarose gel electrophoresis again, you can identification.The method of the invention has the advantages that fast simple to operate, detection speed, high-accuracy and low cost, especially suitable for large-scale molecular epidemiology survey.

Description

The detection method of the type of COxsackie A groups 10 virus in hand-foot-and-mouth disease mixed infection

Technical field

The invention belongs to biological technical field, and in particular to the type of COxsackie A groups 10 disease in a kind of hand-foot-and-mouth disease clinical sample The detection method of poison.

Background technology

Since two thousand eight, in China, annual hand-foot-and-mouth disease (Hand-foot-mouth disease, HFMD) case More than million, and there is the report of death.HFMD have become China and country in Southeast Asia great public health problem it One.HFMD be as caused by a variety of Human enterovirus virus common transmittable disease, the pathogen for causing HFMD be mainly CV-A16,4, 5th, 7,9,10, and B 3,5, echovirus and EV-A71, the wherein type of COxsackie A groups 10（Coxsackievirus A10, CV- A10）Have become and remove Enterovirus 71 type（Enterovirus 71, EV-A71）, cause morbidity beyond CV-A16 and CV-A6 One of main pathogens.

In HFMD burst periods, a variety of enterovirus mixed infections be present, mixed infection is possible to aggravate disease and/or prolonged The long course of disease.Therefore, HFMD is contributed to prevent and treat mixed infection monitoring.

In practice examining, after HFMD has been determined as certain enterovirus infection, it is desirable to determine whether also exist CV-A10 infection, generally also need to carry out RT-PCR with CV-A10 special primer, then nest-type PRC, pass through agarose electricity Whether swimming identification has CV-A10 infection.This just needs RT-PCR twice, adds cost, especially carries out large-scale molecular epidemic disease Investigation, the cost that it spends is quite huge, therefore, it is very necessary to explore simple and rapid CV-A10 detection methods.

The content of the invention

The technical problems to be solved by the invention are to overcome defect described above, there is provided a kind of detection speed is fast, high precision The few type of COxsackie A groups 10 virus of rate, expense（CV-A10）Detection method.

In order to solve the problems, such as techniques described above, the type of COxsackie A groups 10 disease in hand-foot-and-mouth disease mixed infection of the present invention The detection method of poison, this comprises the following steps：

（1）Viral RNA is extracted, enterovirus universal primer is designed according to the characteristics of enterovirus capsid protein gene and carries out half nest Formula PCR；Primer 2 24 (5 ' GCIATGYTIGGIACICAYRT 3 ') and 222 are used first（5’CICCIGGIGGIAYRWACAT 3’） The amplification of first time RT-PCR is carried out, then uses primer AN89 again（5’CCAGCACTGACAGCAGYNGARAYNGG3’）And AN88 （5’ACTGGACCACCTGGNGGNAYRWACAT 3’）According to the special CV-A10 sense primers CVA10TF of CV-A10 sequences Designs （5’TACAAGCCGCGGAGACAGG3’）With anti-sense primer CVA10TR（5’GGTGGGACATACATGTACTG 3’）, carry out the Secondary nested PCR amplification and sequencing, and by its nucleotide sequence carry out NCBI BLAST comparisons, if the nucleotide sequence with The nucleotide sequence homology of certain enterovirus serotype is more than 75% in GenBank databases, that is, is considered identical serum Type, determine that hand-foot-and-mouth disease patient has infected this kind of enterovirus, that is, detect the enterovirus kind of hand-foot-and-mouth disease patient infection Class；

（2）By the step（1）Identification, if with universal primer be not detected by the type of COxsackie A groups 10 virus, then with specifically CV-A10 sense primers CVA10TF and anti-sense primer CVA10TR, with the step（1）Middle RT-PCR products are that masterplate carries out nest Formula PCR is expanded, and takes amplified production to carry out 1% agarose gel electrophoresis, you can determines to whether there is CV-A10 sense in mixed infection Dye.

Beneficial effects of the present invention：Compared to prior art, the present invention omits one-step RT-PCR method, so that it may completes the sample CV-A10 identification, cost-saved nearly 25 yuans an of sample, the time also shortened to 2 hours from original 4 hours, and Only need a RT-PCR can complete, therefore this method can quickly, simplicity and expense is greatly lowered, be large-scale CV-A10 Molecular Epidemics Hygienic monitoring on hands of childhood provides guarantee in enterovirus mixed infection.

Brief description of the drawings

Fig. 1 is the agarose gel electrophoresis figure of enterovirus 1% of the embodiment；

Fig. 2 is the CV-A101% agarose gel electrophoresis figures of the embodiment；

Fig. 3 is surveyed the CV-A10 sequences of a sample by the embodiment；

Fig. 4 is CV-A10 parts VP1 gene magnification schematic diagrames.

Embodiment

The present invention is described in further detail with reference to embodiment.

The detection method of the type of COxsackie A groups 10 virus, methods described include in hand-foot-and-mouth disease mixed infection of the present invention Following steps：

（1）Viral RNA is extracted, enterovirus universal primer is designed according to the characteristics of enterovirus capsid protein gene and carries out half nest Formula PCR；Primer 2 24 (5 ' GCIATGYTIGGIACICAYRT 3 ') and 222 are used first（5’CICCIGGIGGIAYRWACAT 3’） The amplification of first time RT-PCR is carried out, then uses primer AN89 again（5’CCAGCACTGACAGCAGYNGARAYNGG3’）And AN88 （5’ACTGGACCACCTGGNGGNAYRWACAT 3’）According to the special CV-A10 sense primers CVA10TF of CV-A10 sequences Designs （5’TACAAGCCGCGGAGACAGG3’）With anti-sense primer CVA10TR（5’GGTGGGACATACATGTACTG 3’）, carry out the Secondary nested PCR amplification carries out NCBI BLAST comparisons by sequencing and by its nucleotide sequence, if the nucleotide sequence It is more than 75% with the nucleotide sequence homology of certain enterovirus serotype in GenBank databases, that is, is considered identical blood Clear type, thus determine that hand-foot-and-mouth disease patient has infected this enterovirus；

（2）By the step（1）Identification, if not detecting the type of COxsackie A groups 10 virus with universal primer, it is also possible to special Different CV-A10 sense primers CVA10TF and anti-sense primer CVA10TR, with the step（1）Middle RT-PCR products are carried out for masterplate Nested PCR amplification, amplified production is taken to carry out 1% agarose gel electrophoresis, you can to determine to whether there is CA10 sense in mixed infection Dye.

The method of the invention, viral RNA is extracted from the excrement or cerebrospinal fluid of clinical patient, drawn with enterovirus is general Thing 224-222 first carries out RT-PCR, then carries out CVA10TF and CVA10TR nest-type PRCs by template of its product, passes through survey Sequence and in NCBI BLAST（The one of American National Biotechnology Information center, which is enclosed in DNA databases, carries out similarity system design Analysis tool, http://blast.ncbi.nlm.nih.gov/Blast.cgi) compare, it is not CV-A10 infection to be defined as, Primer does nest-type PRC designed by again.It is exemplified below：

Embodiment：

1st, sample treatment

0.5 gram of stool sample is taken, 2.5mLPBS is added and fully vibrates mixing, 3000r/min centrifugation 30min, take supernatant, preserve In -20 DEG C；

2nd, viral RNA extracts

Kit is pressed in the extraction of viral RNA（Qiamp viral RNA mini Kit）Specification operates, specific as follows：Take 140 μ L of supernatant liquid or cerebrospinal fluid add 560AVL, and room temperature places 10min after overturning mixing；560 μ L absolute ethyl alcohols are added, overturn mixing； The above-mentioned μ L of solution 630 are added in adsorption column, 8000rpm centrifugation 1min, add 500 μ LAW1,8000rpm and centrifuge 1 min, It is intended to outwell the waste liquid in collecting pipe above；Add 500 μ LAW2,14000rpm and centrifuge 3 min, outwell useless in collecting pipe Liquid；Adsorption column is put into sky collecting pipe, 14000rpm centrifugations 1min；Adsorption column is put into new centrifuge tube, adds elution buffer Liquid, room temperature place 1min, 8000rpm centrifugations 1min, -20 DEG C of storages；

3rd, amplification and sequencing

RT-PCR is specific as follows according to Super one step RT-PCR Kit operating instructions：2х reaction buffer 25 μ L, RT-PCR MIX 1 μ L, 222 20pmol, 22420pmol, the μ L of RNA 10 add water to 50 μ L, mix after centrifugation 50 DEG C it is inverse 30min is transcribed, by 94 DEG C of 2min, 94 DEG C of 30sec, 52 DEG C of 30sec, 72 DEG C of 30sec, 30 circulations；72 DEG C of extension 5min, this is The first step；Then the μ L of RT-PCR products 10 are taken again, with the μ L of 2 х Taq PCR MasterMix 25, are pressed with AN88 and AN89 primers The condition of the above first step（That is 94 DEG C of 2min, 94 DEG C of 30sec, 52 DEG C of 30sec, 72 DEG C of 30sec, 30 circulations, 72 DEG C of extensions 5min）Amplification, takes the agarose gel electrophoresis of 2 μ L of amplified production 1%（Gained electrophoretogram is shown in accompanying drawing 1）.Have correspondingly sized special Fragment（About 321bp）With the high automation sequenator sequencings (Sanger double deoxidations cessation method) of ABI3730XL.

After above sequencing result compares by using NCBI BLAST, which kind of enterovirus be defined as.

4. non-CV-A10 sample PCR again

Randomly select 10 samples for not detecting CV-A10 infection by above step, the RT- obtained with the first step in step 3 The μ L of PCR primer 10, with the μ L of 2 х Taq PCR Master MIX 25, with CVA10TF and CVA10TR, by above step 3 first The condition of step（That is 94 DEG C of 2min, 94 DEG C of 30sec, 52 DEG C of 30sec, 2 DEG C of 30sec, 30 circulations, 72 DEG C of extension 5min）Amplification； Take the μ L1% agarose gel electrophoresis of amplified production 2（Gained electrophoretogram is shown in accompanying drawing 2）.

From electrophoretogram（Accompanying drawing 2）Upper to can be seen, every sample standard deviation for having infected CV-A10 has about 230bp size specific fragments It has been shown that, and the fragment is sequenced with ABI3730XL types automation sequenator（Based on Sanger double deoxidation cessation methods）, its sequence leads to NCBIBLAST comparisons are crossed, if the sequence of positive（Accompanying drawing 3 is seen, by taking the sequence of a sample as an example）It is homologous big with CV-A10 It is CV-A10 infection in 75%.This explanation expands positive by special primer, and its sequencing result and electrophoretogram are kissings Close, therefore in work afterwards, need to can only be judged as that CV-A10 infects by agarose gel electrophoresis, this is greatly simplified Job step, simple program, shortens the time, saves expense, significant to extensive epiphytotics investigation.

Claims (1)

1. in hand-foot-and-mouth disease mixed infection the type of COxsackie A groups 10 virus detection method, it is characterised in that methods described include with Lower step：

（1）Viral RNA is extracted, enterovirus universal primer is designed according to the characteristics of enterovirus capsid protein gene and carries out half nest Formula PCR；Primer 2 24 (5 ' GCIATGYTIGGIACICAYRT 3 ') and 222 are used first（5’CICCIGGIGGIAYRWACAT 3’） The amplification of first time RT-PCR is carried out, then uses primer AN89 again（5’CCAGCACTGACAGCAGYNGARAYNGG3’）And AN88 （5’ACTGGACCACCTGGNGGNAYRWACAT 3’）According to the special CV-A10 sense primers CVA10TF of CV-A10 sequences Designs （5’TACAAGCCGCGGAGACAGG3’）With anti-sense primer CVA10TR（5’GGTGGGACATACATGTACTG 3’）, carry out the Secondary nested PCR amplification and sequencing, and by its nucleotide sequence carry out NCBI BLAST comparisons, if the nucleotide sequence with The nucleotide sequence homology of certain enterovirus serotype is more than 75% in GenBank databases, that is, is considered identical serum Type, determine that hand-foot-and-mouth disease patient has infected this kind of enterovirus, that is, detect the enterovirus kind of hand-foot-and-mouth disease patient infection Class；

（2）By the step（1）Identification, if with universal primer be not detected by the type of COxsackie A groups 10 virus, then with specifically CV-A10 sense primers CVA10TF and anti-sense primer CVA10TR, with the step（1）Middle RT-PCR products are that masterplate carries out nest Formula PCR is expanded, and takes amplified production to carry out 1% agarose gel electrophoresis, you can determines to whether there is CV-A10 sense in mixed infection Dye.