CN107603972A - A kind of DNA extraction method - Google Patents
A kind of DNA extraction method Download PDFInfo
- Publication number
- CN107603972A CN107603972A CN201711007837.9A CN201711007837A CN107603972A CN 107603972 A CN107603972 A CN 107603972A CN 201711007837 A CN201711007837 A CN 201711007837A CN 107603972 A CN107603972 A CN 107603972A
- Authority
- CN
- China
- Prior art keywords
- dna
- pcr
- sample
- extraction method
- dna extraction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kind of DNA extraction method, this method comprises the following steps：Sample is suspended in TE buffer solutions；Cell cracks to be discharged with DNA；And amination magnetic nano-particle adsorption of DNA.The DNA extraction method of the present invention will detect sample simple process, with amination magnetic nano-particle quick separating DNA therein, then directly add magnetic composite in PCR, realize quickly and Sensitive Detection, and be applicable for a variety of detection sample standard deviations.
Description
Technical field
The present invention relates to biological technical field, more particularly to a kind of DNA extraction method suitable for PCR detections.
Background technology
Detected for living matter, PCR in the short period of time in vitro can expand specific dna sequence from several copies
Increase the level to millions of times.However, in actual sample detection, although PCR is ripe method, but how quick and simple
Just the DNA for obtaining test sample is to compare stubborn problem.Although PCR amplification abilities are extremely strong, sensitivity is high, if
The DNA profiling of extraction, which has PCR mortifiers, can then cause false negative.In order to which the DNA purified (removes PCR to do as far as possible
Disturb the DNA profiling of material) generally require various cumbersome purification steps.
Therefore, it is necessary to a kind of simple and efficient DNA extraction method, to adapt to the requirement of PCR detections.
The content of the invention
It is an object of the invention to provide a kind of DNA extraction method, this method comprises the following steps：
(1) sample is suspended in TE buffer solutions (pH6-10)
Wherein for the solid sample of bulk, such as animal sources, plant source, macro fungi sample, need to first be ground with liquid nitrogen
1-3 times, sample is thoroughly crushed, in order to which cell cracking discharges with DNA in ensuing processing；Liquid sample then need not
This operating procedure, directly it is suspended in TE buffer solutions；
If solid sample passes through liquid nitrogen grinding, pH6-10 1x TE solution is added；If liquid sample needs to add
Add 10x TE mother liquors, final solution reaches the pH essentially the same with solid sample and ionic strength；
(2) cell cracking discharges with DNA
Triton X-100 and Proteinase K (concentration 20mg/mL) are added in the suspension of sample, 10- is handled at 25-60 DEG C
After 60min, 90-100 DEG C of high-temperature heating 5-20min；
On the one hand the effect of high-temperature heating is to allow enzyme-deactivating, on the other hand allow cell more thoroughly to crack released dna；
(3) amination magnetic nano-particle adsorption of DNA
Sample treatment liquid collects supernatant by 12000rpm centrifugation 5-20min；At 30-90 DEG C with amination magnetic
Nano-particle mixing 10-60min, then Magnetic Isolation, is washed with 1x PCR buffer solutions or TE solution (pH6-10)；
The obtained magnetic mixture for being adsorbed with DNA is extracted in aforementioned manners, and performing PCR inspection can be entered directly as template
Survey.During detection, in PCR system except add 1-6 μ L concentration be 10% BSA solution closed in addition to, other with routine
PCR is the same.
In order to obtain more sensitive PCR testing results, can before the step (2) with corresponding ferment treatment sample suspension,
Wherein described enzyme is wall breaking enzyme or lysozyme；Such as broken wall ferment treatment is added for fungal sample；Added for bacteria samples molten
Bacterium ferment treatment.
In above-mentioned steps (2), the addition of triton X-100 need to make final solution concentration be 0.5%-2%.
In above-mentioned steps (3), amination magnetic nano-particle used can be that the direct amination of magnetic kernel is modified
The magnetic nano-particle that amination is modified after the coating such as particle or silicon, polyethylene, in addition, the amino of commercialization purchase
It is equally applicable to change magnetic nano-particle.
In above-mentioned steps (3), during amination magnetic nano-particle capture dna, if nano-particle dispersiveness is not fine,
It can be shaken with 1000-2000rpm, aided capture.
In the DNA extraction method of the present invention, DNA extractions are easy to operate, only with amination magnetic nano-particle more
The removal DNA chaff interferences of can maximum possible are adsorbed in complicated sample composition, moreover, without by DNA from amination magnetic
Eluted on nano-particle, directly can enter performing PCR detection using this compound as template, it is simply better than with quick degree
Other DNA separation methods.Detected by verifying that the method can apply to various sample DNA extractions with PCR, including：
Animal sources sample, plant source sample, fungal sample, bacteria samples etc..
Amination magnetic nano-particle used can be under less salt, high ph-values directly in the DNA extraction method of the present invention
Adsorption of DNA, it can be directly added into PCR system and be detected by Magnetic Isolation, be compared with other method, be washed without cumbersome
De-, repurity process.And the DNA of all magnetic absorptions is added in PCR system, the sensitivity for raising trace detection is outstanding
To be important.
Summarize it is an advantage of the invention that：
1st, DNA extraction method is easy, quick, without cumbersome purification step；
2nd, the DNA extracted is not eluted, and concentration does not dilute, and can improve PCR detection sensitivities；
3rd, this method is applicable to several samples, no limitation.
Brief description of the drawings
Figure 1B SA solution eliminates inhibitory action of the amination magnetic nano-particle for PCR
Wherein：
M：DNA Marke；1：The normal PCR of amination magnetic nano-particle is not added；2-8：0-6 μ L are added respectively
10% BSA solution, wherein adding 40 μ g amination magnetic nano-particles；NC：Negative control.
The genomic DNA of Fig. 2 fungi universal primer ITS4/ITS5PCR amplification cultivation things
Wherein：
1：Positive control is used as by template of matsutake genomic DNA；2：Using fungal cultures genomic DNA as template；NC：
Negative control.
Fig. 3 cotton seed hulls detection of GMOs
Wherein：
M：DNA Maker；1：Expanded by primer of CaMV35S-r/f；2：Using Cry IA (b)+Cry IA (c)-r/f to draw
Thing expands；3：Expanded by primer of the-r/f of CpT I；4：Expanded by primer of Cry IA (c)-r/f；5：Expand by primer of NOS-r/f
Increase；6：Cotton endogenous gene is expanded with C18s rDNA-r/f primers；NC：Negative control.
Micro walnut composition detection in Fig. 4 peanut milks
Wherein：
M：Marker；1：Positive control is used as using Manufacture of Walnut Milk；2-6：Different batches peanut milk sample detection result；NC：It is cloudy
Property control.
Embodiment
Below in conjunction with accompanying drawing, by embodiment, the present invention will be further described.
Embodiment 1：BSA solution, which is added to PCR system, can eliminate suppression of the amination magnetic nano-particle to PCR.
The preparation of amination magnetic nano-particle：
1)Fe3O4It is prepared by magnetic nano-particle：0.02mol FeCl3·6H2O and 0.01mol FeSO4·7H2O is dissolved in
In 150ml deionized waters, 85 DEG C, sustained response 25min are heated under nitrogen protection, is dried in vacuo after Magnetic Isolation, washing.
2) preparation of magnetic nano-particle：By 9ml n-hexyl alcohols, 37.5mL hexamethylenes, 8.85mL Triton X-100s, 200mg Fe3O4Nanometer
Mix particles, 0.5mL tetraethyl orthosilicates are added, then add 0.3mL ammoniacal liquor, at room temperature magnetic agitation reaction 24h.Magnetic point
From, washing after be dried in vacuo.3) amination is modified：The above-mentioned Fe of 200mg3O4Nano-particle and 1ml 3- aminopropyl-triethoxy silicon
Alkane is mixed in 30mL toluene, first ultrasonic 10min, and then nitrogen is protected, 90 DEG C of electric stirring 12h.It is true after Magnetic Isolation, washing
Sky is dried.
With 2 μ L 50pg/ μ L λ DNA (being purchased from Shanghai Sheng Gong bioengineering limited company) for template, λ DNA283-r/f
For primer, enter performing PCR amplification.PCR amplification system cumulative volume is 25 μ L (containing 40 μ g aminations magnetic beads), the composition of reaction system
For：1 × PCR buffer solutions, 1.5mM MgCl2, 0.1mM dNTP, 400nM λ DNA283-r/f primers
(GGCTTCGGTCCCTTCTGT；CACCACCTGTTCAAACTCTGC), 1.0U Taq archaeal dna polymerases, etc..PCR programs are 94
DEG C pre-degeneration 5min, 94 DEG C of denaturation 30s, 60 DEG C of annealing 30s, 72 DEG C of extension 30s, repeats denaturation, annealing, extension step totally 35
Circulation, then 72 DEG C are continued to extend 8min.Different amounts of 10%BSA solution is added in different experiment groups.Final result
See Fig. 1, when BSA solution is not added, 40 μ g amination magnetic bead complete inhibition PCR amplifications, still, when amination magnetic bead
During the different amounts of BSA solution of middle addition, this inhibitory action is effectively eliminated.That is, after BSA is added,
Amination magnetic bead can be added directly into PCR system to be reacted and be expanded without suppression PCR.
Embodiment 2：Fungal cultures genomic DNA is extracted, PCR amplification gene sequences, whether sequencing identification is matsutake.
Take a small amount of fungal cultures (Academy of Agricultural Sciences, Shanghai City) liquid nitrogen grinding 3 times, weigh 200mg samples, add 1000 μ
L TE buffer solutions (pH=9), 2 μ L of addition 500U/mL lywallzymes (being purchased from Shanghai Yi Sheng bio tech ltd), 37 DEG C
It is incubated 30min.Add Proteinase K (purchase of the 10 μ L triton X-100s (being purchased from Shanghai Chinese medicines group) with 50 μ L concentration for 20 μ L/mL
From Merck ＆ Co., Inc.), 65 DEG C of incubation 30min.12000rpm rotating speeds centrifuge 5min, and Aspirate supernatant moves into new 1.5mL centrifuge tubes,
Add the amination magnetic nano-particle of 40 μ g embodiments 1 preparation, 90 DEG C of reaction 10min.After TE elutions once, solid constituent
By Magnetic Isolation in the small bottom of the tube of PCR, addition PCR system (system includes the BSA solution that 2 μ L concentration are 10%).Amplimer
For fungi universal primer ITS4 and ITS5 (TCCTCCGCTTATTGATATGC；GGAAGTAAAAGTCGTAACAAGG), PCR programs
For 94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 40s, repetition denaturation, annealing, extension step are total to
35 circulations, then 72 DEG C are continued to extend 8min.PCR primer agarose gel electrophoresis result is shown in Fig. 2.Pcr amplification product is served
Hai Shenggong bioengineering limited company be sequenced, it is positive and negative can survey it is logical, sequencing result by NCBI websites Blast compare, tie
Fruit shows not matsutake and is mould.
That is, the compound for the DNA and amination magnetic nano-particle that Magnetic Isolation obtains not only can directly add
Enter in PCR system and expand, and amplified production is not also influenceed by magnetic particle, can carry out sequencing analysis.
Embodiment 3：Genomic DNA in cotton seed hulls is extracted, PCR identifies whether be transgenic cotton seed shell.
Take a small amount of cotton seed hulls (coming from Academy of Agricultural Sciences, Shanghai City) liquid nitrogen grinding 3 times, weigh 200mg samples, add
1000 μ L TE buffer solutions (pH=9), add the Proteinase K of 10 μ L triton X-100s and 50 μ L concentration for 20 μ L/mL, at 65 DEG C
Manage 30min.Then, 100 DEG C of processing 10min.12000rpm centrifuges 5min, and Aspirate supernatant moves into new 1.5mL centrifuge tubes, added
Enter 200 μ g purchase amination magnetic bead (Plus Amine, purchased from Bangslab companies), 90 DEG C of reaction 10min.TE
After buffer solution washed once, solid constituent is by Magnetic Isolation respectively in different PCR tubules, and adding PCR system, (system includes 2 μ
L concentration is 10% BSA solution).
Amplimer is to being respectively：CaMV35S-r/f、NOS-r/f、CpTⅠ-r/f、Cry IA(b)+Cry IA(c)-r/
F, Cry IA (c)-r/f, particular sequence are respectively：
GCTCCTACAAATGCCATCA, GATAGTGGGATTGTGCGTCA；
GAATCCTGTTGCCGGTCTTG, TTATCCTAGTTTGCGCGCTA；
GCGATGAACCTTCTGAGTCT, TACTCATCATCTTCATCCCTG；
GTTCCAGCTACAGCTACCTCC, CCACTAAAGTTTCTAACACCCAC；
GTTCGTTCTCGGACTAGTTG, GGAGAGCTGGGTTAGTAGGA.
PCR programs are 94 DEG C of pre-degeneration 5min, 94 DEG C of denaturation 30s, 50 DEG C of annealing 30s, 72 DEG C of extension 40s, repeat denaturation,
Annealing, totally 35 circulations of extension step, then 72 DEG C are continued to extend 8min.Final electrophoresis result in cotton seed hulls as shown in figure 3, examine
Measure CaMV35S promoters, NOS terminator, anti insect gene CpT I, Cry IA (c) these exogenous sequences, it can be determined that this cottonseed
Shell is transgenic cotton seed shell.
Embodiment 4：Micro walnut genomic DNA in peanut milk is extracted, detects whether walnut anaphylactogen be present with reference to PCR.
Beverage production line may produce various beverages simultaneously, can so cause some beverage adulterations to have micro- in Other Drinks
Quantity of material, need to pay special attention to if these materials have allergic reaction for some crowds.In this example, peanut milk is detected
In whether have the residual (some people are for walnut allergy) of walnut, comprise the following steps that：
Taking 1mL Manufacture of Walnut Milk or peanut milk sample, (commercially available prod, Manufacture of Walnut Milk are No. 1, five batches of peanut dairy products, respectively
Label 2-6) add in 2mL centrifuge tubes, add 100 μ L 10x TE buffer solutions (pH=9).Then, the μ g/mL of 50 μ L 20 are added
Proteinase K and triton X-100 (final concentration of 0.5%), be incubated 30min at 56 DEG C, boil 10min, cool down.12000rpm
5min is centrifuged under rotating speed, Aspirate supernatant adds amination magnetic Nano prepared by 40 μ g embodiments 1 in 1.5mL centrifuge tubes
Particle, 90 DEG C of mixing 10min, Magnetic Isolation.Most magnetisable material is collected in PCR tubules and expanded at last.Draw used in amplification
Thing is to for WAL-F and WAL-R (GATCTATATTGTTGGAAAATGTAGC；GGTTAGAATCATTAGTGGAAATCAG).
PCR amplification system cumulative volume is 25 μ L, and the composition of reaction system is：1 × PCR buffer solutions, 1.5mM MgCl2、
0.1mM dNTP, 400nM primers (preceding primer and rear primer), 1.0U Taq archaeal dna polymerases, 2 μ L 10% BAS solution.Expand
It is as follows to increase step：5min at 94 DEG C；30s is reacted respectively at 95 DEG C, 55 DEG C, 72 DEG C, totally 35 circulations；Last 72 DEG C of extensions
8min。
PCR primer is analyzed with 2% agarose electrophoresis.As a result see Fig. 4, No. 1 be Manufacture of Walnut Milk detection positive findings,
No. 2-6 is peanut milk sample detection result, in weakly positive, illustrates that peanut milk contains micro walnut composition, therefore, this peanut milk
It is unsuitable for walnut allergic human population to drink.
The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the invention, for those skilled in the art
For member, the present invention can have change and change.Within the spirit and principles of the invention, any modification, the improvement made
Deng all should be included within protection scope of the present invention.
Claims (3)
1. a kind of DNA extraction method, this method comprise the following steps：
(1) sample is suspended in TE pH of buffer 6-10；
(2) cell cracking discharges with DNA
Triton X-100 is added in sample suspension and the Proteinase K that concentration is 20mg/mL, 10-60min is handled at 25-60 DEG C
Afterwards, 90-100 DEG C of high-temperature heating 5-20min；
(3) amination magnetic nano-particle adsorption of DNA
Sample treatment liquid collects supernatant by 12000rpm centrifugation 5-20min；At 30-90 DEG C with amination magnetic Nano
Mix particles 10-60min, then Magnetic Isolation, is washed with 1x PCR buffer solutions or TE pH value of solution 6-10.
2. DNA extraction method according to claim 1, it is characterised in that ferment treatment sample suspension is used before step (2),
Wherein described enzyme is wall breaking enzyme or lysozyme.
3. in DNA extraction method according to claim 1 or 2, wherein step (2), the addition of triton X-100 need to make
Final solution concentration is 0.5%-2%；Proteinase K addition is 20-80 μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711007837.9A CN107603972A (en) | 2017-10-25 | 2017-10-25 | A kind of DNA extraction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711007837.9A CN107603972A (en) | 2017-10-25 | 2017-10-25 | A kind of DNA extraction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107603972A true CN107603972A (en) | 2018-01-19 |
Family
ID=61079788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711007837.9A Pending CN107603972A (en) | 2017-10-25 | 2017-10-25 | A kind of DNA extraction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107603972A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825499A (en) * | 2019-04-18 | 2019-05-31 | 华南农业大学 | A kind of extraction reagent, kit and the application and extracting method of cell-bacterial parasite total DNA |
| CN110628760A (en) * | 2019-09-24 | 2019-12-31 | 中科瑞慈生物科技(深圳)有限责任公司 | Method for synthesizing washing-free and removal-free nano magnetic beads for nucleic acid extraction by one-step method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160577A (en) * | 2013-02-05 | 2013-06-19 | 上海交通大学 | Method for rapidly detecting pathogenic bacteria in food |
| CN104313130A (en) * | 2014-09-23 | 2015-01-28 | 华南师范大学 | Functionalized magnetic nanoparticles for efficiently enriching microorganisms, preparation and applications thereof |
-
2017
- 2017-10-25 CN CN201711007837.9A patent/CN107603972A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103160577A (en) * | 2013-02-05 | 2013-06-19 | 上海交通大学 | Method for rapidly detecting pathogenic bacteria in food |
| CN104313130A (en) * | 2014-09-23 | 2015-01-28 | 华南师范大学 | Functionalized magnetic nanoparticles for efficiently enriching microorganisms, preparation and applications thereof |
Non-Patent Citations (1)
| Title |
|---|
| SAIYED 等: ""Extraction of Genomic DNA Using Magnetic Nanoparticles (Fe3O4) as a SolidPhase Support"", 《AMERICAN JOURNAL OF INFECTIOUS DISEASES》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109825499A (en) * | 2019-04-18 | 2019-05-31 | 华南农业大学 | A kind of extraction reagent, kit and the application and extracting method of cell-bacterial parasite total DNA |
| CN109825499B (en) * | 2019-04-18 | 2020-11-06 | 华南农业大学 | Extraction reagent and kit for total DNA of cell-parasitic bacteria, application and extraction method |
| CN110628760A (en) * | 2019-09-24 | 2019-12-31 | 中科瑞慈生物科技(深圳)有限责任公司 | Method for synthesizing washing-free and removal-free nano magnetic beads for nucleic acid extraction by one-step method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103820431B (en) | Nucleic acid extraction purification process and kit based on nanometer magnetic bead | |
| CN105274099B (en) | The primer of 9 kinds of animal derived materials, probe compositions, kit and its detection method and application in Rapid identification food or feed | |
| CN107299097A (en) | A kind of micro-nucleic acid releasing agent, preparation method and applications | |
| Bai et al. | A method based on amino-modified magnetic nanoparticles to extract DNA for PCR-based analysis | |
| JP3818416B2 (en) | Nucleic acid extraction method using particle carrier | |
| CN108624586A (en) | A kind of nucleic acid extraction kit and its application process | |
| CN107603972A (en) | A kind of DNA extraction method | |
| CN102321762B (en) | Method for rapid detection of listeria monocytogenes with high sensitivity and kit thereof | |
| CN112980832A (en) | Nucleic acid extraction method and kit for nucleic acid extraction | |
| CN113151397A (en) | Nucleic acid extraction kit for extracting virus sample based on paramagnetic particle method | |
| CN105120986B (en) | A step program for nucleic acid purification | |
| CN104404030B (en) | A kind of kit and method of rapid extraction plant genome DNA | |
| CN102827940B (en) | PCR (polymerase chain reaction) detection method for ginseng DNA (deoxyribonucleic acid) in Chinese patent medicine | |
| CN110283814A (en) | A kind of magnetic bead aaerosol solution and its application method | |
| CN101864489B (en) | Method for gathering foreign DNA in transgenosis product | |
| CN105986038A (en) | Kit for HCV virus genotyping detection, use method and application thereof | |
| CN104209087B (en) | A kind of dispersed nano magnetic bead for sample quick pretreatment and preparation method thereof | |
| JP4214255B2 (en) | Improved nucleic acid extraction method using particle carrier | |
| CN101705225B (en) | High-efficiency separation method for lower molecular multiplex PCR-amplified fragments | |
| CN104593393B (en) | Red woods ant AChE genes, red woods ant AChE and preparation method thereof | |
| CN102424844B (en) | Method for detecting capra hircus horn ingredients in mixture and primers used in same | |
| CN104387442A (en) | Kit and method for quickly extracting soil microbial protein | |
| CN114906876A (en) | Preparation method of ferroferric oxide magnetic beads based on polyvinyl alcohol modification | |
| CN102424846B (en) | Method for detecting Osteon Myospalacem Baileyi in mixture and primers used thereby | |
| CN102424845B (en) | Method for detecting saiga tatarica horn ingredients in mixture and primers used in same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |