CN107746837A - Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application - Google Patents

Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application Download PDF

Info

Publication number
CN107746837A
CN107746837A CN201711066074.5A CN201711066074A CN107746837A CN 107746837 A CN107746837 A CN 107746837A CN 201711066074 A CN201711066074 A CN 201711066074A CN 107746837 A CN107746837 A CN 107746837A
Authority
CN
China
Prior art keywords
goat
pld
pseudotuberculisis
corynebacterium
recombinant proteins
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201711066074.5A
Other languages
Chinese (zh)
Inventor
高华峰
李志明
郑国英
马玉馨
邵庆勇
洪琼花
李华春
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kunming Xishan Animal Husbandry And Veterinary Station
Yunnan Animal Science and Veterinary Institute
Original Assignee
Kunming Xishan Animal Husbandry And Veterinary Station
Yunnan Animal Science and Veterinary Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Kunming Xishan Animal Husbandry And Veterinary Station, Yunnan Animal Science and Veterinary Institute filed Critical Kunming Xishan Animal Husbandry And Veterinary Station
Priority to CN201711066074.5A priority Critical patent/CN107746837A/en
Publication of CN107746837A publication Critical patent/CN107746837A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/04—Phosphoric diester hydrolases (3.1.4)
    • C12Y301/04004—Phospholipase D (3.1.4.4)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/543—Immunoassay; Biospecific binding assay; Materials therefor with an insoluble carrier for immobilising immunochemicals
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Hematology (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Urology & Nephrology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a kind of goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application, belong to gene engineering technology field.The present invention obtains goat Corynebacterium pseudotuberculisis phospholipase D by full genome synthetic method（PLD）Gene removes the sequence of signal peptide, it is subcloned into prokaryotic expression carrier pET28a, induced through IPTG and obtain soluble express protein, through obtaining expressing protein of the purity more than 95% after purification twice, the albumen shows with biological activity through immunoblotting assay, through series of optimum, the assembling of a whole set of ELISA detection kit is completed.Serologic detection is completed to goat after sensitiveness, specificity analysis and immunoprophylaxis monitors, the kit of detection and the monitoring result expression present invention have preferable accuracy, sensitivity and repeatability, adapt to diagnosis and immunologic surveillance that goat Corynebacterium pseudotuberculisis causes infection.

Description

Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application
Technical field
The invention belongs to gene engineering technology field, and in particular to goat Corynebacterium pseudotuberculisis PLD recombinant proteins and its Preparation method and application.
Background technology
Corynebacterium pseudotuberculisis is a kind of facultative intracellular bacterial parasite, and main infection silk floss goat and goat, caused disease claim For caseous lymphadenitis, in terms of the clinical manifestation of disease, it is mainly characterized by the lymph node to suppurate, and this disease is at present in the world In the range of be widely current, also there are this many sick report the country, and goat puppet tuberculosis is the internationally recognized animal epidemic disease for being difficult to purify Disease, it is difficult to which the major reason of preventing and treating is the granulomatous packing of fibroid that abscess surface is surrounded by a thickness and densification, causes medicine It is difficult to penetrate into it by this layer of packing and plays a role, thus systemic administration is ineffective, local application's formality is cumbersome, it is difficult to root Remove.Not only be limited to the treatment to sick goat there is an urgent need to the Shopping mall strategy of more effective epidemic disease, could reduce or Prevent the prevalence of disease and propagated in flock of goats, because Corynebacterium pseudotuberculisis has the higher incidence of disease, thus to continuous mountain Sheep and goat puppet tulase develop new and effective vaccine with regard to particularly necessary, in addition, the necessary condition of exploitation new generation vaccine is that possess The appraisal procedure of corresponding vaccine immunity effect, based on factors above, we have developed this Serology test.
The content of the invention
The invention aims to solve the deficiencies in the prior art, there is provided a kind of goat Corynebacterium pseudotuberculisis P LD weights Histone and preparation method and application.The present invention establishes Corynebacterium pseudotuberculisis antibody test by molecular biology method Method, the ratio that can be infected in fast slowdown monitoring flock of goats and endanger seriousness, coordinate the use of vaccine, available for immune antiboidy Monitoring and immune level evaluation.
To achieve the above object, the technical solution adopted by the present invention is as follows：
Goat Corynebacterium pseudotuberculisis PLD recombinant proteins are the albumen that the amino acid sequence shown in SEQ ID NO.1 forms.
Encode the nucleotide sequence of above-mentioned goat Corynebacterium pseudotuberculisis PLD recombinant proteins, the nucleotide sequence such as SEQ Shown in ID NO.2.
The preparation method of the goat Corynebacterium pseudotuberculisis PLD recombinant proteins, comprises the following steps：
Step (1), using SEQ ID No.3, SEQ ID No.4 as upstream and downstream primer, with the gene shown in SEQ ID NO.2 Enter performing PCR amplification for template, amplified production is connected in pET28a carriers, obtains pET-28a-PLD recombinant vectors；
Described sense primer F：5’-atgagggagaaagttgtttta-3’
Described anti-sense primer R：5’-tcaccacgggttatccgc-3’；
Step (2), pET-28a-PLD recombinant vectors are transferred to the induced expression that fusion protein is carried out in Escherichia coli；
Step (3), it will be centrifuged in step (2) after the Escherichia coli cracking of induced expression fusion protein, then will centrifugation The supernatant collected afterwards is isolated and purified using affinity chromatography, obtains goat Corynebacterium pseudotuberculisis PLD recombinant proteins.
The present invention provides the recombinant bacterium containing the nucleotide sequence.
It is preferred that the host cell that the recombinant bacterium uses is e. coli bl21 (DE3).
The present invention provides goat Corynebacterium pseudotuberculisis PLD recombinant proteins as goat puppet mycobacterium tuberculosis antibody is prepared and detected The application of reagent, kit.
Present invention simultaneously provides the goat puppet tubercle bacillus comprising the goat Corynebacterium pseudotuberculisis PLD recombinant proteins to resist Body detection kit.
Specifically, described goat puppet mycobacterium tuberculosis antibody detection kit, including goat Corynebacterium pseudotuberculisis PLD weights It is histone coating elisa plate, positive control serum, negative control sera, defatted milk, substrate TMB, 25 × PBS, polysorbas20, peppery The rabbit-anti goat antibody and terminate liquid of root peroxidase labelling；
Described negative control sera is the goat negative serum after testing without the infection of goat Corynebacterium pseudotuberculisis；
Described positive control serum is the goat positive serum after testing through goat Corynebacterium pseudotuberculisis superinfection；
Described terminate liquid is 1M H2SO4。
It may further be preferable that the preparation side of described goat Corynebacterium pseudotuberculisis PLD recombinant proteins coating elisa plate Method is：Goat Corynebacterium pseudotuberculisis PLD recombinant proteins are diluted to 2-10 μ g/mL with carbonate buffer solution, added afterwards per hole Enter 100 μ l coated elisa plates, 4 DEG C overnight, produces goat Corynebacterium pseudotuberculisis PLD recombinant proteins coating elisa plate.
The detection reagent that the present invention develops is developed based on virulence gene goat Corynebacterium pseudotuberculisis phospholipase D (PL D) , PLD gene outcome is Corynebacterium pseudotuberculisis Major Virulence Factors, PLD gene code phospholipase Ds-PLD exotoxin, Sphingomyelinase dissociation is catalyzed, increases the permeability of blood vessel, so as to cause bacterium parasitic in the cell, therefore from phagocyte to office The body of portion's lymph node and transport, although not causing direct haemolysis, collaboration haemolysis can be produced, other important virulence factors Including complete memebrane protein (FagA), transport protein (FagB), ATP combinations membrane-associated protein (FagC) and the iron element knot of iron enterobactin Hop protein (F agD).Several gene constitutive operators participate in the absorption of iron, form pseudo- tulase to goat persistent infection.This Individual operator is located at from the downstream of PLD genes, contributes to pseudo- tuberculosis virulence to maintain.
Compared with prior art, its advantage is the present invention：
The present invention after being transformed into E.coli BL21 (DE3), is successfully lured by building prokaryotic expression plasmid pET-28a-PLD Lead and express goat Corynebacterium pseudotuberculisis PLD recombinant proteins.Through SDS-PAGE and Western blot identify, after purification should Recombinant protein has immune response originality.Meanwhile the present invention is built using goat Corynebacterium pseudotuberculisis PLD recombinant proteins as antigen Vertical indirect ELISA, has good sensitiveness, spy by Optimum Experiment condition and multigroup detection analysis of experiments, the inventive method The opposite sex and stability.ELISA detection method is simple to operate, and detection limit is big, is tested without living animal, it also avoid C.p separation Authentication method environmental pollution, pathogen caused by sampling is possible are disseminated and for the visceratonia sense without obvious clinical symptoms The missing inspection situation of dye, there is higher feasibility, the detection available for goat puppet tuberculosis antibody.
Brief description of the drawings
Fig. 1 is fusion protein S DS-PAGE analysis charts；Wherein, M：Protein marker；1：Supernatant before induction；2：20℃ The supernatant collected after induction；3：The precipitation collected after 20 DEG C of inductions；4：The supernatant collected after 37 DEG C of inductions；5：Received after 37 DEG C of inductions The precipitation of collection；
Fig. 2 is that first time nickel agarose affinity chromatography purifies SDS-PAGE analysis charts；Wherein, M：Protein marker； 1：Loading (recombination bacillus coli through ultrasonic degradation)；2：Flow out (the sample pair not purified by nickel agarose affinity chromatography According to)；3-4：50mM Imidazole elution fractions；5：100mM Imidazole elution fractions；6-7：500mM Imidazole Elution fraction；
Fig. 3 is that second of nickel agarose affinity chromatography purifies SDS-PAGE analysis charts；Wherein, M：Protein marker； 1：Before cutting (purifying protein for not cutting off histone label)；2：After cutting (purifying protein of excision histone label)；3：20mM Imidazole elution fractions；4：50mM Imidazole elution fractions；5：500mM I midazole elution fractions；
Fig. 4 is purifying protein Western blot analysis charts；M：Protein Marker；1 and 2 be goat puppet tuberculosis rod Shape bacillus PLD recombinant proteins.
Embodiment
With reference to embodiment, the present invention is described in further detail.
It will be understood to those of skill in the art that the following example is merely to illustrate the present invention, and it should not be regarded as limiting this hair Bright scope.In the examples where no specific technique or condition is specified, according to the technology or condition described by document in the art Or carried out according to product description.Material therefor or the unreceipted production firm person of equipment, it is that can be obtained by buying Conventional products.
Unless otherwise indicated, usual solid is formulated in liquid the present invention, and percentage sign is mass percentage concentration,
Ratio is mass ratio；For liquid dosage in liquid, percentage sign is concentration expressed in percentage by volume, and ratio is volume ratio.
Otherwise percentage sign represents percentage by volume；Ratio is volume ratio.
First, the structure of pET-28a-PLD recombinant vectors
Using SEQ ID No.3, SEQ ID No.4 as upstream and downstream primer, entered using the gene shown in SEQ ID NO.2 as template Performing PCR is expanded, and amplified production is connected in pET28a carriers, obtains pET-28a-PLD recombinant vectors；
Sense primer F：5’-atgagggagaaagttgtttta-3’；(SEQ ID No.3)
Anti-sense primer R：5’-tcaccacgggttatccgc-3’；(SEQ ID No.4)
Specific method is as follows：
The present invention is closed according to goat Corynebacterium pseudotuberculisis phosphatidase virulence gene PLD information, the present invention by full genome The sequence of goat Corynebacterium pseudotuberculisis phospholipase D (PLD) gene removing signal peptide moiety is obtained into method, for follow-up solvable Property expressing protein genetic engineering bacterium expression.
According to virulence gene PLD reference sequences, design pair of primers is used to expanding and analyzing digestion albumen.Sense primer, PLD_F：atgagggagaaagttgtttta；Anti-sense primer PLD_R：Tcaccacgggttatccgc, amplification.
Standard PCR
(1) a 200ul PCR light-wall pipes are taken, sequentially add following reagent：
(2) centrifuged after mixing；
(3) response parameter is set：
1) 94 DEG C of pre-degeneration 3min
2) 94 DEG C, 40Sec
3) 50 DEG C, 40Sec
4) 72 DEG C, 90Sec
5) step 2)~4) circulate 30 times
6) 72 DEG C, 5min is extended
(4) electrophoresis detection on the Ago-Gels of 5 μ L 1%, gel imager observation 852bp positive bars are taken after completion of the reaction Band.
PCR primer purifies (DNA gel absorption method, according to prior art)
(1) common 1% agarose gel electrophoresis, cuts off purpose band, moves in 1.5mL eppendorf；
(2) Binding buffer, 55 DEG C of water-bath 10min are added in the ratio of every 400 μ L/100mg Ago-Gels, really Gel is protected completely to melt；
(3) UN IQ-5 pillars being put into 2mL collecting pipes, the gel solution of thawing is shifted so far, room temperature puts 2min, Room temperature 8000rpm centrifuges 1min；
(4) UN IQ-5 pillars are removed, outwell the waste liquid in collecting pipe, pillar is put back into collecting pipe, adds 500 μ L Wash Solution, room temperature 8000rpm centrifuge 1min；
(5) (4) are repeated；
(6) UN IQ-5 pillars are removed, outwell the waste liquid in collecting pipe, pillar is put back into collecting pipe, allow centrifugation lid to open Open, room temperature 12000rpm centrifugations 1min；
(7) UN IQ-5 pillars are put into a new 1.5mL eppendorf, in pillar center plus 15~30 μ L Elution Buffer, 55 DEG C of placement 5min；
(8) liquid in 12000rpm centrifugations 1min, 1.5mL eppendorf is the DNA fragmentation reclaimed.
DNA double digestion and digestion products purifying
(1) 20 μ L double digestion systems：
(2) vibration is mixed, centrifugation, and 37 DEG C are reacted 2 hours；
(3) recovery purpose fragment of being tapped rubber to recombinant plasmid dna method recovery.
The connection of PCR primer and cloning vector
The pMD18T vector and expression vector pET28a of gene will be connected with, carried out as follows：
Digestion products coupled reaction liquid is prepared by following composition, establishes 20 μ L reaction systems.
The wherein amount of carrier pET28a and digestion products is according to 1：3 mol ratio adds, mixing, 16 DEG C of connection 10h, full dose Convert bacillus coli DH 5 alpha competent cell.
Conversion and Bacteria Culture
(1) 100 μ L competent cell, thaw on ice to just melting；
(2) 5 μ L coupled reaction liquid, are added in competent cell, flicking tube wall makes its mixing, on ice 30min；
(3) 42 DEG C of water-baths 90 seconds, 10min is quenched in ice；
(4) 37 DEG C of preheating LB fluid nutrient medium 1mL are added, are mixed, 200rpm, 37 DEG C of shaken cultivations 1.5 hours；
(5) 4000rpm, room temperature centrifugation 5min, sucks 1mL supernatants, remains 200 μ L, and piping and druming mixes bacterial precipitation；
(6) 100 μ L/ flat boards, it is applied on two flat boards of LB containing kanamycins, 37 DEG C stand overnight culture.
Note：If directly being converted with plasmid, then 2 μ L are added in step (1)；Plasmid is into 200 μ L competent cells, step Suddenly (5) do not have to centrifugation, directly take 100 μ L to be applied on flat board.
After (7) 16~24h, choose single bacterium colony and be inoculated in LB fluid nutrient mediums of the 5mL containing kanamycins, 37 DEG C of shaken cultivations Overnight.
(8) transfer single bacterium colony and identified (method according to PCR amplifications is identified), positive colony is cultivated in a small amount, extracts matter Grain, serve Hai Shenggong bioengineering Co., Ltd measure nucleotide sequence.
The above-mentioned concentration using kanamycins is generally 50ug/ml, but not as concrete restriction.
2nd, induced expression
PET-28a-PLD recombinant vectors are transferred to the induced expression that fusion protein is carried out in Escherichia coli, specific method is such as Under：
Take 1ul pET-28a-PLD recombinant vectors to convert BL21 (DE3), after 42 DEG C of thermal shock 90s, stand 2min on ice, after (LB Bo rth Agar are provided by giving birth to work, article No. on LB solid plates of the coating containing final concentration of 30 μ g/mL kanamycins A507003-0250,4g powder 100mL dd wat er dissolve during use), 37 DEG C of overnight incubations.
Lab scale culture selects optimal inductive condition：Picking expression bacterial strain BL21 (DE3) single bacterium is fallen within triangular flask (10mL LB culture mediums, LB Borth are provided by giving birth to work, and article No. A507002-0250,25g is molten with 1L dd water during use Solution, and kanamycins is added to final concentration of 30 μ g/mL), in 37 DEG C, 220rpm is incubated overnight.By the bacterium solution being incubated overnight by 1:100 ratios are inoculated in 10mL LB culture mediums respectively, add the μ g/mL kanamycins of final concentration 30,37 DEG C, 220rpm is cultivated.
When the OD values of bacterium solution reach 0.6, addition IPTG to final concentration of 0.5mM, 220rpm, 20 DEG C of overnight inductions of difference Or 37 DEG C of induction 4h, do not add IPTG derivants is used as negative control.
Afterwards, 4000rpm centrifuges 10min and collects thalline, abandons supernatant, thalline is hanged with 500 μ L PBS (pH7.4) buffer solutions It is floating, ultrasonication 6min (ultrasonic 0.5s stops 1.5s as a circulation), supernatant precipitation, 500 μ L of precipitation are collected by centrifugation respectively Solubilization of inclusion bodies liquid (8M Urea, 50mM Tris-HCl, 300mM NaCl, PH8.0) dissolve, take respectively 40 μ L collect supernatant, Precipitation, then mixed respectively with 10 μ L5 × protein loading buffer, boiling water bath 10min.
SDS-PAGE is detected, and prepares 12% SDS-PAGE, Tris-Gly electrophoretic buffers (Tris 3.0g, glycine 14.4g, SDS 1.0g, are settled to 1L), the μ L of applied sample amount 10, concentrate glue 80V 20min, separation gel 120V 60min, gel electrophoresis Dye 20min is examined in end, is decolourized；As a result it is as shown in Figure 1.
The bacterium solution of culture is pressed 1:100 ratios are inoculated in 3L LB fluid nutrient mediums and (contain 30 μ g/mL kanamycins), and 37 DEG C, 220rpm culture, when OD values reach 0.6, addition IPTG to final concentration of 0.5mM, 30 DEG C, 220rpm, overnight induction, from The heart collects cell thalline.
3rd, fusion protein isolates and purifies
Ultrasonication thalline：By the broken Buffer (50mM Tris, 300mM NaCl, pH8.0) of the microorganism of collection Dissolving, afterwards plus PMSF to final concentration of 0.5mM, while add TritonX-100 to its concentration expressed in percentage by volume be 0.1%, ice Ultrasonication thalline in bath, power 400W, 20min (ultrasonic 2S pauses 6S is a circulation).Ultrasound finishes, 15000rpm, 4 DEG C Lower centrifugation 20min, collect supernatant and carry out next step purifying.
First time nickel agarose affinity chromatography：5mL Ni-NTA are taken, the Binding buffer with 10 times of bed volumes are clear Wash balance pillar, flow velocity 5mL/min.Upper prop, flow velocity 2mL/min, collection penetrate liquid.The Binding of 10 times of bed volumes Buffer cleans pillar, flow velocity 5mL/min.Wash buffer wash miscellaneous, flow velocity 5mL/min, collect eluent.Elution Buffer elutions (wherein, use imidazole content to do three for the Elution buffer of tri- kinds of concentration of 50mM, 100mM, 500mM Experiment arranged side by side), flow velocity 2mL/min, collect eluent.The component being collected into is subjected to SDS-PAGE detections, Fig. 2 is seen, by 3 groups Divide (50；100；500 imidazoles elution fractions) through 25mM Tris, NaCl, pH8.0,4 DEG C of buffer solution dialysed overnights of 150mM.
Binding buffer：50mM NaH2PO4, 300mM NaCl pH=8.0；
Wash buffer:50mM NaH2PO4, 300mM NaCl, 10mM imidazoles pH=8.0, with preceding plus 1%tritonx- 100,1mM PMSF；
Elution buffer:50mM NaH2PO4, the imidazoles pH=8.0 of 300mM NaCl addition various concentrations.
Second of nickel agarose affinity chromatography：5mL Ni-NTA are taken, are cleaned with the Binding buffer of 1 times of bed volume Balance pillar, flow velocity 5mL/min.Upper prop, flow velocity 2mL/min, collection penetrate liquid.The Binding of 10 times of bed volumes Buffer cleans pillar, flow velocity 5mL/min.Wash buffer wash miscellaneous, flow velocity 5mL/min, collect eluent.Elution Buffer elutions (wherein, use imidazole content to do three simultaneously for the Elution buffer of tri- kinds of concentration of 20mM, 50mM, 500mM The experiment of row), flow velocity 2m L/min, collect eluent.The component being collected into is subjected to SDS-PAGE detections, Fig. 3 is seen, after cutting 3 components are (20 after TEV digestions；50；500 imidazoles elution fractions) it is saturating through 25mM Tris, NaCl, pH8.0,4 DEG C of buffer solutions of 150mM After analysis analysis 1h, in glue box plus PEG 20000 is concentrated, and 15000rpm, 20min, 0.45 μm of CA membrane filtration point is centrifuged at 4 DEG C Fill 1mL/tube, -80 DEG C of preservations
Binding buffer：50mM NaH2PO4, 300mM NaCl pH=8.0；
Wash buffer：50mM NaH2PO4, 300mM NaCl, 10mM imidazoles pH=8.0, with preceding plus 1%tritonx- 100,1mM PMSF；
Elution buffer:50mM NaH2PO4, the imidazoles pH=8.0 of 300mM NaCl addition various concentrations.
The detection of purifying protein --- SDS-PAGE is detected：The SDS-PAGE of preparation 12%, Tris-Gly electrophoretic buffers, The μ g of applied sample amount 1, concentrate glue 80V 20min, separation gel 120V 60min, and gel electrophoresis carries out coomassie brilliant blue staining after terminating 20min, decolourize, as a result see Fig. 4.
Western blot are detected：Glue：Prepare polyacrylamide gel：Concentrate the sample preparation of 5% separation gel of glue 12%：Loading Amount：1ug.Electrophoresis：Concentrate glue 80V, 30min；Separation gel 120V, 60min.Transferring film：Wet turn, 250mA 90min.Closing：5% Skimmed milk power, 37 DEG C of slowly vibrating 2h.It is incubated primary antibody：Primary antibody is rabbit-anti his labels (antibody company：Sangon Biotech, compile Number：D110002), 1:500 dilutions, 37 DEG C of slowly vibrating 60min.It is incubated secondary antibody：Secondary antibody is goat antirabbit (antibody company： Sangon Biotech, numbering：D110058), 1:8000 dilutions, 37 DEG C of slowly vibrating 60min.Colour developing：TMB develops the color, as a result table Bright recombination fusion protein size is 29kDa.
Western blot analyzing proteins activity：Western blot are carried out using goat puppet tuberculosis positive serum as primary antibody Detection is (see Fig. 4).There is the specific band that a size is 33KDa on pvdf membrane.It is indicated above that pET-28a-PLD plasmids In e. coli bl21 (DE3) after induced expression, the goat Corynebacterium pseudotuberculisis PLD recombinant proteins obtained can be by mountain Sheep puppet tuberculosis positive serum identifies.And the specific immunity trace reaction according to being occurred shows that the recombinant protein has good Good antigen-reactive originality.
4th, the assembling and use of kit
This kit is using lowlenthal serum antibody in EUSA detection sample.It is coated with advance on 96 orifice plates Good goat Corynebacterium pseudotuberculisis PLD recombinant proteins, measuring samples are added in coating hole and are incubated, if containing in measuring samples Pseudo- tuberculosis antibody, coated antibody is with antigen with specifically combining to form compound.By washing, the anti-goat of anti-rabbit is added Enzyme labelled antibody, uncombined enzyme labelled antibody is washed away after effect.Developed the color after being eventually adding substrate solution, color is presented in reacting hole The depth and the content of antibody in sample are proportionate.
Kit package：
The hole of 1. goat puppet tuberculosis virulence gene PLD purifying proteins of quantity 96 is coated with removable 2 pieces of plate
2. positive control 2ml
3. negative control 2ml
4. defatted milk 5g
5.Tween 20 2ml
6. the μ L of crosslinking agent secondary antibody 50
7. substrate TMB 10ml
8.25 × washing lotion 35ml
9. terminate liquid 20ml
All reagents, which are both needed to be stored in 2-8 DEG C, to be kept in dark place.
2-8 DEG C has been sealed off after untapped elisa plate vacuum-pumping to preserve or freeze under the conditions of -20 DEG C.
Reagent constituents：
1.96 hole elisa plate：Antigen coat elisa plate, 4 DEG C of preservations are coated in using the protein concentration of optimization.
2. negative control sera：Goat negative serum after testing without the infection of goat Corynebacterium pseudotuberculisis.
3. positive control serum：Goat positive serum after testing through goat Corynebacterium pseudotuberculisis superinfection.
4. defatted milk：DifcoTMSkim Milk are produced, and are closed overnight with 5% (mass concentration) during closing.
5.25 × washing lotion：Ph7.2PBS is formulated, and is diluted with distilled water into 1 times of concentration during use.
6.Tween 20：During use per 1L washing lotions in add 1mL, final concentration of 1 ‰.
7. crosslinking agent secondary antibody：The rabbit-anti goat antibody of horseradish peroxidase-labeled, with 1 during use：50000 concentration are dilute Release.
8. substrate TMB：BIOFX TMB one component HRP Microwell Substrate, per hole during use 100 μ L are added, are kept in dark place.
9. terminate liquid：1M H2SO4, 100 μ L are added during use per hole.
Using the operating procedure of goat puppet mycobacterium tuberculosis antibody detection kit detection goat puppet mycobacterium tuberculosis antibody：
1. all components in kit are first returned into room temperature before sample-adding.
2. closing：It is that 5% defatted milk is closed overnight into elisa plate to add mass concentration；
3. washing, which discards defatted milk, adds 300 μ L work cleaning solutions (1 times of washing lotion PBS) per hole, by 25 × PBS purified waters 25 times of progress board-washings of dilution, convenient preserve are washed 5 times altogether, and each board-washing will abandon most cleaning solution as far as possible, and on the gauze of cleaning ELISA Plate is patted to remove remaining cleaning solution.
4. sample-adding：Add 100 μ L test samples per hole, each sample adds holes, while sets positive, each holes of negative control hole (Positive control wells add positive control serum, and negative control hole adds negative control sera)；After sealed membrane shrouding, 22 are placed Acted on 1 hour at ± 5 DEG C.
5. washing：Discard sample adds 300 μ L work cleaning solutions (1 times of washing lotion PBS) to carry out board-washing per hole, washs 5 times altogether, Each board-washing will abandon most cleaning solution as far as possible, and pat ELISA Plate on the gauze of cleaning to remove remaining cleaning solution.
6. enzyme-added labeling antibody：The rabbit-anti goat antibody of 100 μ L horseradish peroxidase-labeleds is added per hole, is sealed with sealed membrane Place after plate and acted on 1 hour at 22 ± 5 DEG C.
7. washing is " the same as 3 ".
8. add nitrite ion：100 μ L substrate TMB are added per hole, room temperature black out acts on 10 minutes.
9. add terminate liquid：100 μ L terminate liquids are added per hole.
10. reading：After terminating reaction, each hole OD values are read with 450nm wavelength on enzyme-linked readout instrument rapidly.
As a result judge：
When negative control OD value (450nm) be less than 0.2 and positive control OD values (450nm) more than 0.6 when result of the test into It is vertical.
Measuring samples OD values (450nm) are judged to the positive more than 0.5；0.3≤OD values (450nm)≤0.5 are judged to suspicious； OD450 values are judged to feminine gender less than 0.3.Suspicious specimen should again be examined, examine again and be still judged to feminine gender to be suspicious.
5th, kit and its testing conditions Optimum Experiment
(1) foundation of indirect ELISA method
1st, the optimization of antigen coat concentration and serum dilution
Using square formation titration, with carbonate buffer solution by recombinant protein PLD be diluted to 2 μ g/mL, 4 μ g/mL, 6 μ g/mL, 8 μ g/mL, 10 μ g/mL, the liquid coated elisa plate added per hole after 100 μ l dilutions, 4 DEG C overnight.
By known pseudo- tuberculosis positive serum and negative serum with 1：100、1：200、1：400 3 gradient dilutions, add per hole Enter 100 μ l, 37 DEG C of incubation 1h, carry out indirect ELISA experiment, ELIASA is in OD450nm readings, by positive serum (P) and feminine gender Serum (N) ratio (P/N) is maximum and OD450nm values closest to one group of 1.0 as optimal antigen concentration and optimal serum-dilution Degree, follow-up test is carried out with this.
2nd, the selection of closed reagent
The BSA for being 1% from mass concentration, mass concentration are that 5% defatted milk adds 100 μ l as closed reagent, every hole, 4 DEG C of closings are overnight.OD450nm values are determined, analyze P/N size, select the closed reagent of larger one group of ratio as final envelope Close reagent.
3rd, the optimization of secondary antibody working concentration and working time
Under above-mentioned optimal conditions, the rabbit-anti goat antibody of horseradish peroxidase-labeled is diluted to 1 respectively：20000、 1：50000、1：100000,100 μ l are added per hole, 37 DEG C of incubations determine OD450nm values, and analysis draws best effort concentration. The optimization of time is operated on the basis of this.30min, 45min, 60min are incubated respectively at 37 DEG C, by ELIASA reading, is divided Analysis draws the best effort time.
4th, the optimization of developing time
Tested using the optimum experimental condition of determination, developed the color using TMB, 100 μ l are added per hole, lucifuge develops the color respectively 1M H are added after 5min, 10min, 15min2SO4Terminating reaction, OD450nm readings are analyzed, it is determined that optimal developing time.
(2) indirect ELISA replica test
1st, repeat to test in criticizing
Tested in same goat Corynebacterium pseudotuberculisis PLD recombinant proteins coating elisa plate.Take goat puppet tuberculosis 1 part of positive serum, 1 part of negative serum, 2 parts of serum to be checked simultaneously set 1 group of blank control (blank control is not increase serum).Every part Sample repeats 5 holes, records OD450nm values, and calculates average, standard deviation, the coefficient of variation (CV values), judges to criticize interior repeat Property.
2nd, repeat to test between criticizing
5 coated elisa plates of different time are selected, take each 1 part of goat puppet tuberculosis positive serum, negative serum, it is to be checked 2 parts of serum simultaneously sets one group of blank control (blank control is not increase serum), carries out indirect ELISA experiment.Record OD450nm Value, average, standard deviation and CV values are calculated, judge repeatability between criticizing.
(3) indirect ELISA specific test
With goat puppet tuberculosis positive serum and negative serum as a control group, goat aphtha, goatpox, goat Bu Shi are detected The positive serum of bacillosis, according to OD450nm readings, the specificity of the established indirect ELISA of judgement.
(4) determination of critical value
25 parts of goat puppet tuberculosis positive serums that laboratory preserves, indirect ELISA experiment is carried out by the optimum condition of optimization. OD450nm values are recorded, calculate averageWith standard deviation (SD).According to Principle of Statistics, when sample OD450nm values >=When, be defined as the positive, when sample OD450nm values≤When, be defined as feminine gender, between the two it Between need to detect again for suspicious specimen.
(5) detection of clinical sample
The 91 parts of goat puppet antitubercle sera samples preserved to laboratory detect.It is wherein known to there are 30 parts of blood serum samples to adopt Have the goat of obvious body surface lesion by oneself, 15 parts of blood serum samples are negative serum sample, and remaining 46 parts are stochastical sampling.
(6) foundation of indirect ELISA method
1st, the determination of optimal antigen coat concentration and serum dilution
When antigen coat concentration is 4 μ g/mL, serum diluting multiple 1：When 100, P/N values are larger and OD450nm values most connect Nearly 1.0 (being shown in Table 1).Therefore it is set to optimum condition.
The optimal antigen coat concentration of table 1 and serum dilution
2nd, the determination of optimal closed reagent
Use quality concentration be 1%BSA as closed reagent when, its P value is that 0.952, N values are 0.2267, P/N 4.2. Use quality concentration be 5% defatted milk as closed reagent when, P values are that 0.9858, N values are 0.2176, P/N 4.53.Cause This, final choice is that 5% defatted milk is used as closed reagent by the use of mass concentration.
3rd, optimal secondary antibody working concentration and the determination of working time
When ELIAS secondary antibody is with 1：During 50000 dilution, P/N values are larger and OD450nm is closest to 1.0, with this by this concentration The best effort concentration of secondary antibody the most.Although 1：During 20000 dilution, P/N values are maximum, but due to now OD450nm values greatly In 2, beyond 1.0~1.5 section of ELIASA sensitivity, therefore give up and (be shown in Table 2).The best effort time determine 45min (see Table 3).
The enzyme labelled antibody best effort concentration of table 2
The enzyme labelled antibody best effort time of table 3
4th, the determination of optimal developing time
Developed the color using TMB, lucifuge colour developing 10min P/N is maximum, Given this when OD450nm values be 1.1956, contracting can be passed through Short time allows it closer to 1.0.It is therefore contemplated that developing time is optimal (being shown in Table 4) in 8-10m in.
4 optimal developing time of table
5 indirect ELISA replica test interpretations of result
Replica test interpretation of result in 5.1 batches
By four groups of serum and one group of blank control test result (being shown in Table 5), it is 8.1% to obtain positive serum CV values, cloudy Property change of serum C V values be 9.2%, change of serum C V values to be checked are respectively 4%, 1.4%, and blank control C V values are 6.6%, are below 10%.Show that batch interior repeatability is good.
The interior replica test result of 5 batches, table
Replica test interpretation of result between 5.2 batches
Tested using five coated ELISA Plates of different time, five groups of samples are respectively pseudo- tuberculosis positive serum, the moon Property serum, serum to be checked 1, serum to be checked 2, blank control.By be calculated CV values be respectively 7.8%, 8.4%, 5.8%, 5.7%th, 4.2%, both less than 10% (being shown in Table 6).Result above shows, is established using recombinant protein PLD as envelope antigen Repeatability between indirect ELISA method has good batch.
6 batches of replica test results of table
(7) specific test interpretation of result
Obtained according to ELIASA reading, OD450nm values are respectively goat aphtha 0.942, goatpox 0.0782, goat Bu Shi Bacillosis 0.054, it is feminine gender.Show that this method has good specificity.
(8) determination of critical value
According to 25 parts of pseudo- tuberculosis negative serum testing results (being shown in Table 7), it is 0.1595 to calculate average value, and standard deviation is 0.0482.Therefore, when OD450nm values >=0.3398, it is determined as the positive；During OD450n m values≤0.2916, it is determined as feminine gender； During 0.2916≤OD450nm≤0.3398, it is determined as suspicious specimen, need to detects again.
The critical value test data of table 7
A B C D E
1 0.189 0.2018 0.2017 0.1875 0.1993
2 0.2434 0.1444 0.1834 0.1179 0.1747
3 0.2792 0.2832 0.1707 0.2993 0.1967
4 0.2698 0.1517 0.1262 0.1708 0.1718
5 0.2011 0.1705 0.1918 0.2357 0.1491
The Analysis of test results of clinical sample：The detection of 91 parts of blood serum samples, it is known that 30 parts of positives and 15 parts of the moon Property sample all accurate detections, it is seen that its sensitiveness is good.The testing result of remaining 46 parts of sample is, 26 parts of positive, 20 parts of negative sample, positive rate 56.5%.Thus, it is suspicious to recognize that the pseudo- infection conditions lungy of goat are more serious, and There are many goats for not occurring clinical symptoms or visceratonia infection, it is very necessary to carry out detection work.
The present invention after being transformed into E.coli BL21 (DE3), is successfully lured by building prokaryotic expression plasmid pET-28a-PLD Lead and express PLD albumen.Identified through SDS-PAGE and Western blot, recombinant protein after purification has immune response former Property.And indirect ELISA is established using recombinant protein PLD as antigen, pass through Optimum Experiment condition and multigroup detection analysis of experiments.This Method has good sensitiveness, specificity and stability.ELISA detection method is simple to operate, and detection limit is big, is moved without live body Thing is tested, and be it also avoid C.p isolation and identification methods environmental pollution, pathogen caused by sampling is possible and is disseminated and for nothing The missing inspection situation of the visceratonia infection of obvious clinical symptoms, there is higher feasibility, the inspection available for goat puppet tuberculosis antibody Survey.
General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry Personnel are it should be appreciated that the present invention is not limited to the above embodiments, and the simply explanation described in above-described embodiment and specification is originally The principle of invention, without departing from the spirit and scope of the present invention, various changes and modifications of the present invention are possible, these changes Change and improvement all fall within the protetion scope of the claimed invention.The claimed scope of the invention by appended claims and its Equivalent thereof.
Sequence table
<110>Yunnan Livestock Farming Vet Academy of Sciences
Xishan District, Kunming City animal and veterinary station
<120>Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 284
<212> PRT
<213>Artificial sequence ()
<400> 1
Met Ala Pro Val Val His Asn Pro Ala Ser Thr Ala Asn Arg Pro Val
1 5 10 15
Tyr Ala Ile Ala His Arg Val Leu Thr Thr Gln Gly Val Asp Asp Ala
20 25 30
Val Ala Ile Gly Ala Asn Ala Leu Glu Ile Asp Phe Thr Ala Trp Gly
35 40 45
Arg Gly Trp Trp Ala Asp His Asp Gly Ile Pro Thr Ser Ala Gly Ala
50 55 60
Thr Ala Glu Glu Ile Phe Lys His Ile Ala Asp Lys Arg Lys Gln Gly
65 70 75 80
Ala Asn Ile Thr Phe Thr Trp Leu Asp Ile Lys Asn Pro Asp Tyr Cys
85 90 95
Arg Asp Ala Arg Ser Val Cys Ser Ile Asn Ala Leu Arg Asp Leu Ala
100 105 110
Arg Lys Tyr Leu Glu Pro Ala Gly Val Arg Val Leu Tyr Gly Phe Tyr
115 120 125
Lys Thr Val Gly Gly Pro Ala Trp Lys Thr Ile Thr Ala Asp Leu Arg
130 135 140
Asp Gly Glu Ala Val Ala Leu Ser Gly Pro Ala Gln Asp Val Leu Asn
145 150 155 160
Asp Phe Ala Arg Ser Glu Asn Lys Ile Leu Thr Lys Gln Lys Ile Ala
165 170 175
Asp Tyr Gly Tyr Tyr Asn Ile Asn Gln Gly Phe Gly Asn Cys Tyr Gly
180 185 190
Thr Trp Asn Arg Thr Cys Asp Gln Leu Arg Lys Ser Ser Glu Ala Arg
195 200 205
Asp Gln Gly Lys Leu Gly Lys Thr Phe Gly Trp Thr Ile Ala Thr Gly
210 215 220
Gln Asp Ala Arg Val Asn Asp Leu Leu Gly Lys Ala Asn Val Asp Gly
225 230 235 240
Leu Ile Phe Gly Phe Lys Ile Thr His Phe Tyr Arg His Ala Asp Thr
245 250 255
Glu Asn Ser Phe Lys Ala Ile Lys Arg Trp Val Asp Lys His Ser Ala
260 265 270
Thr His His Leu Ala Thr Val Ala Asp Asn Pro Trp
275 280
<210> 2
<211> 853
<212> DNA
<213>Artificial sequence ()
<400> 2
atgcttccgg tagggaatgc agctgcagcg cctgttgtgc ataacccagc ttctacagca 60
aatcggccag tctatgcgat tgcccaccgc gttttaacca ctcaaggcgt ggatgacgca 120
gttgcgatcg gtgcgaatgc gttagaaatt gacttcactg cgtggggtcg tggctggtgg 180
gcagatcatg atggtattcc tactagcgca ggtgctactg cagaggaaat ttttaagcat 240
atagctgata agcgtaagca gggagcaaat attactttca cctggcttga catcaagaat 300
ccagactact gcagggatgc tcgtagtgtg tgctccataa atgcgttgcg tgatttggca 360
cgtaaatatc ttgagccggc aggggttcga gttctctatg ggttctataa gacagtcggc 420
ggacctgcct ggaagacaat caccgctgat cttcgggatg gcgaggcggt agctcttagc 480
ggcccggcgc aggacgtatt aaatgatttt gcaaggtctg aaaataagat ccttactaaa 540
caaaaaatcg ctgactatgg ttactacaac attaaccaag ggtttggtaa ctgctatgga 600
acctggaatc ggacttgtga tcaactccgt aagtccagcg aagctcgtga ccaaggaaaa 660
ctcggtaaaa cttttgggtg gacaatcgct acaggtcagg acgcgcgagt taatgatctt 720
ttaggaaaag ccaacgtaga tggactgatc tttggcttta agattactca cttctaccgt 780
catgcagaca ccgaaaattc tttcaaagcc atcaagaggt gggtggataa gcactccgct 840
actcaccatc tga 853
<210> 3
<211> 21
<212> DNA
<213>Artificial sequence ()
<400> 3
atgagggaga aagttgtttt a 21
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence ()
<400> 4
tcaccacggg ttatccgc 18

Claims (10)

1. goat Corynebacterium pseudotuberculisis PLD recombinant proteins, it is characterised in that the recombinant protein is by SEQ ID NO.1 institute Show the albumen of amino acid sequence composition.
2. encode the nucleotide sequence of the goat Corynebacterium pseudotuberculisis PLD recombinant proteins described in claim 1.
3. nucleotide sequence according to claim 2, it is characterised in that the nucleotide sequence such as SEQ ID NO.2 institutes Show.
4. the preparation method of the goat Corynebacterium pseudotuberculisis PLD recombinant proteins described in claim 1, it is characterised in that including Following steps：
Step（1）, using SEQ ID No.3, SEQ ID No.4 as upstream and downstream primer, using the gene shown in SEQ ID NO.2 as Template enters performing PCR amplification, and amplified production is connected in pET28a carriers, obtains pET-28a-PLD recombinant vectors；
Sense primer F：5’-atgagggagaaagttgtttta-3’；
Anti-sense primer R：5’-tcaccacgggttatccgc-3’；
Step（2）, pET-28a-PLD recombinant vectors are transferred to the induced expression that fusion protein is carried out in Escherichia coli；
Step（3）, by step（2）It is middle to be centrifuged after the Escherichia coli cracking of induced expression fusion protein, then it will be received after centrifugation The supernatant of collection is isolated and purified using affinity chromatography, obtains goat Corynebacterium pseudotuberculisis PLD recombinant proteins.
5. the recombinant bacterium containing nucleotide sequence described in Claims 2 or 3.
6. recombinant bacterium according to claim 5, it is characterised in that：The host cell that the recombinant bacterium uses is Escherichia coli BL21(DE3)。
7. goat Corynebacterium pseudotuberculisis PLD recombinant proteins described in claim 1 are examined as goat puppet mycobacterium tuberculosis antibody is prepared The application of test agent, kit.
8. the goat puppet mycobacterium tuberculosis antibody comprising goat Corynebacterium pseudotuberculisis PLD recombinant proteins described in claim 1 detects Kit.
9. goat puppet mycobacterium tuberculosis antibody detection kit according to claim 8, it is characterised in that：Including the pseudo- knot of goat Core corynebacteria PLD recombinant proteins coating elisa plate, positive control serum, negative control sera, defatted milk, substrate TMB, 25 × PBS, polysorbas20, the rabbit-anti goat antibody of horseradish peroxidase-labeled and terminate liquid；
Described negative control sera is the goat negative serum after testing without the infection of goat Corynebacterium pseudotuberculisis；
Described positive control serum is the goat positive serum after testing through goat Corynebacterium pseudotuberculisis superinfection；
Described terminate liquid is 1M H2SO4。
10. goat puppet mycobacterium tuberculosis antibody detection kit according to claim 9, it is characterised in that：Described goat Corynebacterium pseudotuberculisis PLD recombinant proteins coating elisa plate preparation method be：With carbonate buffer solution by goat puppet tuberculosis rod Shape bacillus PLD recombinant proteins are diluted to 2 ~ 10 μ g/mL, add 100 μ l coated elisa plates per hole afterwards, and 4 DEG C overnight, produce goat Corynebacterium pseudotuberculisis PLD recombinant proteins are coated with elisa plate.
CN201711066074.5A 2017-11-02 2017-11-02 Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application Pending CN107746837A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201711066074.5A CN107746837A (en) 2017-11-02 2017-11-02 Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201711066074.5A CN107746837A (en) 2017-11-02 2017-11-02 Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application

Publications (1)

Publication Number Publication Date
CN107746837A true CN107746837A (en) 2018-03-02

Family

ID=61253495

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201711066074.5A Pending CN107746837A (en) 2017-11-02 2017-11-02 Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application

Country Status (1)

Country Link
CN (1) CN107746837A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110456078A (en) * 2019-09-17 2019-11-15 石河子大学 Detect the albumen and its reagent and kit of sheep MVV and caused infectious disease
CN113759111A (en) * 2021-08-24 2021-12-07 深圳芬德生物技术有限公司 Detection card for detecting pseudotuberculosis corynebacterium antibodies and application and kit thereof
CN113999304A (en) * 2021-10-13 2022-02-01 北京市农林科学院 Anti-enterocin monoclonal antibody mAb4 and application thereof in enterocin detection

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5637303A (en) * 1990-10-25 1997-06-10 Commonwealth Scientific And Industrial Research Organisation Use of a phospholipase D mutant of Corynebacterium pseudotuberculosis for vaccination
CN105181963A (en) * 2015-07-30 2015-12-23 西北农林科技大学 Preparation method for ELISA detection kit of goat corynebacterium pseudotuberculosis antibodies

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5637303A (en) * 1990-10-25 1997-06-10 Commonwealth Scientific And Industrial Research Organisation Use of a phospholipase D mutant of Corynebacterium pseudotuberculosis for vaccination
CN105181963A (en) * 2015-07-30 2015-12-23 西北农林科技大学 Preparation method for ELISA detection kit of goat corynebacterium pseudotuberculosis antibodies

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
ADRIAN L. M. HODGSON ET AL.,: ""Cloning, Nucleotide Sequence, and Expression in Escherichia coli of the Phospholipase D Gene from Corynebacterium pseudotuberculosis"", 《JOURNAL OF BACTERIOLOGY》 *
J. GLENN SONGER ET AL.,: ""Cloning and Expression of the Phospholipase D Gene from Corynebacterium pseudotuberculosis in Escherichia coli"", 《INFECTION AND IMMUNITY》 *
JILL A. HAYNES ET AL.,: ""Production of an enzymatically inactive analog of phospholipase D from Corynebacterium pseudotuberculosis"", 《GENE》 *
匿名: ""GenBank：CP001809.2：24159..25010"", 《GENBANK》 *
匿名: ""P20626（PLD_CORPS）"", 《UNIPROTKB》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110456078A (en) * 2019-09-17 2019-11-15 石河子大学 Detect the albumen and its reagent and kit of sheep MVV and caused infectious disease
CN113759111A (en) * 2021-08-24 2021-12-07 深圳芬德生物技术有限公司 Detection card for detecting pseudotuberculosis corynebacterium antibodies and application and kit thereof
CN113999304A (en) * 2021-10-13 2022-02-01 北京市农林科学院 Anti-enterocin monoclonal antibody mAb4 and application thereof in enterocin detection
CN113999304B (en) * 2021-10-13 2023-10-24 北京市农林科学院 Anti-enterobacterin monoclonal antibody mAb4 and application thereof in enterobacterin detection

Similar Documents

Publication Publication Date Title
Sander et al. Characterization of Bartonella clarridgeiae flagellin (FlaA) and detection of antiflagellin antibodies in patients with lymphadenopathy
CN107746837A (en) Goat Corynebacterium pseudotuberculisis PLD recombinant proteins and preparation method and application
CN101379398B (en) Diagnostic formulation for tsutsugamushi disease
Clayton et al. Detection and identification of Helicobacter pylori by the polymerase chain reaction.
Holec-Gasior et al. GRA2 and ROP1 recombinant antigens as potential markers for detection of Toxoplasma gondii-specific immunoglobulin G in humans with acute toxoplasmosis
CN114807054B (en) Mouse anti-human IgG monoclonal antibody hybridoma cell strain, antibody composition and kit
CN108486064A (en) The monoclonal antibody and application of hybridoma cell strain Anti-CLasMcAb1 and its secretion
Ortiz et al. Use of the 27-kilodalton recombinant protein from Paracoccidioides brasiliensis in serodiagnosis of paracoccidioidomycosis
CN103941020B (en) A kind of indirect ELISA reagent kit detecting haemophilus parasuis antibody
CN108486063A (en) The monoclonal antibody and application of hybridoma cell strain Anti-CLas McAb2 and its secretion
CN101235090A (en) Specificity fusion protein applied to tuberculosis rapid diagnosis
CN114957454B (en) anti-CSFV E2 protein nano antibody, fusion protein, preparation method and application thereof
CN106053807B (en) A kind of indirect ELISA testing kit and its detection method of ox source pasteurella multocida antibody
de Haro-Cruz et al. Obtaining an ELISA test based on a recombinant protein of Chlamydia trachomatis
CN113684189A (en) Novel chicken circovirus type 3 strain and detection system based on same
CN102533663A (en) Foot-and-mouth disease hybridoma cell line, monoclonal antibody, detection reagent and kit
CN107312088A (en) Porcine epidemic diarrhea virus specificity SIgA ELISA detection kits and its application
CN103834668A (en) Recombination mycoplasma pneumoniae protein and application thereof
CN103820471A (en) Recombined chlamydia trachomatis protein and application thereof
Alizadeh et al. Evaluation of New ELISA based on rLsa63–rLipL32 antigens for serodiagnosis of Human Leptospirosis
CN111273005B (en) Enzyme linked immunosorbent assay kit and method for detecting toxoplasma gondii IgG antibody
González et al. Evidence of bovine immunodeficiency virus (BIV) infection: serological survey in Argentina
US7201902B2 (en) Production of recombinant protein pap 31 for the diagnosis and prevention of Bartonella bacilliformis infection
CN101979406B (en) Multi-epitope protein for South Africa type II foot-and-mouth disease, and preparation method and application thereof
CN110196337A (en) A kind of ELISA kit diagnosing coenosis

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
WD01 Invention patent application deemed withdrawn after publication

Application publication date: 20180302

WD01 Invention patent application deemed withdrawn after publication