CN107805277A - Sepiella maindroni Semen sarameters and preparation method and purposes - Google Patents
Sepiella maindroni Semen sarameters and preparation method and purposes Download PDFInfo
- Publication number
- CN107805277A CN107805277A CN201711069817.4A CN201711069817A CN107805277A CN 107805277 A CN107805277 A CN 107805277A CN 201711069817 A CN201711069817 A CN 201711069817A CN 107805277 A CN107805277 A CN 107805277A
- Authority
- CN
- China
- Prior art keywords
- sepiella maindroni
- sarameters
- semen
- cdna
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Abstract
The invention discloses a kind of Sepiella maindroni Semen sarameters and its production and use, Sepiella maindroni Semen sarameters Sp17 cDNA sequence total length has been cloned first, and simultaneously constructing system chadogram is predicted to its physics, chemical property according to cDNA amino acid sequence.The analysis of different tissues expression specificity has been carried out to Sepiella maindroni Semen sarameters Sp17 by fluorescence quantifying PCR method.Have the beneficial effect that：Sepiella maindroni Semen sarameters Sp17 prepared by the present invention, generation, formation to Sepiella maindroni sperm play an important role, and participate in acrosome reaction and promote fertilization process, significant impact is played in reproduction to Sepiella maindroni, can use it for the artificial genital regulating of Sepiella maindroni.The purposes that Sepiella maindroni Semen sarameters Sp17 can be additionally used in cancer detection and treatment.
Description
Technical field
The present invention relates to genetic engineering field, specifically a kind of Sepiella maindroni Semen sarameters and preparation method and
Purposes.
Background technology
In the sexual reproduction of organism, sperm and egg cell need it is final be merged to be formed embryonated egg and by
Step development is new individual, and spermatoblast is as a kind of well differentiated haploid cell structurally and functionally poor with body cell
It is different significantly, various related genes during it is all by sperm development in the function in participating in fertilization process and after reaching maturity
Specific expressed result, spermatoblast are a high-sequential and considerably complicated mistake in reaching maturity structurally and functionally
The biotic factor such as journey, multiple protein, ion plays a role in this process.
The content of the invention
An object of the present invention is to provide a kind of Sepiella maindroni Semen sarameters, with molecular biosciences
Learn generation and fertilization process of the technological means detection Sepiella maindroni Semen sarameters to Sepiella maindroni sperm
Influence.
The second object of the present invention is to provide a kind of favorable reproducibility, the high Sepiella maindroni Semen sarameters of yield
Preparation method.
The third object of the present invention is to provide a kind of purposes of Sepiella maindroni Semen sarameters, by Man needleless
The purposes that cuttlefish Semen sarameters are used in the artificial regulatory and cancer detection and treatment of Sepiella maindroni reproduction.
The present invention is directed to the problem of being mentioned in background technology, and the technical scheme taken is：Sepiella maindroni sperm surface
Albumen, cDNA total lengths 1463bp, 5 ' noncoding regions（UTR）92bp, 3' noncoding region（UTR）222bp, the ORFs of prediction
（ORF）Common 1149bp, encode 382 amino acid, encoding proteins matter relative molecular mass（MW）For 42.058kDa, isoelectric point
（pI）4.66.
The preparation method of Sepiella maindroni Semen sarameters, including Sepiella maindroni Semen sarameters Sp17 bases
Because of clone and tissue expression specificity's analysis.
Sepiella maindroni Semen sarameters Sp17 gene clonings are extracted including RNA：Take sexal maturity male Man needleless
The spermary tissue of cuttlefish, total serum IgE liquid is extracted using Trizol methods；The inspection of RNA mass：It is total using nucleic acid-protein detector measure
Absorbing wavelength of the RNA liquid at 260nm and 280nm, 260/280 value are qualified between 1.8 ~ 2.0；The conjunction of the chains of cDNA first
Into：To detect qualified total serum IgE liquid as template, the synthesis of the chains of cDNA first is carried out using reverse transcription reagent box；Specific sample-adding
System and reaction condition are as follows：
Following reaction system is added in 200ml microcentrifugal tubes：
The μ l of total serum IgE 2
Oligo dt 1µl
The μ l of DEPC water 3
Centrifuge, be placed in PCR instrument after mixing, it is 70 DEG C to set temperature, is taken out immediately after reacting 10min, ice bath 2min terminates；
Following reagent is continuously added in above-mentioned reaction system：
RNase Inhibitor (40U/l) 0.25µl
dNTP Mixture (10mM) 0.5µl
M-MLV Rtase(200U/l) 0.25µl
5×M-MLV Buffer 2.0µl
H2O（RNase-） 7.0µl
Centrifuged after mixing, in setting reaction condition in PCR instrument as 42 DEG C of 60min, 70 DEG C of 15min are rapid after terminating to take out, ice bath
15min, extremely -20 DEG C of preservation is standby, and long-term preserve then is positioned over -80 DEG C of refrigerators.
Sepiella maindroni Semen sarameters Sp17 gene clonings include the amplification of core sequence：With maturation Man without
The cDNA of Sepia andreana male spermary tissue is template, expands to obtain the product fragment of different length respectively using primer, should
Reaction system involved by process is as follows：
2×Es Taq MasterMix (Dye) 12.5µl
Primer F 0.5µl
Primer R 0.5µl
cDNA 0.5µl
H2O 11µl
PCR reaction conditions：95℃ 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, react 30 circulations；72℃ 7min；
12 DEG C of 5min terminate；Pcr amplification product after the completion of reaction detects by 1% agarose gel electrophoresis, to purpose band be present
PCR primer carry out purifying recovery；The primer and its sequence are：Sp17-1F：AGCAGATGTTAGCCCTTT；Sp17-1R：
CTTCAGTATCTTTGGTGCTT；Sp17-2F：TCTTCTAGAGGGTTTCGC；Sp17-2R：TGCAGGAGCTTTTACTTC；
Sp17-3F：ACTAAAACTGCTGAAGAG；Sp17-3R：TGTAGCAGCAGCACTGACCT.
Sepiella maindroni Semen sarameters Sp17 gene clonings include Sepiella maindroni Sp17 gene 5 's and 3 '
RACE is expanded：Utilize 3 ' RACE and 5 ' RACE technologies amplification Sepiella maindroni Sp17 genes；Wherein, the Sp17 genes 3 '
RACE the primers are：3’-Sp17-outter：AGCAAGATCCAGGCAAGTTTTAGAGGTCA；3’-Sp17-inner：
ATGCTATCGACATTGACCTAACTGACCCA；3’RACE Adapter：GCGAGCACAGAATTAATATTTTTTTTTTTT；
The Sp17 gene 5 's RACE the primers：5’-Sp17-outter：GCTCCGAACTGAATGA；5’-Sp17-inner：
TTTTGGCTGAGCCCGTAG；5’RACE Adapter：GGCCAGGCGTCGACTAGTACGGGGGGGGGG.
Sepiella maindroni Semen sarameters Sp17 gene clonings are spliced including cDNA total lengths：By the Sp17 by checking
Core sequence and 3 ' and 5 ' terminal sequences splice the full length cDNA sequence for obtaining gene, and according to cDNA amino acid sequence to it
Physics, chemical property are predicted and constructing system chadogram.
Sepiella maindroni Semen sarameters Sp17 gene cDNAs are：
TGTGACCGGAGAGACTGTCGAGCACGGAATAACACGTGTACCTTGCTATTGAACTAAAGGACAAAGTTAATTC
TTCGTTTTGTAAGTTAATCATGTCTGTACCCTTTTCAAACACAAAGTTGAGGGTACCCAGAGGTTTTGAGGCTCTTC
TAGAGGGTTTCGCTCGTGAAGTTCTACGGGCTCAGCCAAAATGTATCATTCAGTTCGGAGCCATGCATTTCTCCAAT
CTTCTCAAGATTCGAACAGAAACAGGCCAAGATCCTGTTGAAGAGTGTGCTGATTTGGAAGATAGGTTCTATAACAA
TGATTCATTCAAGCATGAAGCTCAAGCAGATGTTAGCCCTTTTGTTGCAGAGACACAGATGGAAGCTCATGCCAGTG
AAGAAGTAAAAGCTCCTGCAGAAGAGAAAGTGACTGATAATGCTCAAGAGGAAATTTCACCCAGTGACGTCACAAAT
GATGAAAATATTTCTGATGCTGCTACAAAGATTCAAGCTGGGTTTAAAGGATACAAGGTTCGAAAAGAAATGAAAGA
ACGCAAGACTGAACATTCTGAAGAGAAAACGACTGCAGGTACTATAGAAGATGCTGAAGGCACAAAAGATGCTGAAG
GCACTAAAACTGCTGAAGAGGCTGCAAATGCTGAAAGCACCAAAGATACTGAAGAGGTTAAAAATGCAGAAGACACT
GGAGATGCAGCAGATAATACAAAAGAACAAGAAATACCCAATGAAGAGGTTATAGATATTGACCTCAATGACCCAGA
AGTGGCAAACGCTGCTAGCAAGATCCAGGCAAGTTTTAGAGGTCATAAAACCAGGAGAGATCTGCTTAGTAAGCAAC
AATCAGAACATCTAGAAAATGAAAAAGATGCTAACAACAGTGCAATTACAGAAGACAATGCTATCGACATTGACCTA
ACTGACCCAGAGGTCAGTGCTGCTGCTACAAAAATTCAAGCAATTTTTCGTGGTCATCAGARCAGGCAAAAACTTAA
AGACACTCCTAAGGATCCAGCAAGTGAGAAAACCATGTCTCAAAAATCTGATAGTGCCACACCTGTTCAAGATGCTA
CTGGTGACCAGGGACAGGAGGATGACAAGTCTATCAACTATGAGGATCCACAGGTCCAACTGGCTGCCACTAAAATC
CAAGCTGGCTTTAAAGGCTACCAAACCCGCAAGAGCCTAAAGAAGCAAGCTGGGAATTCAGAGGATCTTGAAAAGGA
CAGTGGATCCTAACAAGTTGGTGGATGAAAACAGATGGTGTCTTGATGGAAGAATCCTCTGTTCCTCAGTAAAGCTG
ATAAAATTTATTGTTCTGATATAATTATTTGTATTGATAAAATAACTCTGGTCCTATTCTTATTGGCTTTCTCCCCC
TTCATAGTAAGGGAAATGTTCTGGCAAAGATAAATTTCTTATTTTCTTTAGGAAAAAAAAAAAAAAAAAAAAAAAAA
AAAA。
Tissue expression specificity's analysis includes extracting the total serum IgE of each tissue and reverse transcription：It is graceful that sexal maturity male is extracted respectively
The brain of family name's sepiella maindroni de Rochebrune, optic lobe, muscle, Wei, Gill, liver, the heart, spermary, vas deferens, seminal vesicle, prostate, spermatophore, intestines and pancreas
Total serum IgE, reverse transcription prepare the cDNA templates needed for real-time PCR experiments；Need to remove in the total serum IgE extracted before reverse transcription
Interference of the genomic DNA for real-time PCR experiments, is comprised the following steps that：
Following reaction system is added in 200ml centrifuge tubes：
Total serum IgE 1ng
5×gDNA Eraser Buffer 2µl
gDNA Eraser 1µl
Water（Rnase-） 8µl
Slightly centrifuged after mixing, centrifuge tube is placed in PCR instrument, set reaction condition as：42 DEG C of 2min, reaction are rapid after terminating
Taking-up is placed in 2min in ice bath.
Tissue expression specificity's analysis includes the design of real-time PCR primers：According to obtained Sp17 full length genes
CDNA sequence is designed for real-time PCR primer, is specially：Sp17-YF：TCATTCAGTTCGGAGCCA；Sp17-
YR：CCTATCTTCCAAATCAGCACA；Actin-F：TGAGAGGGAGATTGTGCGTG；Actin-R：
GAACATAGATTCTGGAGCACGG。
Tissue expression specificity's analysis includes quantitative fluorescent PCR：Using the quantitative method of relative fluorescence, choose in muscle
Sp17 gene expression amounts use Sepiella maindroni β-actin genes as reference（S.japonicaJN564496.1）Make
For reference gene, compare Sp17 genes in Sepiella maindroni brain, optic lobe, muscle, Wei, Gill, liver, the heart, spermary, vas deferens, storage
Expression difference in 14 kinds of seminal vesicle, prostate, spermatophore, intestines and pancreas different tissues, and carry out significance difference analysis.
Sepiella maindroni Semen sarameters, for improving the genital regulating of Sepiella maindroni and cancer detection and controlling
Purposes in treatment.
Compared with prior art, the advantage of the invention is that：Sepiella maindroni Semen sarameters have been cloned first
Sp17 cDNA sequence total length, and simultaneously constructing system is predicted to its physics, chemical property according to cDNA amino acid sequence
Chadogram.It is special that different tissues expression has been carried out to Sepiella maindroni Semen sarameters Sp17 by fluorescence quantifying PCR method
Specific analysis.Sepiella maindroni Semen sarameters Sp17 prepared by the present invention, generation, shape to Sepiella maindroni sperm
Into playing an important role, and participate in acrosome reaction and promote fertilization process, great shadow is played in the reproduction to Sepiella maindroni
Ring, the artificial genital regulating of Sepiella maindroni can be used it for.Sepiella maindroni Semen sarameters Sp17 can be additionally used in
Purposes in cancer detection and treatment.The present invention prepares Sepiella maindroni Semen sarameters Sp17 method favorable reproducibility,
Yield is high, and particularly reverse transcription efficiency is apparently higher than prior art.
Brief description of the drawings
Fig. 1 is Sepiella maindroni spermary Total RNAs extraction electrophoretogram；
Fig. 2 is Sp17 gene core fragment amplification result figures；
Fig. 3 is that Sp17 genes 3 ' hold amplification electrophoretogram；
Fig. 4 is Sp17 gene 5 's end amplification electrophoretogram；
Fig. 5 is Sepiella maindroni Sp17 gene cDNA total lengths；
Fig. 6 is transmembrane region prediction result figure；
Fig. 7 is Sp17 signal peptide prediction result figures；
Fig. 8 is Sp17 amino acid identity comparison charts；
Fig. 9 is that Human sperm protein 17 domain compares analysis chart；
Figure 10 is Sp17 secondary structure prediction figure；
Figure 11 is the systematic evolution tree based on Sp17 homologous amino acid sequences structure；
Figure 12 is expression figure of the Sepiella maindroni Sp17 genes in different tissues.
Description of reference numerals：The ORFs predicted in Fig. 5 shows initiation codon with black line collimation mark（ATG）And end
Only codon（TAA）；Identical amino acid residue is indicated with black in Fig. 8, and conserved amino acid is indicated with grey.
Embodiment
The present invention program is described further below by drawings and examples：
Embodiment 1：
1. the extraction of spermary total tissue RNA
1）Preparation before RNA extractions：
Cause to degrade to ensure RNA extraction process not contaminated, start to need meetings such as tweezers, scissors before extracting RNA
The instrument for directly contacting RNA samples to be extracted carries out DEPC processing, i.e., these instruments is positioned over containing the water-soluble of 0.1%DEPC
Soaked overnight in liquid, and the 30min that sterilizes under the high temperature conditions, half an hour is soaked in absolute ethyl alcohol using preceding.Used in experiment
To pipettor gun head and centrifuge tube be both needed to by without RNase processing.
2）RNA extraction steps：
a）250mlTrizol reagents are added in 1.5ml centrifuge tubes, is gone bail for be stored in RNA preservation liquid with tweezers and scissors and treated
Extract sample about 30mg to immerse in Trizol reagents, be fully homogenized using hand electric homogenizer rapidly, until tissue dispersion,
Opaque, it is 1ml to add Trizol reagents to final volume；
b）Centrifuge tube is gently mixed, and 5min is stood under room temperature condition, treats that tissue fully cracks；
c）12000g under the conditions of 4 DEG C, centrifuge 10min；
d）Supernatant liquor is beaten easily, prevents from stirring lower sediment, is added to the new centrifuge tube for filling the chloroform that 200ml shifts to an earlier date precooling
In, acutely concussion mixes 15s, is stored at room temperature 5min；
e）4 DEG C, 12000g, centrifuge 15min；
f）Centrifugation terminates significantly to be divided into three layers of upper, middle and lower in rear visible centrifuge tube, beats easily supernatant liquor and is added to precooling in advance
In the new centrifuge tube for filling 500ml isopropanols, gently mix and about 1 hour is stood under the conditions of -20 DEG C；
g）4 DEG C, 12000g, centrifuge 10min；
h）Visible a small amount of white precipitate being attached on the inside of ttom of pipe, removes supernatant, adds 75% ethanol solution of precooling after centrifugation
1ml, pressure-vaccum are uniform；
i）4 DEG C, 7500g, centrifuge 5min；
j）Supernatant is removed, retains precipitation, about 15 ~ 20min is dried in superclean bench, until ethanol volatilizes, it is heavy on tube wall to treat
When shallow lake is changed into transparent, 20mlDEPC processing water dissolvings RNA is added.
3）The inspection of RNA mass：
The RNA for being dissolved in DEPC processing water determines its absorption ripple at 260nm and 280nm using nucleic acid-protein detector
Long, according to relevant information, 260/280 value shows that extracted RNA mass is purer between 1.8 ~ 2.0, the foreign protein contained with
And polysaccharose substance content is less, less than this scope RNA it is not recommended that using, higher than 2.0 the extracted RNA of explanation have more
Degraded, be not suitable for the experiment of next step amplification gene full-length cDNA and use.After the completion of measure, 2 ~ 3ml is taken to be splined on 1% Ago-Gel
Electrophoresis, deposition condition are set as 135V and 150mA, electrophoresis 15min, are scanned under Labworks image acquisition and analysis software and obtain electrophoresis result
As shown in Figure 1.Take the RNA after a small amount of dissolving to determine the light absorption value at 260nm and 280nm in nucleic acid-protein detector, survey
Determine result and show A260/A280 ratios between 1.80 ~ 2.00, and electrophoretogram shows that 28S bands are obvious.Result above is said
The spermary total serum IgE purity of this bright extraction is higher, though in the presence of the synthesis that is still applied to the chains of next step cDNA first of degrading on a small quantity
Reaction.
2. the synthesis of the chains of cDNA first：
The step uses the M-MLV Reverse Transcriptase kits of Takara companies production, with Man needleless crow
The total serum IgE extracted in crafty spermary tissue is template, carries out the synthesis of the chains of cDNA first, specific to be loaded system and reaction condition
It is as follows：
Following reaction system is added in 200ml microcentrifugal tubes：
The μ l of total serum IgE 2
Oligo dt 1µl
The μ l of DEPC water 3
Centrifuge, be placed in PCR instrument after mixing, it is 70 DEG C to set temperature, is taken out immediately after reacting 10min, ice bath 2min terminates.
Following reagent is continuously added in above-mentioned reaction system：
RNase Inhibitor (40U/l) 0.25µl
dNTP Mixture (10mM) 0.5µl
M-MLV Rtase(200U/l) 0.25µl
5×M-MLV Buffer 2.0µl
H2O（RNase-） 7.0µl
The μ l of methyl thiofuroate 0.3
The μ l of methyl cyclopentadiene 0.1
Centrifuged after mixing, in setting reaction condition in PCR instrument as 42 DEG C of 60min, 70 DEG C of 15min are rapid after terminating to take out, ice bath
15min, extremely -20 DEG C of preservation is standby, and long-term preserve then is positioned over -80 DEG C of refrigerators.The methyl thiofuroate and first that the present invention uses
Butylcyclopentadiene interacts with other compositions in reaction system, can avoid producing because of the difference of RNA secondary structures additionally
Reverse transcription product, and the activity of reverse transcriptase can be significantly improved, reverse transcription efficiency is improved, improves cDNA template initial concentrations.
3. the amplification of Sepiella maindroni Sp17 gene core sequences：
The cDNA organized using the Sepiella maindroni male spermary of maturation is expanded respectively as template using primer in table 1
To the product fragment of different length, the reaction system involved by the process is as follows：
2×Es Taq MasterMix (Dye) 12.5µl
Primer F 0.5µl
Primer R 0.5µl
cDNA 0.5µl
H2O 11µl
PCR reaction conditions：95℃ 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, react 30 circulations；72℃ 7min；
12 DEG C of 5min terminate；
Table 1 clones Sp17 gene core fragment the primers
Tab 1 Primers used for Sp17 gene clone
| Primer | Sequence（5’to 3’） |
| Sp17-1F | AGCAGATGTTAGCCCTTT |
| Sp17-1R | CTTCAGTATCTTTGGTGCTT |
| Sp17-2F | TCTTCTAGAGGGTTTCGC |
| Sp17-2R | TGCAGGAGCTTTTACTTC |
| Sp17-3F | ACTAAAACTGCTGAAGAG |
| Sp17-3R | TGTAGCAGCAGCACTGACCT |
Pcr amplification product after the completion of reaction detects by 1% agarose gel electrophoresis, and the PCR primer that purpose band be present is entered
Row purifying recovery, concrete operations are as follows：
a）1% Ago-Gel is prepared, loading rear electrophoresis, deposition condition 100V, 150mA, 20min, after electrophoresis terminates, gel is put
Electrophoretic band is scanned in gel imaging system and is preserved, and purpose band is extracted in 1.5ml centrifuge tubes with clean blade（Rnase-）
In, the quality of adhesive tape is weighed on electronic balance, is added according to the given ratio of E.Z.N.A TM Gel Extraction Kit specifications
Enter reagent 1, be placed in 56 DEG C of water bath with thermostatic control and heat 10min, during which taking out concussion every 5min mixes, and accelerates dissolving；
b）Mixed liquor after above-mentioned dissolving is all added in the centrifugal column of kit outfit, 10000rpm centrifugations 2min；
c）Whole liquid in collecting pipe are added in centrifugal column again, repeat aforesaid operations once；
d）The raffinate in collecting pipe is emptied, and 700ml rinsing liquid is added into centrifugal column, 10000rpm centrifugation 1min, is discarded
Waste liquid；
e）700ml rinsing liquids are added into centrifugal column again, and are centrifuged；
f）Exchange clean collecting pipe for, 20mlEB eluents are uniformly added dropwise on adsorbed film, are stored at room temperature 2min, 12000rpm
Under the conditions of centrifuge 5min, collect the purpose PCR primer fragment being recycled；
g）1ml recovery products are taken using nucleic acid-protein detector measure concentration, and serve the survey of Hai Shenggong bioengineering Co., Ltd
Sequence.Expanded by PCR three times, respectively obtained the purpose fragment that length is 338bp, 256bp and 336bp, as shown in Fig. 2
Sample presentation is sequenced and finally splicing has obtained the core fragment of Sepiella maindroni Sp17 genes.
4. Sepiella maindroni Sp17 genes 3,RACE is expanded：
a）The preparation of 3 ' RACE cDNA templates：
The total serum IgE of Sepiella maindroni spermary tissue is extracted, according to SMART™RACE cDNA Amplification Kit are tried
The method of agent box suggestion prepares 3 ' RACE template cDNA, and concrete operations are as follows：
Following reagent is added in 200ml microcentrifugal tubes：
The μ l of spermary total serum IgE 2
3’RACE Adapter 2µl
H2O（Rnase-） 6µl
Concussion mixes reaction system, is placed in after centrifugation in PCR instrument, imposes a condition and is taken out immediately after terminating for 70 DEG C of 2min, reaction,
Ice bath 2min；
Following reagent is added in microcentrifugal tube one step up：
DTT 2µl
5×Buffer 4µl
dNTP Mixture(10mM) 2µl
PowerScript Reverse Transcriptase 2µl
Concussion mixes reaction system, is placed in PCR instrument, imposes a condition after centrifugation：42 DEG C 1.5 hours, 70 DEG C of 7min, reaction terminates
Take out ice bath 2min immediately afterwards, after nucleic acid-protein detector determines concentration, -20 DEG C of guarantors are sub-packed in after being diluted to suitable concn
Deposit standby.
b）The amplification that Sp17 genes 3 ' are held：
The process mainly utilizes Nested PCR Technique, and amplification obtains 3 ' terminal sequences of gene, the primer sequence being related in step reaction
Row see the table below, and concrete operations are as follows：
The RACE the primers of 2 Sp17 genes of table 3 '
Tab 2 Primers used for Sp17 gene 3’RACE
| Primer | Sequence（5’to 3’） |
| 3’-Sp17-outter | AGCAAGATCCAGGCAAGTTTTAGAGGTCA |
| 3’-Sp17-inner | ATGCTATCGACATTGACCTAACTGACCCA |
| 3’RACE Adapter | GCGAGCACAGAATTAATATTTTTTTTTTTT |
i）Nido one takes turns PCR：
Following reaction system is added in 200ml centrifuge tubes：
2×Es Taq MasterMix (Dye) 12.5µl
3’-Sp17-outter 0.5µl
3’RACE Adapter 0.5µl
cDNA 0.5µl
H2O 11µl
Mix the system centrifugation after be placed in PCR instrument, set reaction condition as：94℃ 5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C
1min, react 30 circulations；72℃5min；12℃5min.
ii）Nido two takes turns PCR：
Using a wheel PCR primer as template, following reaction system is added in 200ml centrifuge tubes：
2×Es Taq MasterMix (Dye) 12.5µl
3’-Sp17-outter 0.5µl
3’RACE Adapter 0.5µl
One wheel PCR primer 1.0 μ l
H2O 10µl
Reaction system is mixed, is placed in after centrifugation in PCR instrument, setting reaction condition is as follows：94℃5min；94 DEG C of 30s, 60 DEG C of 30s,
72 DEG C of 1min, react 35 circulations；72℃5min；12℃5min；
Reaction terminates rear product and analyzed by 1% agarose gel electrophoresis, and band is as shown in figure 3, purpose fragment length is 563bp.
Purpose band purifying recovery is extracted, concentration is reclaimed to improve PCR primer, can be admixed together by multitube PCR primer, using second
Alcohol reclaims, specific method：According to PCR primer and absolute ethyl alcohol volume ratio 1:9 mixing, 12000r/min after standing 5 minutes, centrifugation
5min, supernatant is abandoned, then precipitation washed once with 75% ethanol, the precipitation of ttom of pipe and the dry ethanol that volatilizees are retained after centrifugation, is added suitable
Measure water dissolving.PCR primer after recovery is connected on PMD18-T carriers, picking single bacterium culture, is verified by bacterium solution PCR
Work sequencing is given birth to for the Shanghai of delivering to of positive colony.
5. Sepiella maindroni Sp17 genes 5,RACE is expanded：
a）The preparation of 5 ' RACE templates：
Using Sepiella maindroni spermary total serum IgE as template, prepared by the template cDNA that reverse transcription method is equally applicable to 5 ' RACE, behaviour
It is as follows to make step：
Following reagent is added in 200ml centrifuge tubes：
The μ l of spermary total serum IgE 1.0
5’RACE Adapter 1.0µl
Water（Rnase-） 13.5µl
Centrifuge, be positioned in PCR instrument after mixing reaction system, setting reaction condition is 70 DEG C of 10min, rapid after terminating to take out ice
Bathe 2min.
React one step up and following reagent is added in the system of end：
dNTP Mixture(10mM) 1.0µl
10×PCR Buffer 2.5µl
0.1M DTT 2.5µl
MgCl2(25mM) 2.5µl
Centrifuged after mixing reaction system, centrifuge tube is placed in PCR instrument, setting reaction condition is：42℃1min；Take out and add
After SuperScript II RT1ml mix centrifugation, put back in PCR instrument, 42 DEG C of 50min, 70 DEG C of 15min reactions terminate, and take out
Put back to after adding RNase mix 1ml, 37 DEG C of reaction 30min.
b）RACE templates cDNA purifying
React 5 times of volume Solution of addition in the product of end one step up according to PCR primer purification kit operating method
I, it is transferred to after well mixed in centrifugal column, 1min is centrifuged under the conditions of 10000rpm, the waste liquid in collecting pipe is removed, to centrifugal column
Middle addition 350ml Solution II, 12000rpm centrifugation 1min, are repeated once;The collecting pipe more renewed, into centrifugal column
25ml DEPC processing water is added, 1min is incubated under room temperature condition, centrifuges 5min under the conditions of last 12000rpm, obtain after purification
CDNA.
c）CDNA tailings, reaction system are as follows：
The μ l of cDNA 20 after purification
2mM dCTP 5µl
5×Tailing Buffer 10µl
Water（RNase-） 13µl
Centrifuged after mixing, PCR reaction conditions are set as：94 DEG C of 3min, rapid taking-up is placed in after terminating stands 2min on ice, adds
Enter 1ml TdT；Terminate reaction after 37 DEG C of 10min, 65 DEG C of 10min, take out product utilization nucleic acid-protein detector measure concentration,
And use H2O (RNase-) is diluted to suitable concn, is saved backup in -20 DEG C；
d）Sp17 gene 5 's end expands：
The nested PCR method that 5 ' RACE methods are still recommended using kit is carried out, and the primer sequence being related to see the table below, specific step
It is rapid as follows：
The Sp17 gene 5 ' RACE the primers of table 3
Tab 3 Primers used for sp17 5’RACE
| Primer | Sequence（5’to 3’） |
| 5’-Sp17-outter | GCTCCGAACTGAATGA |
| 5’-Sp17-inner | TTTTGGCTGAGCCCGTAG |
| 5’RACE Adapter | GGCCAGGCGTCGACTAGTACGGGGGGGGGG |
i）One wheel PCR：
Following reagent is added in 200ml centrifuge tubes：
2×Es Taq MasterMix (Dye) 12.5µl
5’-Sp17-outter 0.5µl
5’RACE Adapter 0.5µl
cDNA 0.5µl
H2O 11µl
Centrifuged after mixing reaction system, centrifuge tube is placed in PCR instrument, and setting reaction condition is as follows：94℃5min；94 DEG C of 30s, 60
DEG C 30s, 72 DEG C of 30s, react 30 circulations；72 DEG C of 5min, 12 DEG C of 5min, reaction are taken out after terminating；
ii）Two wheel PCR：
Following reagent is added into reaction system：
2×Es Taq MasterMix (Dye) 12.5µl
5’-Sp17-inner 0.5µl
5’RACE Adapter 0.5µl
One wheel PCR primer 1 μ l
H2O 11µl
Reaction system is mixed and centrifuged, centrifuge tube is placed in PCR instrument, and setting reaction condition is as follows：94℃5min；94 DEG C of 30s,
60 DEG C of 30s, 72 DEG C of 30s, react 35 circulations；72 DEG C of 5min, 12 DEG C of 5min, reaction are taken out after terminating；
The PCR primer electrophoresis that reaction terminates by more than reclaims purpose band, and product is analyzed by 1% agarose gel electrophoresis, band
As shown in figure 4, purpose fragment length is 210bp.PCR primer after purification is connected to PMD18-T carriers and goes to DH5 α impressions
In state cell, picking Colony Culture after coated plate, the raw work sequencing in sea is served after bacterium solution PCR checkings.
6. Sp177 gene cDNAs total length and sequence analysis：
The nucleotide sequence obtained using DNAMAN softwares to sequencing is compared and total length is spliced, and obtains the Sp17 by checking
Core sequence and 3 ' and 5 ' terminal sequences, and splice and obtain the full length cDNA sequence of gene.Use ORFfinder（https://
www.ncbi.nlm.nih.gov/orffinder/）The ORFs of online tool predicted gene（ORF）Position, Ran Houyong
ORF region nucleotide sequences are translated as corresponding amino acid sequence by DNAMAN softwares.Predict Sp17 relative molecular mass and wait
Electricity point uses online tool Expasy-ProtParam（http://web.expasy.org/protparam/）.Amino acid
Parent/hydrophobicity analysis uses online tool Expasy-ProtScale (http://web.expasy.org/cgi-bin/
Protscale/protscale.pl), the Server of NetPhos 3.1（http://www.cbs.dtu.dk/services/
NetPhos/）Carry out amino acid phosphorylation site analysis, scratch protein predictor（http://
scratch.proteomics.ics.uci.edu/）Disulfide bond position in analysis of amino acid sequence, protein secondary structure prediction
Using Antheprot5.0 software analysis, using online tool SignaIP（http://www.cbs.dtu.dk/services/
SignalP/）Carry out signal peptide prediction to the amino acid sequence of coding, and with TMHMM Server v .2.0 (http://
Www.cbs.dtu.dk/servi-ces/TMHMM/ transmembrane region prediction) is carried out.Using NCBI online tools to Sp17 amino
Acid sequence carries out Blastx and Blastn analyses, and uses ClustalW2（http://www.ebi.ac.uk/Tools/msa/
clustalo/）Sp17 and its homologous amino acid sequence are compared, conserved structure domain analysis is searched using the online of NCBI
Rope instrument Conserved domain search（https://www.ncbi.nlm.nih.gov/Structure/cdd/-
wrpsb.cgi）.Other 65 Sp17 homologous amino acid sequences selected by phylogenetic analysis both from ncbi database,
Compared using MEGA5.0 softwares and these amino acid sequences are carried out with preliminary processing with ClustalW functions, then used
Phylogeny.fr（http://www.phylogeny.fr/）The Gblooks functions of online website are protected to amino acid sequence
The analysis of amino acid is kept, after exporting accordingly result, amino acid replacement model is predicted using Modelgenerator softwares,
Chadogram model parameter is determined, is finally based on bayesian theory constructing system chadogram using mrBayes softwares.PEST sequences point
Analysis uses online website PEST FIND（http://emboss.bioinformatics.nl/cgibin/emboss/
epestfind）Instrument.
Finally splice obtained Sepiella maindroni Sp17 gene cDNA sequence total lengths common 1463bp, 5 ' UTR areas 92bp, 3'
UTR areas 222bp, the ORFs 1149bp of prediction, 382 amino acid are encoded altogether（Fig. 5）.The transmembrane region analysis shows albumen
Without transmembrane region（Fig. 6）, online signal peptide prediction result shows that Sp17 is free of signal peptide（Fig. 7）, therefore the albumen may
It is positioned at and is played a role extracellular.The protein relative molecular mass of coding is 42.058kDa, isoelectric point 4.66, is hydrophilic
Property albumen.Further analysis finds 45 sites that phosphorylation modification may occur in the protein amino acid sequence be present, though not
In the presence of obvious disulfide bond, but the possibility of potential formation disulfide bond at 34 and 61 amino acids be present.
Use ClustalW on-line analyses（http://www.ebi.ac.uk/Tools/msa/clustalw2/）Sp17 ammonia
Base acid homology, comparison result show Sepiella maindroni Sp17 amino acid sequences and Pacific oyster（Crassostrea gigasXP_011412976.1）, extra large snail（Aplysia californica XP_012936202.1）, the double spot octopus in California
（Octopus bimaculoidesXP_014778086.1）, biomphalaria glabrata（Biomphalaria glabrata XP_
013090015.1）, Anthocidaris crassispina（Strongylocentrotus purpuratusXP_011680588.1）And acorn worm
（Saccoglossus kowalevskiiXP_006818979.1）Similitude be respectively 36%, 36%, 36%, 31%, 44% and
38%, conservative situation of the partial amino-acid in evolution is as shown in Figure 8.Corresponding conservative domain as shown in figure 9,
Contain DD CABYR SP17 domains and at least one IQ structures in Sepiella maindroni Sp17 and its homologous protein
Domain, and DD CABYR SP17 are both present in same position（12-50aa）.
By being found to the secondary structure analysis of Human sperm protein 17, contain 54% spiral in its albumen（Helix）, 3% folding
It is folded（Sheet）, 6% corner（Turn）And 38% random coil（Coil）Structure, each structure is relative on peptide chain
Position is as shown in Figure 10.
65 Sepiella maindroni Sp17 amino acid homology sequences are chosen, based on bayes method constructing system chadogram,
As a result show the double spot octopus in Sepiella maindroni Sp17 and California on evolutionary relationship recently, next to that Pacific oyster, extra large snail,
The mollusks such as Anthocidaris crassispina, biomphalaria glabrata and Anthocidaris crassispina and echinoderm, with people and the affiliation of East Africa baboon
Farthest（Figure 11）.
7. extract total serum IgE in Sepiella maindroni different tissues：
According to said extracted Sepiella maindroni spermary total serum IgE extracting method extraction brain, optic lobe, muscle, Wei, Gill, liver, the heart,
Totally 14 total serum IgEs organized, the RNA of extraction pass through measure 260/ for spermary, vas deferens, seminal vesicle, prostate, spermatophore, intestines, pancreas
Absorbance and electrophoresis checking qualified save backup after -20 DEG C at 280nm.
8. the synthesis of the chains of cDNA first and template dilution：
The extracted total serum IgE reverse transcription from different tissues of previous step is prepared needed for real-time PCR experiments
CDNA templates, specific method is with reference to M-MLV Reverse Transcriptase reagent operation instructions.Needed before reverse transcription
Except interference of the genomic DNA for real-time PCR experiments in the total serum IgE of extraction, comprise the following steps that：
Following reaction system is added in 200ml centrifuge tubes：
Total serum IgE 1ng
5×gDNA Eraser Buffer 2µl
gDNA Eraser 1µl
Water（Rnase-） 8µl
Slightly centrifuged after mixing, centrifuge tube is placed in PCR instrument, set reaction condition as：42 DEG C of 2min, reaction are rapid after terminating
Taking-up is placed in 2min in ice bath.Next the RNA synthesis chains of cDNA first for having removed contaminating genomic DNA, this step are utilized
Reaction needs to add following reaction system in centrifuge tube：
Primer script buffer 24µl
Primerscript RT enzyme mix I1µl
Rt primer mix 1µl
Water（Rnase-） 14µl
Reaction system centrifuges after mixing, be placed in PCR instrument set reaction condition as：37 DEG C of 15min, 85 DEG C of 5s, take out after terminating
Reverse transcription product is immediately placed in 15min in ice bath.Product preserves standby into -20 DEG C of refrigerators.Before computer experiment, prepare
Sepiella maindroni different tissues cDNA needs to be diluted to 100ng/ml concentration, and the process needs to be detected by means of nucleic acid-protein
Instrument determines cDNA concentration, and calculates extension rate.
9. real-time PCR primers design：
Designed for real-time PCR primer, and select Sepiella maindroni β-actin genes
（S.japonicaJN564496.1）As reference gene.Complementation is not present between the primer of design, dimer, hair will not be formed
Card structure, specifying information are：
The primer that the Sepiella maindroni Sp17 gene by fluorescence quantitative PCR of table 4 is used
Table 4 Primers of Sp17 in S.japonicaused in quantitative real-time PCR
| Primer | Sequence（5’to 3’） |
| Sp17-YF | TCATTCAGTTCGGAGCCA |
| Sp17-YR | CCTATCTTCCAAATCAGCACA |
| Actin-F | TGAGAGGGAGATTGTGCGTG |
| Actin-R | GAACATAGATTCTGGAGCACGG |
10. quantitative fluorescent PCR：
Using the quantitative method of relative fluorescence, choose Sp17 gene expression amounts in muscle and be used as reference, and use Man without
Sepia andreana β-actin genes（S.japonicaJN564496.1）As reference gene, compare Sp17 genes in Man needleless crow
Expression difference in 14 kinds of different tissues such as crafty brain, optic lobe, spermary, vas deferens.According to SYBR Permix Ex TaqTM II
Kit reagent operation instructions, reaction system are as follows：
2×SYBR 10.0µl
Sp17-YF 0.8µl
Sp17-YR 0.8µl
cDNA 0.8µl
ROX Reference Dye II 0.4µl
H2O 7.2µl
It is placed in after reaction system centrifugation after mixing in quantitative real time PCR Instrument, each three secondary orifices of sample.Set reaction condition
For：94℃30s;94 5s;59 DEG C of 30s, react 40 circulations；55 DEG C ~ 95 DEG C, 2min terminates.
By real-time PCR methods to Sepiella maindroni brain, optic lobe, muscle, stomach, intestines, pancreas, heart, liver, the gill,
Totally 14 tissues have carried out the expression specificity analysis of Sp17 gene organizations, experiment for spermary, vas deferens, prostate, seminal vesicle, spermatophore
The expression quantity of Sp17 genes is as reference in middle selection muscle.As shown in figure 12, Sp17 genes are in sexal maturity period Man needleless
There is conspicuousness expression in the spermary of cuttlefish, seminal vesicle（p<0.05）, also there is higher expression in brain, spermatophore, vas deferens
Amount, and expression quantity is extremely low in other tissues.
Sepiella maindroni Semen sarameters 17（Sp17）Gene cDNA total length 1463bp, the ORFs of prediction
（ORF）Common 1149bp, encode 382 amino acid, 3 ' UTR areas 222bp, 5 ' UTR areas 92bp.Relative point of predictive coding albumen
Protonatomic mass is 42.058kDa,pI4.66.Signal peptide and transmembrane region analysis for the albumen find that signal peptide is not present in it
And transmembrane region, be not intracellular secretory albumen, containing the phosphorylation site of 45 in the protein amino acid sequence, this
A little sites play a role during cell signalling.DD CABYR SP17 domains of its N-terminal and positioned at 34 and 61
Potentially form the site of disulfide bond at amino acid and Trimeric structures that Human sperm protein 17 is formed during acrosome reaction are relevant.
Further analysis finds that the C-terminal of its amino acid sequence has a potential PEST site, and this can be sheared with Human sperm protein 17
Process for the less albumen of molecular weight is relevant.IQ motifs on peptide chain can combine the glycosyl molecule on egg membrane oolemma with it
Work relevant.And secondary structure analysis find that helical structure accounts for significant proportion on whole peptide chain, is particularly at IQ structures
In domain.Compared by amino acid identity and find that the albumen is not guarded in evolution, with the evolutionary relationships of the double spot octopus in California most
Closely, and similitude is only up to 44%.Finally by the histological difference analysis to Sp17 gene expression amounts, it has been found that Sp17
Gene mainly has notable expression in spermary and seminal vesicle, and the expression quantity in whole sexual gland is more other, and tissue is also higher, therefore,
With reference to achievement in research before it is presumed that Sp17 works in the formation of sperm and maturation.
By the Sepiella maindroni Semen sarameters being prepared be used for improve Sepiella maindroni genital regulating and
Purposes in cancer detection and treatment.
Routine operation in the operating procedure of the present invention is well known to those skilled in the art, herein without repeating.
Technical scheme is described in detail embodiment described above, it should be understood that it is described above only
For the specific embodiment of the present invention, it is not intended to limit the invention, all any modifications made in the spirit of the present invention,
Supplement or similar fashion replacement etc., should be included in the scope of the protection.
Sequence table
<110>Zhejiang Ocean university
<120>Sepiella maindroni Semen sarameters and preparation method and purposes
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1463
<212> DNA
<213>Sepiella maindroni (Sepiella japonica)
<400> 1
tgtgaccgga gagactgtcg agcacggaat aacacgtgta ccttgctatt gaactaaagg 60
acaaagttaa ttcttcgttt tgtaagttaa tcatgtctgt acccttttca aacacaaagt 120
tgagggtacc cagaggtttt gaggctcttc tagagggttt cgctcgtgaa gttctacggg 180
ctcagccaaa atgtatcatt cagttcggag ccatgcattt ctccaatctt ctcaagattc 240
gaacagaaac aggccaagat cctgttgaag agtgtgctga tttggaagat aggttctata 300
acaatgattc attcaagcat gaagctcaag cagatgttag cccttttgtt gcagagacac 360
agatggaagc tcatgccagt gaagaagtaa aagctcctgc agaagagaaa gtgactgata 420
atgctcaaga ggaaatttca cccagtgacg tcacaaatga tgaaaatatt tctgatgctg 480
ctacaaagat tcaagctggg tttaaaggat acaaggttcg aaaagaaatg aaagaacgca 540
agactgaaca ttctgaagag aaaacgactg caggtactat agaagatgct gaaggcacaa 600
aagatgctga aggcactaaa actgctgaag aggctgcaaa tgctgaaagc accaaagata 660
ctgaagaggt taaaaatgca gaagacactg gagatgcagc agataataca aaagaacaag 720
aaatacccaa tgaagaggtt atagatattg acctcaatga cccagaagtg gcaaacgctg 780
ctagcaagat ccaggcaagt tttagaggtc ataaaaccag gagagatctg cttagtaagc 840
aacaatcaga acatctagaa aatgaaaaag atgctaacaa cagtgcaatt acagaagaca 900
atgctatcga cattgaccta actgacccag aggtcagtgc tgctgctaca aaaattcaag 960
caatttttcg tggtcatcag arcaggcaaa aacttaaaga cactcctaag gatccagcaa 1020
gtgagaaaac catgtctcaa aaatctgata gtgccacacc tgttcaagat gctactggtg 1080
accagggaca ggaggatgac aagtctatca actatgagga tccacaggtc caactggctg 1140
ccactaaaat ccaagctggc tttaaaggct accaaacccg caagagccta aagaagcaag 1200
ctgggaattc agaggatctt gaaaaggaca gtggatccta acaagttggt ggatgaaaac 1260
agatggtgtc ttgatggaag aatcctctgt tcctcagtaa agctgataaa atttattgtt 1320
ctgatataat tatttgtatt gataaaataa ctctggtcct attcttattg gctttctccc 1380
ccttcatagt aagggaaatg ttctggcaaa gataaatttc ttattttctt taggaaaaaa 1440
aaaaaaaaaa aaaaaaaaaa aaa 1463
Claims (10)
1. Sepiella maindroni Semen sarameters, it is characterised in that its cDNA total length 1463bp, 5 ' noncoding regions（UTR）
92bp, 3' noncoding region（UTR）222bp, the ORFs of prediction（ORF）Common 1149bp, encode 382 amino acid, coding
Protein relative molecular mass（MW）For 42.058kDa, isoelectric point（pI）4.66.
2. the preparation method of Sepiella maindroni Semen sarameters, it is characterised in that including Sepiella maindroni sperm surface egg
White Sp17 gene clonings and tissue expression specificity's analysis.
3. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：Described
Sepiella maindroni Semen sarameters Sp17 gene clonings are extracted including RNA：Take the essence of sexal maturity male Sepiella maindroni
Nest tissue, total serum IgE liquid is extracted using Trizol methods；The inspection of RNA mass：Existed using nucleic acid-protein detector measure total serum IgE liquid
Absorbing wavelength at 260nm and 280nm, 260/280 value are qualified between 1.8 ~ 2.0；The synthesis of the chains of cDNA first：With inspection
It is template to survey qualified total serum IgE liquid, and the synthesis of the chains of cDNA first is carried out using reverse transcription reagent box；Specific sample-adding system and
Reaction condition is as follows：
Following reaction system is added in 200ml microcentrifugal tubes：
The μ l of total serum IgE 2
Oligo dt 1µl
The μ l of DEPC water 3
Centrifuge, be placed in PCR instrument after mixing, it is 70 DEG C to set temperature, is taken out immediately after reacting 10min, ice bath 2min terminates；
Following reagent is continuously added in above-mentioned reaction system：
RNase Inhibitor (40U/l) 0.25µl
dNTP Mixture (10mM) 0.5µl
M-MLV Rtase(200U/l) 0.25µl
5×M-MLV Buffer 2.0µl
H2O（RNase-） 7.0µl
Centrifuged after mixing, in setting reaction condition in PCR instrument as 42 DEG C of 60min, 70 DEG C of 15min are rapid after terminating to take out, ice bath
15min, extremely -20 DEG C of preservation is standby, and long-term preserve then is positioned over -80 DEG C of refrigerators.
4. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：It is described
Sepiella maindroni Semen sarameters Sp17 gene clonings include the amplification of core sequence：With the Sepiella maindroni of maturation
The cDNA of male spermary tissue is template, expands to obtain the product fragment of different length respectively using primer, the process institute
The reaction system being related to is as follows：
2×Es Taq MasterMix (Dye) 12.5µl
Primer F 0.5µl
Primer R 0.5µl
cDNA 0.5µl
H2O 11µl
PCR reaction conditions：95℃ 5min；94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 30s, react 30 circulations；72℃ 7min；
12 DEG C of 5min terminate；Pcr amplification product after the completion of reaction detects by 1% agarose gel electrophoresis, to purpose band be present
PCR primer carry out purifying recovery；The primer and its sequence are：Sp17-1F：AGCAGATGTTAGCCCTTT；Sp17-1R：
CTTCAGTATCTTTGGTGCTT；Sp17-2F：TCTTCTAGAGGGTTTCGC；Sp17-2R：TGCAGGAGCTTTTACTTC；
Sp17-3F：ACTAAAACTGCTGAAGAG；Sp17-3R：TGTAGCAGCAGCACTGACCT.
5. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：It is described
Sepiella maindroni Semen sarameters Sp17 gene clonings include Sepiella maindroni Sp17 gene 5 's and 3 ' RACE and expand：
Utilize 3 ' RACE and 5 ' RACE technologies amplification Sepiella maindroni Sp17 genes；Wherein, draw used in the RACE of Sp17 genes 3 '
Thing is：3’-Sp17-outter：AGCAAGATCCAGGCAAGTTTTAGAGGTCA；3’-Sp17-inner：
ATGCTATCGACATTGACCTAACTGACCCA；3’RACE Adapter：GCGAGCACAGAATTAATATTTTTTTTTTTT；
The Sp17 gene 5 's RACE the primers：5’-Sp17-outter：GCTCCGAACTGAATGA；5’-Sp17-inner：
TTTTGGCTGAGCCCGTAG；5’RACE Adapter：GGCCAGGCGTCGACTAGTACGGGGGGGGGG.
6. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：Described
Sepiella maindroni Semen sarameters Sp17 gene clonings are spliced including cDNA total lengths：By the Sp17 core sequences by checking
And 3 ' and 5 ' terminal sequence splice the full length cDNA sequence that obtains gene, and according to cDNA amino acid sequence to its physics, change
Learn property and be predicted simultaneously constructing system chadogram.
7. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：It is described
Tissue expression specificity's analysis include extracting the total serum IgE simultaneously reverse transcription of each tissue：Sexal maturity male Man needleless is extracted respectively
The brain of cuttlefish, optic lobe, muscle, Wei, Gill, liver, the heart, spermary, vas deferens, seminal vesicle, prostate, spermatophore, the total serum IgE of intestines and pancreas,
Reverse transcription prepares the cDNA templates needed for real-time PCR experiments；Need to remove genome in the total serum IgE extracted before reverse transcription
Interference of the DNA for real-time PCR experiments, is comprised the following steps that：
Following reaction system is added in 200ml centrifuge tubes：
Total serum IgE 1ng
5×gDNA Eraser Buffer 2µl
gDNA Eraser 1µl
Water（Rnase-） 8µl
Slightly centrifuged after mixing, centrifuge tube is placed in PCR instrument, set reaction condition as：42 DEG C of 2min, reaction are rapid after terminating
Taking-up is placed in 2min in ice bath.
8. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：It is described
Tissue expression specificity analysis include real-time PCR primers design：According to obtained Sp17 full length gene cDNA sequences
Designed for real-time PCR primer, it is specially：Sp17-YF：TCATTCAGTTCGGAGCCA；Sp17-YR：
CCTATCTTCCAAATCAGCACA；Actin-F：TGAGAGGGAGATTGTGCGTG；Actin-R：
GAACATAGATTCTGGAGCACGG。
9. the preparation method of Sepiella maindroni Semen sarameters according to claim 2, it is characterised in that：Described
Tissue expression specificity's analysis includes quantitative fluorescent PCR：Using the quantitative method of relative fluorescence, Sp17 gene tables in muscle are chosen
Reference is used as up to amount, and uses Sepiella maindroni β-actin genes（S.japonicaJN564496.1）As reference gene,
Compare Sp17 genes Sepiella maindroni brain, optic lobe, muscle, Wei, Gill, liver, the heart, spermary, vas deferens, seminal vesicle, prostate,
Expression difference in 14 kinds of spermatophore, intestines and pancreas different tissues, and carry out significance difference analysis.
10. the purposes of Sepiella maindroni Semen sarameters, it is characterised in that the reproduction for improving Sepiella maindroni is adjusted
Purposes in control and cancer detection and treatment.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711069817.4A CN107805277A (en) | 2018-01-29 | 2018-01-29 | Sepiella maindroni Semen sarameters and preparation method and purposes |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711069817.4A CN107805277A (en) | 2018-01-29 | 2018-01-29 | Sepiella maindroni Semen sarameters and preparation method and purposes |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107805277A true CN107805277A (en) | 2018-03-16 |
Family
ID=61591163
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711069817.4A Pending CN107805277A (en) | 2018-01-29 | 2018-01-29 | Sepiella maindroni Semen sarameters and preparation method and purposes |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107805277A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486825A (en) * | 2018-04-28 | 2019-03-19 | 浙江海洋大学 | Sepiella maindroni Spef1 and application thereof |
| CN109868277A (en) * | 2019-03-13 | 2019-06-11 | 浙江海洋大学 | Sepiella maindroni Toll-like receptor gene and its immune defense function |
| CN110438130A (en) * | 2019-08-15 | 2019-11-12 | 浙江海洋大学 | Sepiella maindroni tnf gene and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106906196A (en) * | 2008-03-06 | 2017-06-30 | 哈洛齐梅公司 | The large-scale production of soluble transparent matter acid enzyme |
-
2018
- 2018-01-29 CN CN201711069817.4A patent/CN107805277A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106906196A (en) * | 2008-03-06 | 2017-06-30 | 哈洛齐梅公司 | The large-scale production of soluble transparent matter acid enzyme |
Non-Patent Citations (3)
| Title |
|---|
| 周林等: "曼氏无针乌贼(Sepiella japonica)精子表面蛋白17(Sp17)基因克隆以及组织表达特异性分析", 《海洋与湖沼》 * |
| 生吉萍等: "《普通高等教育"十三五"规划教材 高等学校专业教材 食品基因工程导论》", 28 February 2017, 中国轻工业出版社 * |
| 贾连群等: "《现代基础医学理论与技术进展》", 31 August 2015, 中国医药科技出版社 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109486825A (en) * | 2018-04-28 | 2019-03-19 | 浙江海洋大学 | Sepiella maindroni Spef1 and application thereof |
| CN109868277A (en) * | 2019-03-13 | 2019-06-11 | 浙江海洋大学 | Sepiella maindroni Toll-like receptor gene and its immune defense function |
| CN110438130A (en) * | 2019-08-15 | 2019-11-12 | 浙江海洋大学 | Sepiella maindroni tnf gene and application thereof |
| CN110438130B (en) * | 2019-08-15 | 2023-01-03 | 浙江海洋大学 | Sepiella maindroni TNF gene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107805277A (en) | Sepiella maindroni Semen sarameters and preparation method and purposes | |
| Mingam et al. | DEAD‐box RNA helicases in Arabidopsis thaliana: establishing a link between quantitative expression, gene structure and evolution of a family of genes | |
| Gaillard et al. | Characterization of gonadotropin-releasing hormone (GnRH) genes from cartilaginous fish: evolutionary perspectives | |
| Kazeto et al. | Molecular characterization of three forms of putative membrane-bound progestin receptors and their tissue-distribution in channel catfish, Ictalurus punctatus | |
| Williford et al. | Evolution of a novel function: nutritive milk in the viviparous cockroach, Diploptera punctata | |
| Zheng et al. | Identification of sex chromosome and sex-determining gene of southern catfish (Silurus meridionalis) based on XX, XY and YY genome sequencing | |
| Nakajima et al. | Identification of three novel non-classical cadherin genes through comprehensive analysis of large cDNAs | |
| Kawaguchi et al. | Evolution of teleostean hatching enzyme genes and their paralogous genes | |
| CN109136389A (en) | A kind of DNA bar code standard detection segment CO II, kit and its application method identifying American cockroach | |
| Yamaguchi et al. | Discovery of conventional prolactin from the holocephalan elephant fish, Callorhinchus milii | |
| CN109486825B (en) | Sepiella maindroni Spef1 and application thereof | |
| Si et al. | Characterization of multiple mRNAs that encode mammalian translation initiation factor 5 (eIF-5) | |
| Wang et al. | Insulin-like growth factor 2 (IGF2) gene: molecular characterization, expression analysis and association of polymorphisms with egg production traits in goose (Anser cygnoides) | |
| Samanta et al. | Isolation of RNA from field-grown jute (Corchorus capsularis) plant in different developmental stages for effective downstream molecular analysis | |
| Mita et al. | A relaxin‐like gonad‐stimulating peptide identified from the starfish Astropecten scoparius | |
| CN108486124B (en) | Method for identifying TFAM gene characteristic sequence and meat quality performance of Jiaxing black pig | |
| Phillips et al. | Characterization of the OmyY1 region on the rainbow trout Y chromosome | |
| Shkolnik et al. | Molecular characterization and bioinformatics analysis of Ncoa7B, a novel ovulation-associated and reproduction system-specific Ncoa7 isoform | |
| CN114591976A (en) | Gene for encoding GA2 ox-oxidase and application thereof in judging dwarf mango variety | |
| Saito et al. | Molecular cloning, molecular evolution and gene expression of cDNAs encoding thyrotropin-releasing hormone receptor subtypes in a teleost, the sockeye salmon (Oncorhynchus nerka) | |
| CN103014001A (en) | Bactrian camel myosin gene, recombinant protein and cloning method thereof | |
| Shan et al. | Partial molecular cloning, characterization, and analysis of the subcellular localization and expression patterns of the porcine OTUB1 gene | |
| CN105543184B (en) | Pelteobagrus fulvidraco Cyp24a1 genes and its method for obtaining full length sequence | |
| Sivakumar et al. | Cloning and structural analysis of an Indian little millet (Panicum sumatrense) zein-like storage protein: Implications for molecular assembly | |
| CN110592095A (en) | Clone and expression of sepiella maindroni tretinoin X receptor gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180316 |
|
| RJ01 | Rejection of invention patent application after publication |