CN107573384B - A kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system - Google Patents
A kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system Download PDFInfo
- Publication number
- CN107573384B CN107573384B CN201710606253.7A CN201710606253A CN107573384B CN 107573384 B CN107573384 B CN 107573384B CN 201710606253 A CN201710606253 A CN 201710606253A CN 107573384 B CN107573384 B CN 107573384B
- Authority
- CN
- China
- Prior art keywords
- iridium
- product
- mimicry
- bipyridyl
- bipyridyl complex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses a kind of iridium bipyridyl complex and synthetic method and the applications in DNA nano medicament carrying system.The structural formula of the iridium bipyridyl complex is shown in formula I.The complex has preferable water-soluble and stronger photoluminescent property, has good internal stability and traceable property.By unilateral protection hexamethylene diamine, then the mode being deprotected, the yield of complex can be made up to 80% or more.In order to further enhance iridium bipyridyl complex to the lethal effect of tumour cell, the present invention constructs the DNA nano-carrier with Tumor Angiongesis mimicry targeting to load iridium bipyridyl complex, effectively increase its targeting to Tumor Angiongesis mimicry, and the efficiency that drug enters neoplastic cell nuclei is improved, finally improve the antitumous effect of the drug.
Description
Technical field
The invention belongs to biomedicine field, in particular to a kind of iridium bipyridyl complex and synthetic method and in DNA
Application in nano medicament carrying system.
Background technique
Cancer, which has surmounted cardiovascular disease, becomes the main reason for threatening publilc health.What is clinically used at present is many anti-
Tumour medicine such as Avastin, Pazopanib and Sunitinib mainly improve antitumor curative effect by inhibiting angiogenesis.
Recent research indicate that Tumor Angiongesis is not the sole mode that tumour obtains blood supply, in melanoma, gastric cancer, breast cancer
Have found that a kind of intratumoral vasculature independent of endothelial cell generates mode -- vasculogenic mimicry in contour invasion tumour
(Vasculogenic mimicry,VM).VM refers to that certain malignant cells occur gene and turn back to the undifferentiated embryo of pluripotency
Tire like cell phenotype, and endothelial cell is simulated by self-deformation and is interacted with extracellular matrix, imitate wall structures
The pipe-line system of blood (blood plasma, red blood cell) can be transported by being formed, to remold tumor microcirculation, and be connected with host blood vessel and made
Tumour obtains blood supply, this be find in recent ten years the completely new tumor microcirculation mode of one kind (Liu et al.,
J.Modern Oncol.2013；04.).Clinical research shows the presence of VM and the generation of tumour, development, transfer and long term
Poor prognosis suffer from close relationship, prompt the novel targets for inhibiting tumour VM that can become target treatment to tumor blood vessel.
Currently, existing scholar is dedicated to the R&D work of anti-VM drug.Tetracycline COL-3 by chemical modification can press down
The related gene expression of the VM of aggressive cell is made, and then inhibits the formation of VM, mechanism may be related with MMP activity is inhibited
(Seftor et al.,Clin.Exp.Metastasis,2002,19,233-246).Thalidomide can inhibit C57 mouse tumor
Growth, PAS/CD31 bis- coloration results prompt blood vessels in tumors generate mimicry structures and are obviously inhibited, and VEGF in tumour,
The expression such as MMP-2 and MMP-9 are substantially reduced (Zhang et al., J.Exp.Clin.Cancer Res., 2008,27,60).Power
Up to mycin can inhibit neuroglial cytoma C6 and U87 medium vessels generate mimicry formation (Li Xingqi etc., Chinese Medical Journal,
2009,89,1736-1740).But in order to improve pharmacokinetic properties, tumor-targeting and the entity of anti-VM drug in vivo
Tumor penetration capacity needs the dosage form of rational Design on Plane drug, makes it effectively to be absorbed in vivo, realizes the target of high-efficiency low-toxicity.
In recent years, it has been found that nano-medicament carrier can utilize its unique dimensional effect, interfacial effect and macroscopic quantum
The antitumous effect of tunnel-effect enhancing drug, hence it is evident that reduce drug-induced toxic side effect.For example, Li Yaping (Duan et
Al., ACS Nano, 2013,7,5858-5869.) by constructing the pipe/polyhenylethylene nano load medicine system with pH and time-response
System, while adriamycin and disulfiram are loaded, collaboration inhibits tumor cell proliferation, finally reverses tumor multi-medicine drug-resistant；Shi Jinjin
Etc. devising Fullerene-nanogold composite material, and radio frequency or micro-filtration in neoplasm in situ depth photo-thermal therapy is applied to shine
(China Patent No.: CN201310260339) is penetrated in drug, and the design for Nano medication of new generation provides theoretical basis sum number
According to support.
With the development of nanosecond science and technology, people have higher requirement to modern Nano medication transportation system.That is nanometer medicine
Object, which transports carrier, need to have good biocompatibility and tumor-targeting, and make it in one in combination with multiple functions component
Better adapt to vivo environment, achieve the purpose that it is accurate, efficient, stable, transport drug [Peppas.Adv.Drug safely
Deliver.Rev.,2013,65,5-9.].Currently, about design there is the composite nano material of good biocompatibility to answer
Just like a raging fire carrying out for the conveying of early diagnosis of tumor, targeting cancer therapy, medicine controlled releasing and intellectual drug.Wherein,
One important research strategy is that will have the functional molecular of biocompatibility in assemble nanometer particle surface, keeps it more in realization
The toxicity to tissue is reduced while dimension antitumous effect.For example, Song Tianqiang seminar, tumour hospital, Medical University Of Tianjin will
Adriamycin (DOX) is loaded on grafted by beta cyclodextrin hyaluronic acid (HACD) nanoparticle, can realize that obvious liver cancer targeting is thin
Drug is reduced to the toxicity of body simultaneously under the action of born of the same parents.[Bai et al.,Int.J.Biomed.Eng.,2017,40,1-
11].Nano-lipid carrier (NLCs) delivering baicalein (Baicalein, BCL) that Liu et al. people is modified with hyaluronic acid (HA) and
DOX.Compared with other preparations, which all shows biggish anti-tumor activity.[Liu et
al.,Drug Deliver.,2016,23,1364-1368].These results have prompted the composite nano based on biocompatibility
Drug designs the broad prospect of application in tumour diagnosis and treatment.But on clinical treatment, people to the design of anti-tumor drug not only
Harmless to patient in a short time, also otherwise generating long term toxicity is advisable.This requires nano-carriers efficiently to play a variety of function
While energy, carrier itself will also have good biocompatibility and degradability.Therefore, the carrier material of biological source is found
The new trend of anti-tumor drug design is expected to push the development of clinical antineoplastic new drug.
Summary of the invention
The primary purpose of the present invention is that the shortcomings that overcoming the prior art and deficiency, provide a kind of iridium bipyridyl complex.
Another object of the present invention is to provide the synthetic methods of the iridium bipyridyl complex.
Another object of the present invention is to provide application of the iridium bipyridyl complex in DNA nano medicament carrying system.
The purpose of the invention is achieved by the following technical solution: a kind of iridium bipyridyl complex, structural formula such as Formulas I institute
Show:
The synthetic method of the iridium bipyridyl complex, includes the following steps:
(1) by 4- methyl-[2,2 ' bipyridyl] -4- carboxylic acid, NHS (n-hydroxysuccinimide), EDC (1- (3- diformazan ammonia
Base propyl) -3- ethyl-carbodiimide hydrochloride) it is scattered in DMF (n,N-Dimethylformamide), it is heated to 40~60 DEG C of progress
Reaction, DMF solution is concentrated under reduced pressure after reaction, adds water, then be extracted with dichloromethane, collected organic layer is dried, filters, taken
Filtrate is spin-dried for, and obtains product 1 (2,5- dicarbapentaborane -1- pyrrolidinyl 4'- methyl-[2,2'- bipyridyl] -4- carboxylate)；Its
In, 4- methyl-[2,2 ' bipyridyl] -4- carboxylic acid, NHS and EDC is 1:(1~2 in molar ratio): (1~2) is matched；
(2) by di-tert-butyl dicarbonate ((BOC)2O it) is scattered in methanol, the first of hexamethylene diamine is added drop-wise under condition of ice bath
In alcoholic solution, room temperature is reacted, and decompression is spin-dried for after reaction, is taken solid, is dispersed in water, is then extracted with ethyl acetate
It takes, collects ethyl acetate layer, be concentrated under reduced pressure, tune pH to acidity, then extracted with water, water layer is collected, adjusts pH to alkalinity, freeze-drying obtains
Product 2 (tert-butyl-(6- ammonia hexyl)-carbamate)；Wherein, hexamethylene diamine and di-tert-butyl dicarbonate be in molar ratio (3~
6): 1 is matched；
(3) product 2, the DMAP (4-dimethylaminopyridine), three second for obtaining product 1 that step (1) obtains, step (2)
Amine is added in DCM (methylene chloride), react 12 under room temperature~for 24 hours, and after reaction, washing, collected organic layer is dry, it filters,
Filtrate is taken, is spin-dried for, (tert-butyl-(6- (4'- methyl-[2,2'- the bipyridyl] -4- formamide) hexyl) carbamic acid of product 3 is obtained
Ester)；Wherein product 1, product 2, DMAP, triethylamine are 1:(1.1~1.5 in molar ratio): (0.5~1.0): (5~13) carry out
Proportion；
(4) product 3 that step (3) obtains is dissolved in DCM, the diluted trifluoroacetic acid of DCM is added dropwise under ice bath, is stirred under room temperature
Reaction, after reaction, is spin-dried for solvent, obtains (N- (6- Aminohexyl) -4'- methyl-[2,2'- the bipyridyl] -4- first of product 4
Amide)；Wherein, product 3 and trifluoroacetic acid are 1:(5~10 in molar ratio) it is matched；
(5) by IrCl3(iridous chloride) and 2- (2- thiophene)-pyridine is scattered in the mixed solvent, is heated to 110~135
It DEG C is reacted, after reaction, filters, washs, taking filter cake, drying, obtaining product 5 (chlorine bridging intermediate)；Wherein, it mixes
Solvent be ethylene glycol ethyl ether and water by volume (1~3): the mixed solvent that 1 proportion obtains, IrCl3With 2- (2- thiophene)-pyridine
It is matched in molar ratio for 1:2；
(6) product 5 that step (5) obtains and the product 4 that step (4) obtains are added in the mixed solvent, are heated to 40
~55 DEG C are reacted, and are added ammonium hexafluorophosphate after reaction, are stirred under room temperature, are filtered, are taken filtrate, be spin-dried for, obtain iridium
Bipyridyl complex；Wherein, mixed solvent is methylene chloride and methanol 1:(1~3 by volume) obtained mixed solvent is matched,
Product 4 and product 5 are (2.1~2.6) in molar ratio: 1 is matched.
The temperature of reaction described in step (1) is preferably 50 DEG C.
The time of reaction described in step (1) is 10~16h；Preferably 12h.
It is spin-dried for described in step (1) to be evaporated using Rotary Evaporators.
The number of extraction described in step (1) is preferably 3 times.
4- methyl-described in step (1) [2,2 ' bipyridyl] -4- carboxylic acid, NHS and EDC preferably in molar ratio 1:
1.1:1.3 proportion calculates.
Water described in step (1) and (2) is preferably deionized water.
Drying described in step (1) and (3) is preferably dried using anhydrous sodium sulfate.
Hexamethylene diamine described in step (2) and di-tert-butyl dicarbonate ((BOC)2O) preferably 6:1 proportion is counted in molar ratio
It calculates.
The methanol solution of hexamethylene diamine described in step (2) is prepared preferably by following method: by hexamethylene diamine point
It dissipates in methanol, 0.5~1.0h is stirred under condition of ice bath, obtains the methanol solution of hexamethylene diamine.
Time for adding described in step (2) is 0.5~1.0h；Preferably 0.5h.
Reaction time described in step (2) is 6~12h；Preferably 6h.
The number of the extraction of ethyl acetate described in step (2) is 3~6 times；Preferably 5 times.
Described in step (2) with water extract number be 3~6 times；Preferably 5 times.
Tune pH described in step (2) is adjusted to pH=4 using dilute hydrochloric acid solution to acidity.
The dilute hydrochloric acid solution is preferably the dilute hydrochloric acid solution of pH=4.
Tune pH described in step (2) is adjusted to pH=9 using sodium hydroxide solution to alkalinity.
The concentration of the dilute sodium hydroxide is preferably 1mol/L.
Freeze-drying described in step (2) is realized preferably by following method: after saving 2~4h at -20 DEG C, being put into cold
It is dry in lyophilizer.
Reaction time described in step (3) is preferably 12h.
Washing described in step (3) is to be washed using diluted hydrochloric acid aqueous solution；Preferably washed with diluted hydrochloric acid aqueous solution
It washs 3 times.
The dilute hydrochloric acid solution is preferably the dilute hydrochloric acid solution of pH=4.
Product 1 described in step (3), product 2, DMAP (4-dimethylaminopyridine), triethylamine are 1.0 in molar ratio:
1.3:1.0:8.0 proportion calculates.
The time of dropwise addition described in step (4) is 0.25~0.75h；Preferably 0.5h.
The volume ratio of DCM described in step (4) and trifluoroacetic acid is 30~50:1；Preferably 40:1.
The time of reaction described in step (4) is 4~8h；Preferably 6h.
Preferably 1:6.73 proportion calculates in molar ratio for product 3 described in step (4) and trifluoroacetic acid.
Mixed solvent described in step (5) is preferably the mixing that 3:1 is matched by volume of ethylene glycol ethyl ether and water
Solvent.
The temperature of reaction described in step (5) is preferably 130 DEG C.
The time of reaction described in step (5) is 10~15h；Preferably 12h.
Washing described in step (5) is to be washed with deionized water 2~5 times；It is preferably washed with deionized water 3 times.
The temperature of reaction described in step (5) is preferably 50 DEG C.
Reaction described in step (5) and (6) is preferably reacted under inert gas protection.
The inert gas is preferably nitrogen.
The time of reaction described in step (6) is 6~8h.
The additive amount of ammonium hexafluorophosphate described in step (6) is by ammonium hexafluorophosphate and metal iridium (IrCl3) molar ratio
It matches and calculates for 10~20:1.
The time of stirring described in step (6) is 6~8h；Preferably 6h.
Iridium bipyridyl complex described in step (6) can also be purified further through alumina column chromatography.
The aluminium oxide plastic column chromatography is to be eluted using the eluant, eluent of methylene chloride and methanol.
The volume ratio of the methylene chloride and methanol is 1~100:1, preferably 30:1.
The iridium bipyridyl complex application in preparation of anti-tumor drugs.
The tumour includes Non-small cell lung carcinoma, human cervical carcinoma, human gastric cancer, melanoma, human osteosarcoma cell, mammary gland
Cancer and glioma.
A kind of Tumor Angiongesis mimicry targeting DNA nano medicament carrying system includes above-mentioned iridium bipyridyl complex.
The preparation method of the Tumor Angiongesis mimicry targeting DNA nano medicament carrying system, includes the following steps:
(a) four oligonucleotide chains that targeted molecular is modified are dissolved in 1 × TAE/Mg2+In buffer, heated in 2 minutes
To 95 DEG C, 2~8 DEG C are gradually cooling to, obtains the positive tetrahedron DNA nanoparticle of targeted molecular modification；
(b) by DNA nanometers of positive tetrahedron of the modification of targeted molecular obtained in iridium bipyridyl complex solution and step (a)
Particle is incubated for 1~72 hour altogether, is then centrifuged for, is abandoned supernatant, then will precipitate with 1 × TAE/Mg2+Buffer is resuspended, and obtains tumour blood
Pipe generates mimicry targeting DNA nano medicament carrying system (the DNA nano medicament carrying system of load iridium bipyridyl complex).
Targeted molecular described in step (a) is MUC-1 mucoprotein aptamers, integrin, AS1411 aptamer, leaf
One of acid, transferrins, cell-penetrating peptide, galactosamine, new vessels targeting peptides and granular leukocyte macrophage stimulus factor or
More than；Preferably MUC-1 mucoprotein aptamers and/or AS1411 aptamers, MUC-1 mucoprotein aptamers or AS1411 aptamers
It can be with any one single-stranded combination of four oligonucleotide chains on the end DNA5 '.
The sequence of four oligonucleotide chains described in step (a) is as follows:
S1:5 '-GGCTATAGCACATGGGTAAAAGACAGGCAGTTGAGACGAACATTCCTAAGTCTGAA ATTTAT
CACCCGCCATAGTAGACGTATCACC-3'(SEQ ID NO:1)；
S2:5 '-GGTGGTGGTGGTTGTGGTGGTGGTGGCTTGCTACACGATTCAGACTTAGGAATGTT CGACAT
GCGAGGGTCCAATACCGACGATTACAG-3'(SEQ ID NO:2)；
S3:5 '-GGTGGTGGTGGTTGTGGTGGTGGTGGGGTGATAAAACGTGTAGCAAGCTGTAATCG ACGGGA
AGAGCATGCCCATCCACTACTATGGCG-3'(SEQ ID NO:3)；
S4:5 '-GGCTATAGCACATGGGTAAAACGACCCTCGCATGACTCAACTGCCTGGTGATACGA GGATGG
GCATGCTCTTCCCGACGGTATTGGAC-3’(SEQ ID NO:4)。
The time of cooling described in step (a) is preferably 2~48h；Preferably 2h.
Step (a) and 1 × TAE/Mg described in (b)2+The formula of buffer are as follows: 20mM Tris, 2mM EDTA, 12.5mM
MgCl2。
The concentration of oligonucleotide chain described in step (a) is preferably 1~100 μM.
Iridium bipyridyl complex solution described in step (b) is that iridium bipyridyl complex is dissolved in (the dimethyl Asia DMSO
Sulfone) obtained solution.
The concentration of the iridium bipyridyl complex solution is preferably 0.01~1mM.
The time of incubation described in step (b) is preferably for 24 hours.
The revolving speed of centrifugation described in step (b) is preferably 5000~10000rpm；The time of centrifugation is preferably 10 minutes；
The number of centrifugation is preferably 2 times.
The preserving type of the DNA nano medicament carrying system of iridium bipyridyl complex is loaded described in step (b) are as follows: 2~8
DEG C phosphate buffer solution in saved with liquid form.
The present invention has the following advantages and effects with respect to the prior art:
1, it is an object of the invention to develop a kind of novel iridium bipyridyl complex with good anti-tumor activity, and sets
Meter constructs the load iridium bipyridyl complex of the DNA nanometer medicine-carried system with Tumor Angiongesis mimicry targeting, to improve
Its targeting to Tumor Angiongesis mimicry realizes the oncotherapy target of high-efficiency low-toxicity.
2, the novel iridium bipyridyl complex synthesized by the present invention compared with other types complex have it is preferable water-soluble and
Stronger photoluminescent property can enhance the stability and traceable property of drug in vivo.Using unilateral protection hexamethylene diamine, then it is deprotected
Mode, can efficient selective ground synthetic ligands bpy-C6-NH2, yield is up to 80% or more.
3, since iridium bipyridyl complex structure does not have targeting group, to tumour cell and normal cell without choosing
Selecting property.The shortcomings that in order to overcome iridium bipyridyl complex, the present invention have high-affinity using iridium bipyridyl complex and DNA
Feature by constructing there is the DNA nano-carrier of VM targeting to load iridium bipyridyl complex, improve the cooperation of iridium bipyridyl
Targeting and antitumous effect of the object to tumour.And preparation method is simple by the present invention, the product of preparation can be slow in phosphate
It rushes and stablizes preservation in solution, be conducive to storage.
4, VM targeted molecular (preferably MUC-1 mucoprotein aptamers) are modified at 5 end of DNA chain, it can be achieved that right in the present invention
Non-small cell lung carcinoma, human cervical carcinoma, human gastric cancer, melanoma, human osteosarcoma cell, breast cancer and the isocellular target of glioma
To recognition effect.
5, conventional medicament, which enters only 1-5% after endochylema, can enter nucleus performance curative effect, and the present invention will target carefully
The aptamers (AS1411 aptamers) of karyon are modified at 5 end of DNA chain, and the efficiency that drug enters neoplastic cell nuclei can be effectively improved,
To play better antitumous effect.
It 6, can be by fluorescent tracing or bioluminescence imaging technology to VM since iridium bipyridyl complex has fluorescent both
Targeting DNA nanometer medicine-carried system carries out tracing in vivo and positioning, provides guidance for administration mode and dosage.
Detailed description of the invention
Fig. 1 is 1 products therefrom 1-bipyridyl active ester 2,5- dicarbapentaborane-1- pyrrolidinyl 4'- first of the embodiment of the present invention
The synthetic route chart of base-[2,2'- bipyridyl] -4- carboxylate.
Fig. 2 is the synthetic route of 1 2-tert-butyl of products therefrom of the embodiment of the present invention-(6- ammonia hexyl)-carbamate
Figure.
Fig. 3 is 1 products therefrom of the embodiment of the present invention, 3 tert-butyl-(6- (4'- methyl-[2,2'- bipyridyl] -4- formamide)
Hexyl) carbamate synthetic route chart.
Fig. 4 is 1 products therefrom of the embodiment of the present invention, 4 (N- (6- Aminohexyl) -4'- methyl-[2,2'- bipyridyl] -4- first
Amide) synthetic route chart.
Fig. 5 is the synthetic route chart of 1 products therefrom 5-chlorine bridging intermediate of the embodiment of the present invention.
Fig. 6 is the synthetic route chart of 1 products therefrom 6-iridium bipyridyl complex of embodiment.
Fig. 7 is 1 gained iridium bipyridyl complex mass spectral characteristi figure of embodiment, wherein figure a is full spectrogram, and figure b is isotope
Spectrogram, figure c are theoretical isotope spectrogram.
Fig. 8 is 1 gained iridium bipyridyl complex hydrogen of embodiment spectrum phenogram.
Fig. 9 is targeting DNA nanoparticle (the Apt-cage@that iridium bipyridyl complex is loaded obtained by the embodiment of the present invention 3
Ir particle size distribution figure).
Figure 10 is the potential diagram of 3 gained Apt-cage@Ir of the embodiment of the present invention.
Figure 11 is the atomic force microscope shape appearance figure of 3 gained Apt-cage@Ir of the embodiment of the present invention, wherein figure A is Apt-
The 2D shape appearance figure of cage, the 2D shape appearance figure that figure B is Apt-cage@Ir, figure C are Apt-cage3D shape appearance figure, and figure D is Apt-
The 3D shape appearance figure of cage@Ir.
Figure 12 is the ultraviolet spectrogram of 3 gained Apt-cage@Ir of the embodiment of the present invention.
Figure 13 is the fluorescence spectra of 3 gained Apt-cage@Ir of the embodiment of the present invention.
Figure 14 is that Apt-cage@Ir inhibits U251 human glioma, U87 human glioma, MCF- in the embodiment of the present invention 4
The cell survival rate figure of 7 human breast carcinomas, CHEM-5 Line derived Neurotropic Factor and HBM Human Brain Microvascular Endothelial.
The mitochondria that Figure 15 occurs when being Apt-cage@Ir induced apoptosis of glioma cell in the embodiment of the present invention 4
Fracture.
Figure 16 is the horizontal change of active oxygen (ROS) that Apt-cage@Ir handles human glioma cell in the embodiment of the present invention 4
Change figure.
Specific embodiment
Below with reference to embodiment, the present invention is described in further detail, and embodiments of the present invention are not limited thereto.
The preparation of 1 iridium bipyridyl complex of embodiment
1. the synthesis of iridium bipyridyl complex
(1) synthesis of product 1: as shown in Figure 1, taking 4- methyl-[2,2 ' bipyridyl] -4- carboxylic acid (0.3g, 1.4mmol)
(being purchased from Zhengzhou Alpha Co., Ltd) and n-hydroxysuccinimide (NHS, 0.257g, 2.24mmol), 1- (3- dimethylamino third
Base) -3- ethyl-carbodiimide hydrochloride (EDC, 0.322g, 1.68mmol) is scattered in 15mL DMF (n,N-Dimethylformamide)
In mouth flask, 50 DEG C are heated to, reacts 12h.To which after reaction, decompression is spin-dried for DMF solution.Deionized water 50mL is added, sees
Solid is precipitated.Methylene chloride extraction (15mL is extracted 3 times), takes flaxen organic layer.Then with anhydrous sodium sulfate drying, pumping
It filters, take filtrate, be evaporated filtrate with Rotary Evaporators, obtain light white powder solid, the as active ester of bipyridyl carboxyl: 2,5- bis-
Carbonyl -1- pyrrolidinyl 4'- methyl-[2,2'- bipyridyl] -4- carboxylate (product 1), yield 65.2%.
(2) synthesis of product 2: exist as shown in Fig. 2, hexamethylene diamine 15.97g (137.46mmol) is taken to be scattered in 300mL methanol
In 500mL round-bottomed flask, 0.5h is stirred under ice bath, obtains the methanol solution of hexamethylene diamine.Then take di-tert-butyl dicarbonate
(BOC)2O 10g (45.82mmol) is dissolved in 100mL methanol, is added in 150mL constant pressure funnel, oneself is added dropwise under ice bath two
In the methanol solution of amine, time for adding, which is no less than 30min, to be advisable, and then reacts 6h under room temperature.To which after reaction, decompression is spin-dried for
Solvent methanol obtains white solid.It disperses solid in 300mL deionized water solution, ethyl acetate extraction (60mL, extraction 5
It is secondary), ethyl acetate layer is collected, ethyl acetate volume is concentrated under reduced pressure to 100mL；Then it is added in the ethyl acetate solution of concentration
The aqueous hydrochloric acid solution of pH=4, regulation system to pH=5 stir 20min under room temperature.Deionized water (20mL, 5 times) extraction is taken again
Take hydrochloride BOC-C6-NH3 +Cl-, collect water layer.It takes the sodium hydroxide solution of 1M to adjust to protect at water layer pH to 9 or so, -20 DEG C
3h is deposited, white solid, i.e. product 2: tert-butyl-(6- ammonia hexyl)-carbamate, yield 70.5% is then lyophilized to obtain.
(3) synthesis of product 3: as shown in figure 3, taking above-mentioned 1 (0.91mmol) 0.31g of product and 2 tert-butyl of product-(6-
Ammonia hexyl)-carbamate 0.26g (1.19mmol) is dissolved in 50mL methylene chloride (DCM) in 100mL single necked round bottom flask,
Add 4-dimethylaminopyridine (DMAP) 0.11g (0.91mmol), triethylamine 1mL (7.2mmol) reacts 12h under room temperature.To
After reaction, with the aqueous hydrochloric acid solution of pH=4, washing reaction acquired solution in three times, each 10mL.Collected organic layer, nothing
Aqueous sodium persulfate is dry, filters, takes filtrate, vacuum rotary steam obtains the solid of light brown, i.e. product 3: tert-butyl-(6- (4'- methyl-
[2,2'- bipyridyl] -4- formamide) hexyl) carbamate, yield 82.4%.
(4) synthesis of product 4: as shown in figure 4, taking 3 tert-butyl of product-(6- (4'- methyl-[2,2'- bipyridyl] -4- first
Amide) hexyl) carbamate 0.412g (1.00mmol) is scattered in 40mL DCM in 100mL round-bottomed flask.Take 0.5mL tri-
Fluoroacetic acid (6.73mmol) is scattered in 20mL DCM, is added in 100mL constant pressure funnel, product 3 is added dropwise under ice bath
In DCM solution (time for adding 0.5h), 6h then is stirred under room temperature.To after reaction, depressurize and be spin-dried for solvent, obtain faint yellow
Grease, i.e. product 4 (N- (6- Aminohexyl) -4'- methyl-[2,2'- bipyridyl] -4- formamide), yield 85.8%.
(5) synthesis of product 5: as shown in figure 5, taking iridous chloride (IrCl3) solid 0.6g (1.7mmol), 2- (2- thiophene
Pheno)-pyridine 0.58g (3.5mmol) is scattered in the three-necked bottle of the mixed solvent equipped with ethylene glycol ethyl ether and water, wherein ethylene glycol
Ether and water volume ratio are 3:1, total volume 40mL.Under nitrogen protection, 130 DEG C of reaction 12h.To after reaction, filter,
Deionization washes (10mL is washed 3 times), takes filter cake.50 DEG C of dryings in vacuum oven, as chlorine bridging intermediate (product 5) produce
Rate 71.5%.
(6) synthesis of product 6: as shown in fig. 6, take above-mentioned 5 (chlorine bridging intermediate) 0.2g (0.18mmol) of product with it is upper
It states product 4 (N- (6- Aminohexyl) -4'- methyl-[2,2'- bipyridyl] -4- formamide) 0.12g (0.4mmol) and is scattered in two
The in the mixed solvent of chloromethanes and methanol, wherein the volume ratio of methylene chloride and methanol is 1:1, total volume 150mL.It is heated to
50 DEG C, under nitrogen protection, react 6h.To after reaction, be added ammonium hexafluorophosphate 0.59g (3.6mmol), stirred under room temperature
6h is then filtered, and takes filtrate, and vacuum rotary steam obtains crude product 6.Then, it is chromatographed using the aluminium oxide progress column of 200~300 mesh pure
Change, with 8mL methylene chloride: methanol=10:1 mixed solvent sample dissolution, each applied sample amount are 0.5g, and eluant, eluent is dichloromethane
Alkane and methanol (volume ratio 30:1), vacuum rotary steam solvent obtain product 6 (i.e. iridium bipyridyl complex), yield 53.3%.Benefit
It is characterized with ESI-TOFMS, nuclear magnetic resonance spectroscopy, CHNS elemental analysis.(Fig. 7, Fig. 8).
[Ir(III)(thpy)2(bpy-C6-NH2)](PF6)
Anal.Calcd for C36H36F6IrN6OPS2(%): C, 44.58；H,3.74；N,8.66,S,6.61.Found
(%): C, 44.24；H,3.81；N,8.68,S,6.61ESI-TOFMS(CH3OH):m/z 825.2834[M]+.1H NMR:
(DMSO-d6,δppm)δ9.24(d,2H),8.92(s,1H),7.96(dd,1H),7.85(d,1H),7.75(dd,4H),7.68
(dd,2H),7.61–7.57(m,3H),7.54–7.50(m,2H),7.45(d,1H),6.93–6.82(m,2H),6.10(dd,
2H),3.26(dd,2H),2.73–2.67(m,2H),2.46–2.42(m,3H),1.52–1.45(m,4H),1.30–1.25(m,
4H).
The preparation of 2 targeting DNA nanoparticle of embodiment
In 5 ' end connection MUC-1 mucoprotein aptamers (raw work bioengineering stocks of 1 chain of oligonucleotides (S1) and 4 chains (S4)
Part Co., Ltd), in 5 ' end connection AS1411 aptamer (raw work bioengineering of 2 chain of oligonucleotides (S2) and 3 chains (S3)
Limited liability company), the base sequence of four oligonucleotide chains (Sheng Gong bioengineering limited liability company) is as follows:
S1:(5 ') GGCTATAGCACATGGGTAAAAGACAGGCAGTTGAGACGAACATTCCTAAGTCTGAA ATTTA
TCACCCGCCATAGTAGACGTATCACC(3')；
S2:(5 ') GGTGGTGGTGGTTGTGGTGGTGGTGGCTTGCTACACGATTCAGACTTAGGAATGTT CGACA
TGCGAGGGTCCAATACCGACGATTACAG(3')；
S3:(5 ') GGTGGTGGTGGTTGTGGTGGTGGTGGGGTGATAAAACGTGTAGCAAGCTGTAATCG ACGGG
AAGAGCATGCCCATCCACTACTATGGCG(3')；
S4:(5 ') GGCTATAGCACATGGGTAAAACGACCCTCGCATGACTCAACTGCCTGGTGATACGA GGATG
GGCATGCTCTTCCCGACGGTATTGGAC(3’)。
Four oligonucleotide chains (molar ratio 1:1:1:1) of targeting modification are dissolved in 1 × TAE/Mg2+Buffer (20mM
Tris、2mM EDTA、12.5mM MgCl2) to final concentration of 25 μM (every single-stranded concentration).Mixture is added in 2 minutes
Heat is gradually cooling to 2 DEG C to 95 DEG C, and cooling time is 2 hours, and the positive tetrahedron DNA for obtaining MUC-1 and AS1411 modification receives
Rice corpuscles (Apt-cage).
The preparation of 3 targeting DNA nanometer particle load iridium bipyridyl complex of embodiment
Iridium bipyridyl complex is dissolved in DMSO (dimethyl sulfoxide), 100 μM of iridium bipyridyl complex solution is obtained,
It is incubated for altogether 24 hours with MUC-1 obtained in the embodiment 2 and AS1411 positive tetrahedron DNA nanoparticle modified again.Reaction knot
Shu Hou, 2 wheel centrifugations (every wheel 10 minutes, revolving speed 8000rpm), abandons supernatant, will precipitate with 1 × TAE/Mg2+Buffer is resuspended, and obtains
The targeting DNA nanoparticle (Apt-cage@Ir) of iridium bipyridyl complex is loaded, Apt-cage@Ir can be in 2~8 DEG C of phosphorus
It is saved in hydrochlorate buffer solution with liquid form.Apt- is characterized with Nano-ZS (Malvern Insruments Limited)
The granularity and zeta current potential of cage@Ir.As shown in figure 9, the combination of iridium bipyridyl complex and Apt-cage make DNA nano drug-carrying
The Hydrodynamic diameter of system becomes 712.4nm from 571.9nm, illustrates synthesized VM targeting DNA nanometer medicine-carried system grain
It spends uniform, is uniformly dispersed.After Zeta potential number is it was demonstrated that loaded iridium bipyridyl complex, the zeta of DNA nanometer medicine-carried system
Potential value becomes 21.0mV ± 3.0 (Figure 10) from -9.3mV ± 2.6, this illustrates that complex successfully loads to DNA nano drug-carrying
In system.Atomic force microscopy shows that the average-size of Apt-cage@Ir is 235nm ± 2.9, and average height is
17.7nm ± 3.9 (Figure 11) illustrate that the loading of iridium bipyridyl complex can increase the structure of Apt-cage, but still maintain triangle
The structure of cone.The DNA solution (0.25 μM) of equivalent is added to 1 × TAE/Mg2+ buffering of the bipyridyl complex of iridium containing 0.25mM
Continuous Titration in solution, the UV absorption intensity and fluorescence intensity of iridium bipyridyl complex gradually weakens, it was demonstrated that iridium joins pyrrole
Pyridine complex is by the effect of partial insertion in conjunction with Apt-cage (Figure 12,13).
The anti-tumor activity and related mechanism of 4 targeting DNA nanometer particle load iridium bipyridyl complex of embodiment
Cell used in the present embodiment is purchased from the whole world ATCC Biological Resource Center.MTT colorimetric determination is used first
Apt-cage@Ir inhibit U251 human glioma (ATCC), U87 human glioma (ATCC), MCF-7 human breast carcinoma (ATCC),
The ability (Figure 14) of CHEM-5 Line derived Neurotropic Factor and the growth of HBM Human Brain Microvascular Endothelial；It is thin with mitochondria fluorescence probe &
The double dye methods (Mitotracker&Hoechst co-staining assay) of karyon fluorescence probe are in fluorescence microscope
(NikonEclipse80i) feelings of mitochondria fracture when observing Apt-cage@Ir induction U251 human glioma cell apoptosis under
Condition (Figure 15)；Based on Apt-cage@Ir inducing mitochondrial dysfunction as a result, we further detect Apt-cage@Ir couple
The influence (Figure 16) of active oxygen (ROS) level in U251 human glioma cell.
The results show that significantly improve iridium bipyridyl complex thin to brain glioblastoma cell and breast cancer by Apt-cage@Ir
The toxicity of born of the same parents, and it is substantially reduced its toxicity to normal Glial cells and normal brain microvascular endothelial cells.In addition, Apt-
Cage@Ir can induce tumour cell mitochondrial dysfunction, promotes intracellular ROS to rise, causes cell death, have good
Antitumous effect.
The above embodiment is a preferred embodiment of the present invention, but embodiments of the present invention are not by above-described embodiment
Limitation, other any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present invention,
It should be equivalent substitute mode, be included within the scope of the present invention.
SEQUENCE LISTING
<110>Ji'nan University
Guangzhou institute for drug control
<120>a kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system
<130> 1
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 87
<212> DNA
<213> Artificial Sequence
<220>
<223> S1
<400> 1
ggctatagca catgggtaaa agacaggcag ttgagacgaa cattcctaag tctgaaattt 60
atcacccgcc atagtagacg tatcacc 87
<210> 2
<211> 89
<212> DNA
<213> Artificial Sequence
<220>
<223> S2
<400> 2
ggtggtggtg gttgtggtgg tggtggcttg ctacacgatt cagacttagg aatgttcgac 60
atgcgagggt ccaataccga cgattacag 89
<210> 3
<211> 89
<212> DNA
<213> Artificial Sequence
<220>
<223> S3
<400> 3
ggtggtggtg gttgtggtgg tggtggggtg ataaaacgtg tagcaagctg taatcgacgg 60
gaagagcatg cccatccact actatggcg 89
<210> 4
<211> 88
<212> DNA
<213> Artificial Sequence
<220>
<223> S4
<400> 4
ggctatagca catgggtaaa acgaccctcg catgactcaa ctgcctggtg atacgaggat 60
gggcatgctc ttcccgacgg tattggac 88
Claims (7)
1. iridium bipyridyl complex is preparing the application in Tumor Angiongesis mimicry targeting DNA nano medicament carrying system, special
Sign is that the structural formula of the iridium bipyridyl complex is shown in formula I:
The Tumor Angiongesis mimicry targeting DNA nano medicament carrying system is prepared via a method which to obtain:
(a) four oligonucleotide chains that targeted molecular is modified are dissolved in 1 × TAE/Mg2+In buffer, 95 are heated in 2 minutes
DEG C, 2~8 DEG C are gradually cooling to, the positive tetrahedron DNA nanoparticle of targeted molecular modification is obtained；
(b) by the positive tetrahedron DNA nanoparticle of the modification of targeted molecular obtained in iridium bipyridyl complex solution and step (a)
It is incubated for 1~72h altogether, is then centrifuged for, abandons supernatant, then will precipitate with 1 × TAE/Mg2+Buffer is resuspended, and obtains Tumor Angiongesis
Mimicry targeting DNA nano medicament carrying system；
The sequence of four oligonucleotide chains described in step (a) is as shown in NO:1~4 SEQ ID；
Targeted molecular described in step (a) is one or more of MUC-1 mucoprotein aptamers and AS1411 aptamer.
2. iridium bipyridyl complex according to claim 1 is preparing DNA nanometers of Tumor Angiongesis mimicry targeting loads
Application in medicine system, which is characterized in that the iridium bipyridyl complex is prepared via a method which to obtain:
(1) it disperses 4- methyl-[2,2 ' bipyridyl] -4- carboxylic acid, NHS, EDC in DMF, is heated to 40~60 DEG C and carries out instead
It answers, DMF solution is concentrated under reduced pressure after reaction, add water, then be extracted with dichloromethane, collected organic layer is dried, filtered, taking filter
Liquid is spin-dried for, and obtains product 1；Wherein, 4- methyl-[2,2 ' bipyridyl] -4- carboxylic acid, NHS and EDC is 1:1~2:1 in molar ratio
~2 are matched；
(2) it disperses di-tert-butyl dicarbonate in methanol, in the methanol solution for being added drop-wise to hexamethylene diamine under condition of ice bath, room temperature
It is reacted, decompression is spin-dried for after reaction, is taken solid, is dissolved in water, is then extracted with ethyl acetate, and ethyl acetate is collected
Layer is concentrated under reduced pressure, tune pH to acidity, then is extracted with water, collects water layer, adjusts pH to alkalinity, and freeze-drying obtains product 2；Wherein, oneself two
Amine and di-tert-butyl dicarbonate are that 3~6:1 is matched in molar ratio；
(3) product 2, DMAP, the triethylamine obtained product 1 that step (1) obtains, step (2) is added in DCM, anti-under room temperature
Answer 12~for 24 hours, after reaction, washing, collected organic layer is dry, filters, takes filtrate, be spin-dried for, obtain product 3；Wherein product
1, product 2, DMAP, triethylamine are that 1:1.1~1.5:0.5~1.0:5~13 are matched in molar ratio；
(4) product 3 that step (3) obtains is dissolved in DCM, the diluted trifluoroacetic acid of DCM is added dropwise under ice bath, is stirred under room temperature anti-
It answers, after reaction, is spin-dried for solvent, obtain product 4；Wherein, product 3 is that 1:5~10 are matched with trifluoroacetic acid in molar ratio
Than；
(5) by IrCl3It is scattered in the mixed solvent with 2- (2- thiophene)-pyridine, 110~135 DEG C is heated to and is reacted, is reacted
After, it filters, wash, taking filter cake, drying, obtaining product 5 (chlorine bridging intermediate)；Wherein, mixed solvent is ethylene glycol ethyl ethers
Ether and the water mixed solvent that 1~3:1 is matched by volume, IrCl3With 2- (2- thiophene)-pyridine be in molar ratio 1:2 into
Row proportion；
(6) product 5 that step (5) obtains and the product 4 that step (4) obtains are added in the mixed solvent, are heated to 40~55
It DEG C is reacted, adds ammonium hexafluorophosphate after reaction, stirred under room temperature, filtered, take filtrate, be spin-dried for, obtain iridium connection pyrrole
Pyridine complex；Wherein, mixed solvent is that 1:1~3 matches obtained mixed solvent, product 4 by volume for methylene chloride and methanol
It is matched in molar ratio for 2.1~2.6:1 with product 5.
3. iridium bipyridyl complex according to claim 2 is preparing DNA nanometers of Tumor Angiongesis mimicry targeting loads
Application in medicine system, it is characterised in that:
Tune pH described in step (2) is adjusted to pH=4 using dilute hydrochloric acid solution to acidity；
Tune pH described in step (2) is adjusted to pH=9 using sodium hydroxide solution to alkalinity；
Washing described in step (3) is to be washed using diluted hydrochloric acid aqueous solution.
4. iridium bipyridyl complex according to claim 2 is preparing DNA nanometers of Tumor Angiongesis mimicry targeting loads
Application in medicine system, it is characterised in that:
Time for adding described in step (2) is 0.5~1.0h；
Reaction time described in step (2) is 6~12h；
The time of reaction described in step (4) is 4~8h.
5. iridium bipyridyl complex according to any one of claims 1 to 4 is preparing Tumor Angiongesis mimicry targeting
Application in DNA nano medicament carrying system, it is characterised in that: the tumour is Non-small cell lung carcinoma, human cervical carcinoma, people's stomach
Cancer, melanoma, human osteosarcoma cell, breast cancer or glioma.
6. a kind of Tumor Angiongesis mimicry targeting DNA nano medicament carrying system, which is characterized in that the Tumor Angiongesis
Mimicry targeting DNA nano medicament carrying system is prepared via a method which to obtain:
(a) four oligonucleotide chains that targeted molecular is modified are dissolved in 1 × TAE/Mg2+In buffer, 95 are heated in 2 minutes
DEG C, 2~8 DEG C are gradually cooling to, the positive tetrahedron DNA nanoparticle of targeted molecular modification is obtained；
(b) targeted molecular obtained in the solution containing iridium bipyridyl complex described in claim 1 and step (a) is modified
Positive tetrahedron DNA nanoparticle be incubated for 1~72h altogether, be then centrifuged for, abandon supernatant, then will 1 × TAE/Mg of precipitating2+Buffer
It is resuspended, obtains Tumor Angiongesis mimicry targeting DNA nano medicament carrying system；
The sequence of four oligonucleotide chains described in step (a) is as shown in NO:1~4 SEQ ID；
Targeted molecular described in step (a) is one or more of MUC-1 mucoprotein aptamers and AS1411 aptamer.
7. Tumor Angiongesis mimicry targeting DNA nano medicament carrying system according to claim 6, it is characterised in that:
The concentration of oligonucleotide chain described in step (a) is 1~100 μM；
Iridium bipyridyl complex solution concentration described in step (b) is 0.01~1mM.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710606253.7A CN107573384B (en) | 2017-07-24 | 2017-07-24 | A kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710606253.7A CN107573384B (en) | 2017-07-24 | 2017-07-24 | A kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107573384A CN107573384A (en) | 2018-01-12 |
| CN107573384B true CN107573384B (en) | 2019-09-17 |
Family
ID=61033550
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710606253.7A Active CN107573384B (en) | 2017-07-24 | 2017-07-24 | A kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107573384B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108938647A (en) * | 2018-08-20 | 2018-12-07 | 广东药科大学 | A kind of preparation method of Aromatic ruthenium complex-nucleic acid nano compound and products thereof and application |
| CN112175013B (en) * | 2020-09-23 | 2021-11-23 | 华南理工大学 | Photoactivated cellulose nano drug-loaded material and preparation method thereof |
| CN114409711B (en) * | 2022-01-27 | 2024-02-09 | 南方海洋科学与工程广东省实验室(湛江) | Aptamer-cyclometalated iridium conjugate and preparation method and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360531A (en) * | 2013-07-30 | 2013-10-23 | 中国科学院上海有机化学研究所 | Poly(methyl)acrylamide cationic polymer modified by natural arginine on side chain, preparation method and application |
| CN106866743A (en) * | 2017-01-22 | 2017-06-20 | 暨南大学 | Tumor-targeting metal complex and synthetic method and application |
-
2017
- 2017-07-24 CN CN201710606253.7A patent/CN107573384B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103360531A (en) * | 2013-07-30 | 2013-10-23 | 中国科学院上海有机化学研究所 | Poly(methyl)acrylamide cationic polymer modified by natural arginine on side chain, preparation method and application |
| CN106866743A (en) * | 2017-01-22 | 2017-06-20 | 暨南大学 | Tumor-targeting metal complex and synthetic method and application |
Non-Patent Citations (1)
| Title |
|---|
| "生物大分子纳米载药体系的功能化设计及其在肿瘤诊疗中的研究";黄妍瑜;《中国博士学位论文全文数据库·医药卫生科技辑》;20160815;参见第88页第5.1节，第89页第5.3.1节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107573384A (en) | 2018-01-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Dong et al. | Facile preparation of metal− organic frameworks-based hydrophobic anticancer drug delivery nanoplatform for targeted and enhanced cancer treatment | |
| Shi et al. | A tumor-targeting near-infrared laser-triggered drug delivery system based on GO@ Ag nanoparticles for chemo-photothermal therapy and X-ray imaging | |
| CN102898542B (en) | Water-soluble fullerene and application thereof | |
| CN104650194B (en) | A kind of peptide dendrimer drug and its preparation method and application | |
| CN102675655B (en) | Water-soluble fullerene and preparation and application methods thereof | |
| Zhou et al. | Ru (II)-modified TiO2 nanoparticles for hypoxia-adaptive photo-immunotherapy of oral squamous cell carcinoma | |
| CN101721714B (en) | Passive targeting antitumor prodrug of solid tumor and preparation method thereof | |
| CN107573384B (en) | A kind of iridium bipyridyl complex and synthetic method and the application in DNA nano medicament carrying system | |
| CN103705940A (en) | Preparation and anti-tumor application of natural active drug-polysaccharide targeted compound | |
| CN103804472B (en) | A kind of taxone precursor | |
| Zhao et al. | An iTEP-salinomycin nanoparticle that specifically and effectively inhibits metastases of 4T1 orthotopic breast tumors | |
| You et al. | Near infrared radiated stimulus-responsive liposomes based on photothermal conversion as drug carriers for co-delivery of CJM126 and cisplatin | |
| CN103705943A (en) | Preparation method and application of reduction-response-type pegylation (PEG) nanomedicine composition | |
| Duan et al. | pH-responsive and sustained release drug delivery system of BSA coated CDs-DOX | |
| CN102617610A (en) | Preparation method of porphyrin photosensitizer and anticarcinogen diad | |
| Zhao et al. | An intelligent dual stimuli-responsive photosensitizer delivery system with O2-supplying for efficient photodynamic therapy | |
| Cheng et al. | Synthesis of biotin-modified galactosylated chitosan nanoparticles and their characteristics in vitro and in vivo | |
| CN102898543A (en) | Water-soluble carbon nanotube and application thereof | |
| Dong et al. | GQDs/hMSN nanoplatform: Singlet oxygen generation for photodynamic therapy | |
| CN104587485A (en) | Preparation method of tirapazamine-gold nanoparticle compound and application of tirapazamine-gold nanoparticle compound | |
| CN106215191A (en) | A kind of cerebral glioma targeting drug delivery system and its production and use | |
| Zhang et al. | An oxygen-economical nano-photosensitizer with a high photodynamic therapeutic outcome via simultaneous reduction of the cellular respiration and oxygen depletion of PDT | |
| CN104383543A (en) | Application of chiral nano-selenium material supported siRNA in preparation of antitumor drug | |
| Duan et al. | Two-dimensional silicene photodynamic tumor-targeting nanomedicine | |
| Zhu et al. | Functional supramolecular micelles driven by the amphiphilic complex of biotin-acyclic cucurbituril and cannabidiol for cell-targeted drug delivery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |