CN107604083A - A kind of early stage detects the PCR method of mycoplasma extensively - Google Patents
A kind of early stage detects the PCR method of mycoplasma extensively Download PDFInfo
- Publication number
- CN107604083A CN107604083A CN201710922669.XA CN201710922669A CN107604083A CN 107604083 A CN107604083 A CN 107604083A CN 201710922669 A CN201710922669 A CN 201710922669A CN 107604083 A CN107604083 A CN 107604083A
- Authority
- CN
- China
- Prior art keywords
- mycoplasma
- pcr
- primer
- detection
- extensively
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Detect the PCR method of mycoplasma extensively the invention discloses a kind of early stage.Design, which obtains one group, first early stage to detect the primer sets of mycoplasma extensively, and further constructs PCR detection method and detection kit.The primer sets include forward primer F and reverse primer R；Sequence is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2.The primer sets and PCR detection method of the present invention are extensive to the amount detection and species of mycoplasma, 115 mycoplasma species can be covered, and high sensitivity, it can realize that mycoplasma early detection is identified, and method it is simple, it is quick, efficiently, it is economical, for the detection of mycoplasma being realized in real work in early days and identification has great importance and application value.
Description
Technical field
The invention belongs to technical field of detection of pathogeny.Detect the PCR side of mycoplasma extensively more particularly, to a kind of early stage
Method.
Background technology
Mycoplasma is the minimum prokaryotes having now been found that.A diameter of 0.2-0.3 μm, acellular wall, have very strong
Deformability.Mycoplasma species is various, widely distributed, and strong influence is caused to basic research and human health.On basis
In research and health, often pollute and endanger caused by more mycoplasma species.Therefore realized early stage polluting and endangering
The detection and identification of mycoplasma, which seem, to be even more important and crucial.
PCR is a kind of common method of detection of mycoplasma, and it has the advantages of quick, sensitive and special.But use at present
In the PCR method of detection of mycoplasma, it is limited to detect the value volume and range of product of mycoplasma, and sensitivity is poor, former particularly in branch
The early stage of pollution and the harm of body, often difficulty detect.
The content of the invention
The technical problem to be solved in the present invention is to overcome amount detection and species existing for existing detection of mycoplasma method to have
Limit, sensitivity is poor, can not realize the defects of early detection identification and deficiency, by optimizing sample process flow and redesigning new
Detection of mycoplasma PCR primer, can be used for the detection of quick early stage more mycoplasma species, there is provided one kind can realize early stage
Testing and appraisal, amount detection and species are extensive, and fast and efficiently detect the method for mycoplasma.
It is an object of the invention to provide the primer sets that one group can detect mycoplasma early stage extensively.
Another object of the present invention is to provide the PCR method for a kind of early stage detecting mycoplasma extensively.
Still a further object of the present invention is to provide the kit for a kind of early stage detecting mycoplasma extensively.
Above-mentioned purpose of the present invention is achieved through the following technical solutions：
One group of primer sets that can detect mycoplasma early stage extensively, including forward primer F and reverse primer R；Sequence is respectively such as
Shown in SEQ ID NO.1 and SEQ ID NO.2.
Primer sets detection mycoplasma value volume and range of product is extensive, and high sensitivity, can be rapidly used for a variety of originals of early stage
The detection of body.
Therefore, application of the primer sets in terms of mycoplasma is detected or answering in terms of mycoplasma test reagent box is prepared
With all should be within protection scope of the present invention.
A kind of early stage detects the PCR method of mycoplasma extensively, is using sample DNA as template, draws using described in claim 1
Thing group enters performing PCR amplification, whether contains mycoplasma according in amplification judgement sample.
Preferably, the standard as a result judged is：Amplified production is subjected to gel electrophoresis, if there is specific band, then
Judge to contain mycoplasma in sample.
Preferably, the reaction system of the PCR amplifications is：μ L of forward primer F (10nM) 1, μ L of reverse primer R (10nM) 1,
μ L of 10 × PCR buffer 2.5, dNTP (2.5mM each) 4 μ L, Ex-Taq 0.25 μ L, μ L of template 2, water supply 25 μ L.
Preferably, the response procedures of the PCR amplifications are：94 DEG C 3 minutes；94 DEG C 30 seconds, 55 DEG C~65 DEG C 30 seconds, 72 DEG C
30 seconds, 30 circulations；72 DEG C 5 minutes；4 DEG C 5 minutes.
It is highly preferred that the response procedures of the PCR amplifications are：94 DEG C 3 minutes；94 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 30
Second, 30 circulations；72 DEG C 5 minutes；4 DEG C 5 minutes.
A kind of early stage detects the kit of mycoplasma extensively, and the kit includes above-mentioned primer sets.
Preferably, for example above-mentioned PCR method of detection method used in the kit.
In addition, the application of the PCR method or the kit in terms of mycoplasma is detected, also all should be in the guarantor of the present invention
Within the scope of shield.
The invention has the advantages that：
Detect the PCR method and its kit of mycoplasma extensively the invention provides a kind of early stage, there is following advantage：
(1) it is sensitive：PCR-based expands, and can detect as little as 1pg mycoplasma DNA；
(2) early detection：Early detection especially suitable for mycoplasma；
(3) extensively：The detection of 115 mycoplasma species can be realized simultaneously；
(4) it is simple：By the flow of optimization, mycoplasma is realized using the centrifugal speed and regular-PCR instrument can of routine
Detection；
(5) it is quick：Pcr amplified fragment about 302bp, whole PCR time are about 1 hour；
(6) it is economical：It is related to reagent that detection of mycoplasma uses and primer is relatively cheap, cost is low.
Brief description of the drawings
Fig. 1 is the amplification of multigroup primer pair in embodiment 1；M:DNA mark, 1,2,3,4：Different primer pairs.
Fig. 2 is detection specific outcome；M:DNA mark, 1：The genomic DNA of mycoplasma known to expression, 2：Represent people's
Genomic DNA, 3：Represent pastoris genomic dna.
Fig. 3 is detection sensitivity result；M:DNA mark, 1-5：10ng, 1ng, 100pg, 10pg, 1pg are represented respectively
Mycoplasma DNA.
Fig. 4 is that primer expands temperature optimization result；M:DNA mark, 1-6：Respectively represent temperature be 55 DEG C, 57 DEG C, 59
℃、61℃、63℃、65℃。
Fig. 5 is the testing result of company A and B mycoplasma test reagent box；M：DNA mark；+：PCR positive controls；-：
PCR negative controls；1-8：Suspection is the different samples of mycoplasma contamination；Wherein 1,5 be same sample；2nd, 6 be same sample
This；3rd, 7 be same sample；4th, 8 be same sample.
Fig. 6 is the testing result of mycoplasma test reagent box of the present invention；M：Mark；-：PCR negative controls；+：PCR positive controls；
1-4：Suspection is the different samples of mycoplasma contamination.
Embodiment
The present invention is further illustrated below in conjunction with Figure of description and specific embodiment, but embodiment is not to the present invention
Limit in any form.Unless stated otherwise, the reagent of the invention used, method and apparatus routinely try for the art
Agent, method and apparatus.
Unless stated otherwise, following examples agents useful for same and material are purchased in market.
The design of primers of embodiment 1 and PCR detection method structure
1st, design of primers
Inventor devises multigroup primer, and sequence is as follows：
Forward primer F (SEQ ID NO.1)：GGCTAACTATGTGCCAGCAGC
Reverse primer R (SEQ ID NO.2)：TGGACTACTAGGGTATCTAATCCT
Forward primer 2：TGTTGAACGGAATGTTCTAGTTTACT
Reverse primer 2：TATTCCTTACTGCTGCCTCCC
Forward primer 3：GATATAATAGAAATTCGCATGAGTTTTTA
Reverse primer 3：TACGGACGCTTTACGCCCAAT
Forward primer 4：AGAAAAAACTAGATAGGAAATGATCTAGTCT
Reverse primer 4：CCTTCGCCTATTGGTGTTCTT
2nd, analyzed and verified by preliminary experiment, screening obtains one group of sensitivity preferably and detection covering mycoplasma species is relative
One group of more primer, i.e. primer pair forward primer F and forward primer R (as shown in Figure 1).
2nd, PCR detection architectures
(1) PCR system is as shown in table 1 below：
The PCR system of table 1
| Composition | Dosage (μ L) |
| Forward primer F (10nM) | 1 |
| Reverse primer R (10nM) | 1 |
| 10×PCR buffer | 2.5 |
| dNTP(2.5mM each) | 4 |
| Ex-Taq | 0.25 |
| Template | 2 |
| Water | Supply 25 |
(2) PCR programs are as shown in table 2 below：
The PCR programs of table 2
3rd, testing result
(1) it is specific
Using known mycoplasma DNA as template, enter performing PCR amplification using above-mentioned primer and PCR detection architectures, as a result such as Fig. 2
Shown, primer of the invention and PCR detection method can exclude eucaryote with specific detection mycoplasma.
(2) sensitivity
Using the known mycoplasma DNA of various concentrations (10ng, 1ng, 100pg, 10pg, 1pg) as template, above-mentioned primer is utilized
Enter performing PCR amplification with PCR detection architectures, as a result as shown in figure 3, the inspection of the primer and PCR detection method of the present invention to mycoplasma
It is preferable to survey sensitivity, minimum detectable 1pg mycoplasma DNA.
The primer of embodiment 2 expands temperature optimization
With the primer of embodiment 1, PCR system and program, amplification temperature is optimized.
As a result as shown in figure 4, it is 55 DEG C~65 DEG C to be applicable amplification temperature range.Consider each factor and most preferably recommend 57
℃。
The detection of mycoplasma scope of embodiment 3
1st, sample collection and processing
More mycoplasma species samples are obtained, sample is collected using 1.5ml centrifuge tubes：Liquid is a small amount of, and solid is a small amount of.Add sterilizing
Water, trim to 1ml.Low velocity centrifugation (1000g-3000g) 3 minutes；Remove solid precipitation.It is careful to draw supernatant, in secondary progress
Centrifugation.Centrifugal speed (9000g-17000g), time are 5 minutes.It is careful to remove supernatant.Aqua sterilisa 1ml is added, precipitation is resuspended,
In secondary centrifugation.Centrifugal speed (9000g-17000g), time are 5 minutes.10ul 1xTE (PH7.5) are added, precipitation is resuspended, takes 2
μ l detect for PCR.
2nd, PCR is expanded
Using the DNA of above-mentioned mycoplasma sample as template, performing PCR is entered with the unexpected anger and PCR detection method of embodiment 1 and expanded
Increase.
3rd, the detection of PCR primer
4th, the sequencing identification of PCR primer and analysis of biological information
PCR primer carries out T-A clones, sequencing.Sequencing result is specifically divided by the online Blast instruments of NCBI
Analysis.
5th, result is shown, primer pair of the invention and PCR detection method can realize the detection of 115 mycoplasma species simultaneously,
115 mycoplasma species are as follows：
M.adleri, M.agalactiae, M.agassizii, M.alkalescens, M.alligatoris, M.alvi,
M.amphoriforme, M.anatis, M.anseris, M.arginini, M.arthritidis, M.auris,
M.bovigenitalium, M.bovirhinis, M.bovis, M.bovoculi, M.buccale, M.buteonis,
M.californicum, M.canadense, M.canis, M.capricolum, M.caviae, M.cavipharyngis,
M.citelli, M.cloacale, M.collis, M.columbinasale, M.columbinum, M.columborale,
M.conjunctivae, M.corogypsi, M.cottewii, M.cricetuli, M.cricetuli, M.crocodyli,
M.cynos, M.dispar, M.edwardii, M.elephantis, M.ellychnium, M.equigenitalium,
M.equirhinis, M.falconis, M.fastidiosum, M.faucium, M.felifaucium, M.feliminutum,
M.felis, M.fermentans, M.flocculare, M.gallinaceum, M.gallinarum, M.gallisepticum,
M.gallopavonis, M.gateae, M.genitalium, M.gypis, M.hominis, M.hyopharyngis,
M.hyopneumoniae, M.hyorhinis, M.hyosynoviae, M.iguana, M.imitans, M.indiense,
M.iners, M.insons, M.iowae, M.lagogenitalium, M.leachii, M.leonicaptivi,
M.leopharyngis, M.lipofaciens, M.lipophilum, M.maculosum, M.meleagridis,
M.microti, M.moatsii, M.mobile, M.molare, M.mucosicanis, M.muris, M.mustelae,
M.mycoides, M.neophronis, M.neurolyticum, M.opalescens, M.orale, M.ovipneumoniae,
M.oxoniensis, M.penetrans, M.phocicerebrate, M.phocidae, M.phocirhinis,
M.phytoplasma, M.plumonis, M.pneumonia, M.primatum, M.prium, M.putrefaciens,
M.salivarium, M.simbae, M.spermatophilum, M.sphenisci, M.spumans, M.stumi,
M.sualvi, M.subdolum, M.synoviae, M.testudineum, M.testudinis, M.verecundum,
M.vulturii, M.yeatsii.
The mycoplasma test reagent box of the present invention of embodiment 4
1st, a kind of early stage detects the kit of mycoplasma extensively, and it is (positive that the kit includes primer sets described in embodiment 1
Primers F and reverse primer R, sequence is respectively as shown in SEQ ID NO.1 and SEQ ID NO.2).
Kit also includes reagent needed for PCR amplifications, such as enzyme, dNTP, PCR buffer.
Further, kit can also include reagent needed for sample DNA preparation.
2nd, the application method of mentioned reagent box is as follows：
Using sample DNA as template, enter performing PCR amplification using the primer sets, amplified production is subjected to gel electrophoresis, if
There is specific band, then judge to contain mycoplasma in sample.
Wherein, the reaction system of the PCR amplifications is：μ L of forward primer F (10nM) 1, μ L of reverse primer R (10nM) 1,10
μ L of × PCR buffer 2.5, dNTP (2.5mM each) 4 μ L, Ex-Taq 0.25 μ L, μ L of template 2, water supply 25 μ L.
The response procedures of PCR amplification are：94 DEG C 3 minutes；94 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 30 seconds, 30 are followed
Ring；72 DEG C 5 minutes；4 DEG C 5 minutes.
5 doubtful sample detection of embodiment
1st, the early detection of mycoplasma
Doubtful mycoplasma infection sample, after the method processing of embodiment 3, it is utilized respectively the branch original that city is purchased from A and B companies
Body detection kit, and the kit of the present invention enter performing PCR detection.
As a result respectively as shown in Figure 5 and Figure 6, the results showed that, mycoplasma test reagent box of the invention can realize branch original
The early detection of body.
2nd, the PCR primer of above-mentioned sample 4 is subjected to T-A clones, sequencing.
Sequencing result is passed through into Blast instruments (https online NCBI://blast.ncbi.nlm.nih.gov/
Blast.cgiPROGRAM=blastn＆PAGE_TYPE=BlastSearch＆LINK_LOC=blasthome) carry out specific
Analysis.
As a result show, detect 11 mycoplasma species in sample altogether, each accounting is as shown in table 3.
Table 3
| Species name | Shared ratio |
| Mycoplasma yeatsii | 61% |
| Mycoplasma arginini | 18% |
| Mycoplasma hyorhinis | 9% |
| Mycoplasma arthritidis | 2% |
| Mycoplasma hominis | 2% |
| Mycoplasma columborale | 2% |
| Mycoplasma gallisepticum | 2% |
| Mycoplasma putrefaciens | 1% |
| Mycoplasma dispar | 1% |
| Mycoplasma californicum | 1% |
| Mycoplasma amphoriforme | 1% |
Sequence table
<110>The First Affiliated Hospital of Xinxiang Medical University
<120>A kind of early stage detects the PCR method of mycoplasma extensively
<130> 1713348ZBSH016
<141> 2017-09-30
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>Mycoplasma (Mycoplasma)
<400> 1
ggctaactat gtgccagcag c 21
<210> 2
<211> 24
<212> DNA
<213>Mycoplasma (Mycoplasma)
<400> 2
tggactacta gggtatctaa tcct 24
Claims (10)
1. one group of primer sets that can detect mycoplasma early stage extensively, it is characterised in that including forward primer F and reverse primer R；Sequence
Row are respectively as shown in SEQ ID NO.1 and SEQ ID NO.2.
2. application of the primer sets described in claim 1 in terms of mycoplasma is detected or in terms of mycoplasma test reagent box is prepared
Using.
3. a kind of early stage detects the PCR method of mycoplasma extensively, it is characterised in that is using sample DNA as template, is wanted using right
Ask 1 primer sets to enter performing PCR amplification, whether contain mycoplasma according in amplification judgement sample.
4. the PCR method according to claim 3, it is characterised in that result judge standard be：Amplified production is coagulated
Gel electrophoresis, if there is specific band, then judge to contain mycoplasma in sample.
5. the PCR method according to claim 3, it is characterised in that the reaction system of PCR amplification is：Forward primer F
(10nM) 1 μ L, μ L of reverse primer R (10nM) 1, μ L of 10 × PCR buffer 2.5, dNTP (2.5mM each) 4 μ L, Ex-
μ L of Taq 0.25, μ L of template 2, water supply 25 μ L.
6. the PCR method according to claim 3, it is characterised in that the response procedures of PCR amplification are：94 DEG C 3 points
Clock；94 DEG C 30 seconds, 55 DEG C ~ 65 DEG C 30 seconds, 72 DEG C 30 seconds, 30 circulation；72 DEG C 5 minutes；4 DEG C 5 minutes.
7. the PCR method according to claim 3, it is characterised in that the response procedures of PCR amplification are：94 DEG C 3 points
Clock；94 DEG C 30 seconds, 57 DEG C 30 seconds, 72 DEG C 30 seconds, 30 circulation；72 DEG C 5 minutes；4 DEG C 5 minutes.
8. a kind of early stage detects the kit of mycoplasma extensively, it is characterised in that the kit includes drawing described in claim 1
Thing group.
9. kit according to claim 8, it is characterised in that detection method used in the kit is claim
3 PCR methods.
10. application of the kit described in PCR method described in claim 3 or claim 8 in terms of mycoplasma is detected.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710922669.XA CN107604083B (en) | 2017-09-30 | 2017-09-30 | PCR method for early and extensive detection of mycoplasma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710922669.XA CN107604083B (en) | 2017-09-30 | 2017-09-30 | PCR method for early and extensive detection of mycoplasma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107604083A true CN107604083A (en) | 2018-01-19 |
| CN107604083B CN107604083B (en) | 2021-02-12 |
Family
ID=61068082
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710922669.XA Expired - Fee Related CN107604083B (en) | 2017-09-30 | 2017-09-30 | PCR method for early and extensive detection of mycoplasma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107604083B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699467A (en) * | 2019-07-31 | 2020-01-17 | 中新国际联合研究院 | Mycoplasma PCR universal primer and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050064451A1 (en) * | 2003-04-11 | 2005-03-24 | Stratagene California | Methods and compositions for the detection of bacterial species |
| CN103627781A (en) * | 2012-08-24 | 2014-03-12 | 华北制药集团新药研究开发有限责任公司 | Kit and method for detecting mycoplasma pollution in CHO cultured cells |
| CN106244697A (en) * | 2016-08-19 | 2016-12-21 | 上海逍鹏生物科技有限公司 | The detection primer sets of mycoplasma, test kit and the method for detection mycoplasma contamination |
-
2017
- 2017-09-30 CN CN201710922669.XA patent/CN107604083B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050064451A1 (en) * | 2003-04-11 | 2005-03-24 | Stratagene California | Methods and compositions for the detection of bacterial species |
| CN103627781A (en) * | 2012-08-24 | 2014-03-12 | 华北制药集团新药研究开发有限责任公司 | Kit and method for detecting mycoplasma pollution in CHO cultured cells |
| CN106244697A (en) * | 2016-08-19 | 2016-12-21 | 上海逍鹏生物科技有限公司 | The detection primer sets of mycoplasma, test kit and the method for detection mycoplasma contamination |
Non-Patent Citations (2)
| Title |
|---|
| 刘劼: "支原体基因组学研究进展", 《中国人兽共患病学报》 * |
| 袁正宏: "《医学微生物学》", 31 March 2016, 复旦大学出版社 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110699467A (en) * | 2019-07-31 | 2020-01-17 | 中新国际联合研究院 | Mycoplasma PCR universal primer and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107604083B (en) | 2021-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| McAuliffe et al. | 16S rDNA PCR and denaturing gradient gel electrophoresis; a single generic test for detecting and differentiating Mycoplasma species | |
| Yu et al. | Evaluation of the rapid MGIT TBc identification test for culture confirmation of Mycobacterium tuberculosis complex strain detection | |
| Jalali et al. | Molecular detection and identification of Theileria species by PCR-RFLP method in sheep from Ahvaz, Southern Iran | |
| CN103409546B (en) | Kit for detecting streptococcus suis type 2 and application of kit | |
| Kim et al. | Comparable characteristics of tuberculous and non-tuberculous mycobacterial cavitary lung diseases | |
| Esmaeilnejad et al. | Determination of prevalence and risk factors of infection with Babesia ovis in small ruminants from West Azerbaijan Province, Iran by polymerase chain reaction | |
| Taghizadeh-Armaki et al. | Effect of involved Aspergillus species on galactomannan in bronchoalveolar lavage of patients with invasive aspergillosis | |
| Badiee et al. | Comparison of histopathological analysis, culture and polymerase chain reaction assays to detect mucormycosis in biopsy and blood specimens | |
| Mina et al. | Purification and characterization of a mycelial catalase from Scedosporium boydii, a useful tool for specific antibody detection in patients with cystic fibrosis | |
| Zhao et al. | Direct molecular diagnosis of aspergillosis and CYP51A profiling from respiratory samples of French patients | |
| Li et al. | Development and evaluation of species-specific PCR for detection of nine Acinetobacter species | |
| Dinoop et al. | Comparison of nested-multiplex, Taqman & SYBR Green real-time PCR in diagnosis of amoebic liver abscess in a tertiary health care institute in India | |
| CN107604083A (en) | A kind of early stage detects the PCR method of mycoplasma extensively | |
| Milimo et al. | Diagnosis of rifampicin-resistant tuberculosis: Discordant results by diagnostic methods | |
| Appak et al. | Comparison of polymerase chain reaction-restriction enzyme analysis method and DNA sequence analysis results in the identification of non-tuberculous mycobacteria | |
| EP1329718B1 (en) | Devices for collecting and preparing specimens for detection of mycobacteria and their antigens | |
| Alizadeh et al. | Development of a SYBR green multiplex real time PCR for simultaneous detection of Mycobacterium Tuberculosis and Nocardia Asteroides in respiratory samples | |
| Verma et al. | Amplification of Hsp 65 gene and usage of restriction endonuclease for identification of non tuberculous rapid grower mycobacterium | |
| Santos et al. | Clinical impact of Xpert® MTB/RIF Ultra for pulmonary TB diagnosis under routine conditions in a reference center in Brazil | |
| EP2853594A1 (en) | Primer and probe for detection of Mycobacterium intracellulare, and method for detection of Mycobacterium intracellulare using the primer or the probe | |
| CN105177138A (en) | Primer and method used for detecting Oidium heveae and application | |
| CN105219879B (en) | The application of Primer composition and its application, the kit and kit that are made from it for detecting citrus Tylenchulus Semipenetrans | |
| Kang et al. | Gene-based diagnosis of tuberculosis from oral swabs with a new generation pathogen enrichment technique in real-world practice | |
| CN103409532B (en) | Specific primer used for analysis of diversity of pathogenic fungi causing root rot of soybean | |
| Bouchiat et al. | Evaluation of the R-Biopharm RIDA® GENE Panton–Valentine leukocidin (PVL) kit for the detection of Staphylococcus aureus PVL from pus samples |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20210212 Termination date: 20210930 |