CN107723290A - One kind restructuring human oocyte's oolemma ZP3 albumen and preparation method thereof - Google Patents

Abstract

The invention discloses one kind restructuring human oocyte's oolemma ZP3 albumen and preparation method thereof.Encode the nucleotide sequence such as SEQ ID NO of restructuring human oocyte's oolemma ZP3 albumen：Shown in 1.The nucleotide sequence of the coding ZP3 albumen, obtained by a large amount of screenings, nucleotide sequence codon preference transformation, and eliminate the secondary structure for being unfavorable for expression.Obtained ZP3 sequences, except ensureing that primary structure as naturally, more can guarantee that space structure and naturally closer.The nucleotide sequence for encoding ZP3 albumen is connected phoA promoters and periplasmic secretion signal peptide StII sequences by the present invention, and is transferred in Escherichia coli YK537, and structure obtains the ZP3 colibacillus engineerings of efficient stably excreting expression.Through high density fermentation culture, the high high adjustment induction of phosphorus concentration, ZP3 is present in periplasmic with soluble form.ZP3 expressions are high, account for bacterial protein 20% or so.

Description

One kind restructuring human oocyte's oolemma ZP3 albumen and preparation method thereof

Technical field

The invention belongs to technical field of polypeptide, and in particular to one kind restructuring human oocyte's oolemma ZP3 albumen and its preparation Method.

Background technology

Zona pellucida protein (zone pellucida, ZP) is one layer of epimatrix being centered around around mammalian oocyte, With tissue specificity.In fertilization process, sperm identifies, acrosome reaction occurs with reference to after therewith, penetrates ZP, so that and ovum Fusion.The oolemma of people is made up of 3 kinds of main glycoprotein (ZP1, ZP2 and ZP3).Primary receptors of the wherein ZP3 as sperm With the inducer of acrosome reaction, key effect is played in fertilization process.

ZP3 albumen has very strong antigenicity, and active immunity animal can induce body and produce antibody, can disturb ovum and ovum Information interchange between cystencyte, ovum is set to lose the ability combined with sperm of the same race, therefore ZP3 albumen is considered as that one kind has very much The antifertility vaccine of future；In addition, infertile women its internal ZP3 antibody in part is the positive, thus it is clinically increasingly heavier at present Depending on using ZP3 albumen to detect internal ZP3 antibody as antigen.

Human ZP3 protein is researched and developed as vaccine or diagnostic reagent firstly the need of substantial amounts of, the pure ZP3 eggs of acquisition In vain.Human ZP3 protein is only existed in human oocyte and granular cell, and content is atomic.Using biochemical method from people's ovary ZP3 albumen is separated in tissue, it is not only tissue-derived difficult but also also be difficult to be separated to the ZP3 albumen of high-purity.Therefore, base is passed through Because engineering technology Prepare restructuring human ZP3 protein is that solve difficult optimal path.

Domestic and international researcher expresses people's ovum in the systems such as Escherichia coli, yeast, insect and CHO mammalian cells Oolemma ZP3 albumen.At present soluble protein can be obtained in Pichia pastoris CH cells.Tang Jian etc. is proposed to Pichia anomala expression ZP3 albumen carries out finding its molecular mass heterogeneity when SDS-PAGE and Western-blotting is analyzed and identified, and after purification Protein molecular quality be respectively less than desired value.Found during the amino acid sequence for analyzing ZP3, ZP3 has multiple Yeast proteins in itself The restriction enzyme site of enzyme, it may be possible to which protease present in yeast expression system causes ZP3 expressing proteins by random endless all-hydrolytic. And it is too high using the cost of expressing cho cell, these all govern the research work of ZP3 albumen.

At present, mainly ZP3 parts peptide fragment is expressed using Bacillus coli expression ZP3 albumen, such as leaf will Hua great Expressed in enterobacteria Rosetta2 (DE3) cell in a manner of non-fusion expression 6 people's ZP3 albumen peptide fragments (183~424aa) and 3 people's ZP3 albumen peptide fragments (22~356aa) are expressed in a manner of amalgamation and expression, the albumen of results expression is all the shape with inclusion body Formula is present.It is with the presence of solvable or inclusion bodies without tubulin, is all expressed in endochylema, it is necessary to by ultrasonic disruption Can just come out protein delivery after thalline, not only there is destruction in itself to albumen, and also increase the difficulty of purifying with into This.

The content of the invention

It is an object of the invention to provide one kind restructuring human oocyte's oolemma ZP3 albumen and preparation method thereof.

The technical solution used in the present invention is：

A kind of nucleotide sequence of encoding recombinant human's egg cell oolemma ZP3 albumen, the nucleotide sequence such as SEQ ID NO：1 institute Show.In the present invention by screening, it is determined that this section of nucleotide sequence codon preference transformation, eliminate be unfavorable for expression Secondary structure；And acquisition fragment is longer, includes the more epitopes of ZP3.The ZP3 sequences that the present invention is obtained, except protecting Primary structure is demonstrate,proved as naturally, more can guarantee that its space structure and naturally occurring ZP3 are closer.

A kind of plasmid vector of expression ZP3 albumen, the plasmid vector include promoter sequence, periplasmic secretion signal peptide sequence The nucleotide sequence of row and encoding recombinant human's egg cell oolemma ZP3 albumen described above.

Preferably, promoter phoA.PhoA is escherichia coli alkaline phosphatase phoA gene promoters, can be utilized low Phosphorus induced expression.On the contrary, some other promoters are mostly induced by IPTG, insoluble inclusion body is easily produced, is lured simultaneously It is costly to lead agent IPTG.

Preferably, periplasmic secretion signal peptide be pelB, phoA, ompA, ompF, ompT, lamB, SPA, StII, MalE, One kind in DsbA, TorA or HlyA.

Preferably, periplasmic secretion signal peptide is StII.

A kind of genetic engineering bacterium, the engineering bacteria contain plasmid vector described above.

Preferably, the engineering bacteria is Escherichia coli.

Preferably, the engineering bacteria is Escherichia coli YK537.

A kind of method of fermenting and producing restructuring human oocyte's oolemma ZP3 albumen, comprises the following steps：By any of the above-described Described genetic engineering bacterium carries out Fiber differentiation with hypophosphate culture medium, adds carbon source and nitrogen source in good time, and regulation pH is 7.2~ 7.4, DO>50%, temperature is 28~32 DEG C, induces 10-15h, and centrifugation removes fermented liquid supernatant, obtains thalline, is taken out with TSE solution Raise ZP3 albumen.

Preferably, hypophosphate culture medium includes following component：Peptone, yeast extract (yeast extract or yeast leaching Powder), Mg²⁺, carbohydrate (such as glucose), buffer solution, pH 7.0-7.4.

Preferably, 10g containing peptone, yeast extract or yeast extract 2.5g in every 1000ml hypophosphate culture mediums, MgSO₄·7H₂O 0.5g, phenol red 2ml, glucose 10g, 1mol/L Tris-Cl 50ml, pH 7.0-8.0.

Preferably, TSE solution includes following component：Tris buffer solutions, EDTA and carbohydrate.

Preferably, TSE solution includes following component：20mM Tris-Hcl (pH7.0), 20% glucose, 1mM EDTA.

Preferably, the carbon source added includes glycerine, glucose, molasses.

Preferably, the carbon source added is glycerine.

Preferably, the nitrogen source added includes organic nitrogen source and/or inorganic nitrogen-sourced；Wherein organic nitrogen source includes peptone, ferment Female extract (yeast extract or yeast extract)；It is inorganic nitrogen-sourced including ammoniacal liquor or ammonium salt.

It is furthermore preferred that the nitrogen source added is ammoniacal liquor, it can provide appropriate nitrogen source, while play and can adjust pH value Effect.

A kind of method of fermenting and producing restructuring human oocyte's oolemma ZP3 albumen, comprises the following steps：By any of the above-described Described genetic engineering bacterium is cultivated with hypophosphate culture medium, and after fermentation ends, centrifugation removes fermented liquid supernatant, obtains bacterium Body, extracted to obtain ZP3 albumen with TSE solution.

The beneficial effects of the invention are as follows：

The nucleotide sequence of encoding recombinant human's egg cell oolemma ZP3 albumen disclosed in this invention, it is by a large amount of screenings Obtain, nucleotide sequence codon preference transformation, and eliminate the secondary structure for being unfavorable for expression.The nucleotide sequence energy Efficient amplification, ZP3 sequences are obtained, except ensureing that primary structure as naturally, more can guarantee that space structure and natural ZP3 eggs It is white closer.

The nucleotide sequence of encoding recombinant human's egg cell oolemma ZP3 albumen is connected escherichia coli alkaline phosphatase by the present invention PhoA gene promoters and periplasmic secretion signal peptide StII sequences, and be transferred in Escherichia coli YK537, structure obtain efficiently, The ZP3 colibacillus engineerings of stably excreting expression.

The present invention induces through high density fermentation culture, the high high adjustment of phosphorus concentration, and ZP3 is present in cell week with soluble form Matter.ZP3 expressions are high, account for bacterial protein 20% or so.Because expression is higher, ZP3 can be intactly secreted into carefully In born of the same parents' pericentral siphon, and there is natural activity, not only avoid and slightly propose destruction of the process to protein, and improve purifying yield, Reduce cost.Pass through the ZP3 sterlings of easy, quick purification process, i.e. acquisition high quality.

The inventive method expression quantity is high.By feed profile, the expression of ZP3 albumen is set to reach bacterial protein More than 20%, thalline yield reaches more than 80g/L.

Brief description of the drawings

Fig. 1：Expression vector phoA-ZP3 plasmid construction schematic diagram.

Fig. 2：A is ZP3 PCR amplification figures；Wherein M is DNA Marker (TAKARA companies)；1 is that ZP3 expands production through PCR Thing；The digestion that B is recombinant expression carrier phoA-ZP3 is identified；Wherein M is DNA Marker (TAKARA companies)；1,2 is restructuring Expression vector phoA-ZP3 digestion qualification result.

Fig. 3：A is high density fermentation electrophoretogram；Wherein M is molecular weight standard, and 1 is result before induction, and 2 be to be tied after inducing Fruit；B is the influence of glycerine and glucose feed supplement to thalline yield.

Fig. 4：A is protein electrophoresis detection figure, and 1 is that TSE solution extracts result, and 2 be 0.05 to be rubbed imidazoles in affinity chromatography Elute result, 3 be affinity chromatography in 0.4 rub imidazoles elute result；B is molecular gel exclusion chromatography, and 1,2 be eluting peak；C For efficient liquid phase chromatographic analysis purity of protein；D is the Western blot detection figures of ZP3 destination proteins.

Fig. 5 is protein-chip Detection results figure.

Fig. 6 is receiver operating characteristics curve.

Embodiment

Inventor carries out expression restructuring human oocyte's oolemma by in-depth study extensively with the carrier phoA of structure ZP3 albumen, the carrier contain phoA promoters, can start purpose in the phosphoric acid salt culture medium (low-phosphorous culture medium) containing low concentration The expression of albumen, while the signal peptide StII of secreting, expressing is carried on carrier, contribute to ZP3 eukaryotic genes correct in protokaryon Fold, and be secreted into soluble form in periplasmic space, destination protein just only can release by the extracting of TSE solution, So as to simplify separation purifying technique.

The present invention, but not limited to this is expanded on further with reference to specific experiment.

Test the structure of 1 ZP3 expression engineering bacterias

1. target gene synthesizes

The ZP3 known according to oneself natural acid sequence, certain specific ZP3 nucleic acid sequence fragments is obtained by screening, According to e. coli codon preferences and consider that elimination hairpin structure etc. is unfavorable for the secondary structure of expression, do not changing amino Under conditions of acid sequence, ZP3 coded sequence primer is designed.

Primer sequence ZP3-U：GATGATATGCTAGCCAACCACTGTGGCTGCTGCAG(SEQ ID NO：2)；

Primer sequence ZP3-D：GATGATGGATCCGCTCGCGCTACGGCTCCACT(SEQ ID NO：3).

ZP3 sequences are obtained by bridging PCR method.Resulting ZP3 sequences are shown in SEQ ID NO：1, length is 978bp。

The fragment that the present invention is expanded is different with reported in literature before, and document report is mostly to expand in the prior art Express small fragment.And it is longer by screening the fragment obtained in the present invention, include the more epitopes of ZP3；And it can obtain Efficient amplification, success rate reach 100%.The present invention obtains ZP3 sequences, except ensureing that primary structure as naturally, more can Ensure that its space structure and naturally occurring ZP3 are closer.

The artificial synthesized nucleotide sequence for obtaining recombinating human oocyte zona pellucida ZP3 genes, NheI enzymes are introduced at 5 ' ends of the gene Enzyme site and 3 ' end introduce BamHI restriction enzyme sites.

2. expression plasmid phoA-rhZP3 structure and conversion Host Strains

(expression vector contains phoA secreting signal peptides to the phoA expression vectors that expression plasmid builds and preserved for applicant And periplasmic secretion signal peptide is StII), Host Strains are Escherichia coli YK537.

Gene ZP3 and expression vector phoA, 37 DEG C of digestions, 2 hours recovery phases are handled respectively with NheI and BamHI double digestions The fragment answered, stayed overnight with T4DNA ligases in 16 DEG C of connections.Connection product conversion enters Escherichia coli, is containing ammonia benzyl mould Positive colony is selected on the LB flat boards of plain (l00ug/mL).Expression vector phoA-ZP3 plasmid construction schematic diagram is shown in Fig. 1.

Identified using bacterium colony PCR.During using NheI+BamHI double digestions, size about 1000bp fragment can be cut out, Show that ZP3 gene orders have been correctly inserted into carrier phoA.Digestion result is shown in Fig. 2.

Measure that is forward and inverse to sequence analysis, and entrusting Guangzhou Ai Ji biotech firms progress sequence, card are carried out with conventional method Real cloned sequence and implementation sequence are completely the same.

Test the research of 2 engineering bacteria high density fermentations

Engineering bacteria is inoculated into the 250ml conical flasks of the seed liquors of LB containing 50mI, cultivates 3~4h, treat that OD600 reaches 0.8~1.0, by 1：10 ratio is inoculated in the l000ml conical flasks of the culture mediums of LB containing 250ml, expands 8~10h of culture Left and right, reach 6~8 to OD600.LB culture mediums can be used in cultivation stage, keep the growth of bacterium.LB culture mediums are biochemical molecular realities A kind of culture medium commonly used in testing, can voluntarily be prepared, or purchase commercial prod.Cultivation stage, dissolved oxygen (DO) are controlled 30% More than；PH is controlled 6.8~7.0；Temperature control is at 28~32 DEG C.

Above-mentioned bacterium solution is pressed 1：100 ratio is inoculated in low-phosphorous culture medium and carries out Fiber differentiation.Wherein, it is low-phosphorous per 1000ml 10g containing peptone in hydrochlorate culture medium, yeast extract (yeast extract or yeast extract) 2.5g, MgSO₄·7H₂O 0.5g, benzene Phenol red 2ml, glucose 10g, 1mol/L Tris-Cl 50ml, pH 7.0-8.0.Wherein, the yeast extract of phosphate radical is included Or dusty yeast has carried out halving processing relative to LB culture mediums.It with the addition of quick-acting carbon sources simultaneously --- glucose, and Mg²⁺Promote Expressing protein is more solvable.Phenol red is advantageous to pH value visualization, in order to adjust the pH value of zymotic fluid in time as indicator. Carbon source (glycerine) and nitrogen source (ammoniacal liquor) are added in good time, regulation pH is 7.2~7.4, DO>50%, temperature is 28~32 DEG C, induction 10-15h.Sample carries out SDS-PAGE detections (and scanning), measure protein content.As a result, as shown in Figure 3A, wherein M is molecule Amount standard, 1 is result before induction, and 2 be result after induction；ZP3 protein expression levels reach more than 20% after testing.

Preferably, the carbon source added includes glycerine, glucose, molasses.Can be single carbon source or mixing carbon Source.

Preferably, the carbon source added is glycerine.

By optimizing carbon source, inventor compares the influence of glycerine and glucose feed supplement to thalline yield, as shown in Figure 3 B, Thalline yield is apparently higher than glucose is added after feed supplement adds glycerine, and after fermenting 12 hours, thalline yield is up to more than 80g/L. The time for adding glycerine determines according to general knowledge known in this field.In general, fermentation beginning is, it is necessary to which the glycerine added is less.Treat Ferment the later stage, the OD values of bacterium solution improve slowly, and when dissolved oxygen is held essentially constant, then explanation lacks carbon source, it is necessary to add glycerine.

Preferably, the nitrogen source added includes organic nitrogen source and/or inorganic nitrogen-sourced；Wherein organic nitrogen source includes peptone, ferment Female extract；It is inorganic nitrogen-sourced including ammoniacal liquor or ammonium salt.

It is furthermore preferred that the nitrogen source added is ammoniacal liquor, it can provide appropriate nitrogen source, while play and can adjust pH value Effect.The present invention adjusts pH value merely with ammoniacal liquor.

In the present invention, engineering bacterium expression ZP3 fermentation condition is using culture medium based on specific low-phosphorous culture medium； And the regulation by control parameter (pH, temperature, tank pressure, mixing speed etc.) and fed-batch mode (soda acid and nutrient), regulation The factors such as dissolved oxygen (DO), specific growth rate, reduce the accumulation of acetic acid, improve thalline yield and expression, ferment 12 hours Afterwards, thalline yield is up to more than 80g/L.

The ZP3 coded sequences carrier construction of present invention optimization simultaneously converts Escherichia coli YK537, is trained through high density fermentation Support, expressed in low phosphorus hydrochlorate culture medium, by the guiding of signal peptide, ZP3 is present in periplasmic with solvable, activity form In, while easy purifying process, the method extracted by TSE solution obtains high expression, high yield pulp1, great industrialization value Active ZP3 albumen.

Test 3ZP3 purifying

The present invention extracts to obtain ZP3 albumen using TSE solution.In TSE solution, T is Tris buffer solutions, for adjusting pH Value；E is EDTA, is chelatase；S is sugar, carbohydrate is represented, to adjust, change osmotic pressure.

The present invention is to utilize gentle physical wall breaking method --- permeability evolution obtains ZP3 albumen.First by cell (such as certain density sucrose or glucose solution) is placed in the medium of hyperosmosis, after reaching balance, cell is transferred to buffering In liquid or water, due to the suddenly change of osmotic pressure, water runs through cell membrane and cell membrane enters cell, causes cell membrane and thin After birth swelling fracture, so that cell permeability increases, receive supernatant and obtain ZP3 albumen.

Specific method is as follows：

Configure TSE solution：20mM Tris-Hcl (pH7.0), 20% glucose, 1mM EDTA.

Zymotic fluid 5000rpm at 4 DEG C centrifuges l0min, obtains thalline, and thalline is resuspended using the TSE solution of precooling, and fully Stir.12000rpm centrifuges 10min, must precipitate.20Mm is added, pH7.0 Tris-CL is resuspended, and stirs. 12000rpm centrifuges 10min, receives supernatant.As a result as shown in Fig. 4 A swimming lanes 1.

Chromatographed three times.

1st, affinity chromatography

Chromatography media：Ni-NTA His-Bind Resin.

Buffer solution：Solution A：PBS (pH7.4,20mM).

Solution B：PBS (pH7.4,20mM)+0.02M imidazoles.

Solution C：PBS (pH7.4,20mM)+0.05M imidazoles.

Solution D：PBS (pH7.4,20mM)+0.4M imidazoles.

Loading：Ion is handed over into column chromatography protein solution loading.

Cleaning：After loading chromatographic column is cleaned with solution A.

Elution 1：Peak is washed using the solution B of excess respectively, this peak is the miscellaneous peak without destination protein.

Elution 2,3：Respectively peak is washed using solution C, D.

Collect solution C, D and wash peak, SDS-PAGE electrophoresis detections, as a result such as Fig. 4 A swimming lanes 2, shown in 3.

2nd, molecular gel exclusion chromatography

S-100 molecular sieve gel media are selected, receive peak.By purifying, as shown in Figure 4 B and 4C, can obtain purity 95% with On ZP3 albumen.

The identification and Western blot detections of the restructuring ZP3 albumen of experiment 4

Carried out according to Bio-rad electroporations operating method, cut appropriately sized pvdf membrane first, soak 20min with methanol, Then pvdf membrane is transferred in transfering buffering liquid together with filter paper and foam-rubber cushion.According to blackboard--3 layers of foam-rubber cushion filter paper-PAGE The order of glue--3 layers of pvdf membrane filter paper-foam-rubber cushion-blank, glue is fixed, and blackboard is against the blackboard of transfer groove, and blackboard is on one side Ice chest is placed, transfer groove is placed in ice bath, transferring film 90min under 200mA, then pvdf membrane is taken out and rinsed with 0.01M PBS, Confining liquid (5% skimmed milk power) is added to close 2h.Then by 1:6His monoclonal antibodies (abcam) point of the goat-anti people of 100 confining liquids dilution Onto pvdf membrane, it is incubated overnight in 4 DEG C of wet box.Second day, take out pvdf membrane and wash film 10min × 2 time with PBS.At room temperature with knot Close the secondary antibody (1 for the rabbit-anti sheep for having HRP:200) it is incubated 90min.Film 10min × 2 time are washed with the PBST containing 0.05%Tween 20, Again film 10min is washed with PBS.Pvdf membrane is developed the color in DAB nitrite ions, after occurring to specific hybrid band, uses H₂O terminates aobvious Color.As a result as shown in Figure 4 D, in the purposeful bands of 35KD.

It can be used for detecting after obtained ZP3 protein expressions, such as coating protein chip, then detect people with protein chip The antibody of internal anti-ZP3 albumen.

Test 5ZP3 protein chips

The above-mentioned purifying ZP3 recombinant antigens being prepared are clicked and entered into protein chip.63 are detected respectively using protein-chip The presence (Fig. 5) of ZP3 antibody in individual infertile women's blood serum sample, and tested with the ZP3 listed ELISA detection kit Card, the results are shown in Table 1.

The protein chip of table 1 and the uniformity of ELISA detections

The result of table 1 is shown：15 positives and 48 negative samples are identified using the protein-chip of the present invention, and are used The ZP3 listed ELISA detection kit detects 14 positives and 49 negative samples.With ELISA detection kit phase Than the result totality coincidence rate that protein-chip detection ZP3 antibody obtains is 89.8%, and positive coincidence rate 85.7% is negative Coincidence rate is 93.8%.Protein-chip detects 14 positive serum samples (positive rate 23.8%), and uses AZP3A 12 positive serum samples (positive rate 22.2%) of ELISA kit.

Compare the area under the receiver operating characteristics curve (ROC) of two methods.ROC curve refers to Receiver Operating Characteristics Curve (receiver operating characteristic curve), it is reflection Sensitivity and Specificity continuous variable Overall target, be with composition method disclose Sensitivity and Specificity correlation, it by by continuous variable set out it is multiple not With critical value, so as to calculate a series of Sensitivity and Specificities, then by ordinate, 1- specificity of sensitiveness be abscissa Curve is depicted as, TG-AUC is bigger, and diagnostic accuracy is higher.As a result Fig. 6 is seen, it is 0.934 that protein-chip is shown in figure, Show detect patients with infertility ZP3 antibody when, protein-chip with ELISA Detection results it is close.

SEQUENCE LISTING

<110>Cai Xiangsheng

<120>One kind restructuring human oocyte's oolemma ZP3 albumen and preparation method thereof

<130>

<160> 3

<170> PatentIn version 3.5

<210> 1

<211> 978

<212> DNA

<213>Artificial sequence

<400> 1

caaccactgt ggctgctgca gggtggcgca agccacccgg aaacgagcgt gcaaccggtg 60

ctggttgagt gccaggaagc gaccctgatg gttatggtta gcaaggatct gtttggtacc 120

ggcaaactga tccgtgccgc cgatctgacc ctgggtccgg aggcatgcga accgctggtg 180

agcatggata ccgaggatgt ggtgcgtttt gaggtgggcc tgcacgaatg cggcaacagc 240

atgcaagtga ccgatgatgc cctggtgtat agcacctttc tgctgcatga tccgcgtccg 300

gtgggcaacc tgagcatcgt gcgtaccaat cgcgcagaaa ttccgatcga atgccgttat 360

ccacgtcagg gcaatgtgag cagccaagcg attctgccga cctggctgcc gtttcgtacc 420

accgtgttta gcgaagaaaa actgaccttt agcctgcgtc tgatggagga aaattggaac 480

gcagagaaac gtagcccgac gtttcatctg ggtgacgcag cgcacctgca agcagagatc 540

catacgggta gccatgtgcc gctgcgcctg tttgtggatc attgcgtggc gaccccgacg 600

ccggaccaga acgccagccc gtatcatacc atcgtggatt ttcatggctg tctggtggat 660

ggtctgacgg atgcgagcag cgcgtttaag gtgccacgcc caggtccaga cacgctgcag 720

tttaccgtgg acgtgtttca ttttgcgaat gatagccgta atatgatcta catcacctgc 780

catctgaaag ttaccctggc ggaacaagat ccagacgagc tgaataaagc atgtagcttt 840

agcaaaccga gcaatagctg gttcccagtt gaaggtagcg cagatatttg tcagtgttgc 900

aataaaggcg actgcggcac cccaagccat agccgccgtc agccgcatgt tatgagccag 960

tggagccgta gcgcgagc 978

<210> 2

<211> 35

<212> DNA

<213>Artificial sequence

<400> 2

gatgatatgc tagccaacca ctgtggctgc tgcag 35

<210> 3

<211> 32

<212> DNA

<213>Artificial sequence

<400> 3

gatgatggat ccgctcgcgc tacggctcca ct 32

Claims (10)

1. A kind of 1. nucleotide sequence of encoding recombinant human's egg cell oolemma ZP3 albumen, it is characterised in that the nucleotide sequence such as SEQ ID NO：Shown in 1.
2. A kind of 2. plasmid vector of expression ZP3 albumen, it is characterised in that：The plasmid vector includes promoter sequence, pericentral siphon point The nucleotide sequence of encoding recombinant human's egg cell oolemma ZP3 albumen described in pil signal peptide sequence and claim 1.
3. 3. plasmid vector according to claim 2, it is characterised in that：Promoter is phoA.
4. 4. plasmid vector according to claim 2, it is characterised in that：Periplasmic secretion signal peptide be pelB, phoA, ompA, One kind in ompF, ompT, lamB, SPA, StII, MalE, DsbA, TorA or HlyA.
5. 5. plasmid vector according to claim 4, it is characterised in that：Periplasmic secretion signal peptide is StII.
6. A kind of 6. genetic engineering bacterium, it is characterised in that：The engineering bacteria contains the plasmid vector described in claim 2-5.
7. 7. genetic engineering bacterium according to claim 6, it is characterised in that：The engineering bacteria is Escherichia coli.
8. 8. genetic engineering bacterium according to claim 7, it is characterised in that：The engineering bacteria is Escherichia coli YK537.
9. A kind of 9. method of fermenting and producing restructuring human oocyte's oolemma ZP3 albumen, it is characterised in that comprise the following steps：Will Genetic engineering bacterium described in claim any one of 6-8 carries out Fiber differentiation with hypophosphate culture medium, add in good time carbon source and Nitrogen source, regulation pH are 7.2~7.4, DO>50%, temperature is 28~32 DEG C, induces 10-15h, and centrifugation removes fermented liquid supernatant, obtained Thalline is obtained, is extracted to obtain ZP3 albumen with TSE solution.
10. 10. method according to claim 9, it is characterised in that：Hypophosphate culture medium includes following component：Albumen Peptone, yeast extract, Mg²⁺, carbohydrate, buffer solution, pH 7.0-7.4.