CN107557365A - A kind of double base target dsRNA and synthetic method and application - Google Patents

Abstract

The invention discloses a kind of double base target dsRNA and synthetic method and application, this method expands using pine wood nematode cDNA as template by primer of MK 28i R and MK 28i FmapkGenetic fragment, expanded by primer of RAS 28i F and RAS 28i RrasGenetic fragment, respectively will by digestion connectionmapkWithrasIt is connected between carrier LITMUS 28i double T7 promoters, structure recombinant vector LITMUS 28i RAS MAPK；Again using recombinant vector as template, T7 is that primer enters performing PCR amplification；Using pcr amplification product as template, under T7 RNA polymerase catalytic action, synthesisras‑mapk‑dsRNA.What the present invention synthesizedras‑mapkDsRNA has good prevention effect to pine wood nematode, and environment-friendly, convenient, fast, has universal application value.

Description

A kind of double base target dsRNA and synthetic method and application

Technical field

The invention belongs to biological technical field, more particularly to a kind of double base target dsRNA application, and the double base target DsRNA synthetic method.

Background technology

Pine wood nematode (Bursaphelenchus xylophilus), belongs to vermes door, Nematoda, Tylenchida, cunning Sword Superfamily, umbrella sword category.After it infects pine tree, pine death can be caused, its main harm masson pine, black pine etc..When infection should After disease, in summer and autumn, leaf dehydration is changed into yellow or bronzing.Because the disease has onset speed fast and is difficult to The characteristics of preventing and treating, it is compared to " cancer " of pine tree.To in January, 2017,243 pine lines at county level of existing 15 provinces (city) in China Parasitosis epidemic-stricken area.

Pine wood nematode is mainly propagated by Monochamus alternatus, it was reported that imprisons longicorn (Uraecha bimaculata in short angle Linne communication media can also) be used as.In Japan, the prevention and controls of pine nematode mainly spray thiacloprid insecticides Kill and propagate insect and burning diseased wood.And it is extremely serious in Portugal, the state of an illness, handle diseased wood, such as bromine frequently with chemical reagent Methane.In China, although the occurrence regularity of pine nematode and its prevention and controls people have done substantial amounts of research, to being at present Only, still without efficient, quick prevention and controls.The method of preventing and treating pine wood nematode mainly has chemical method at present, is such as risen with fish Ketone and azole anthelmintic of rattling away suppress to pine wood nematode mitochondrial respiratory chain, and reach desinsection purpose, and physical treatment method is such as Dry processing pine wood nematode with a heatable brick bed room heat, or using heat treatment, suffocating treatment, burn, to destroy the preventing and treating of the methods of epidemic disease wood loose Material nematode, not only the fatality rate of pine wood nematode is low, and has certain pollution to environment, and the energy also has larger waste.Utilize Biology techniques carry out pest control, and into the focus of people's research, the RNAi of wherein rising in recent years is RNA interference (RNAinterference, RNAi) has obtained significantly developing molecular vaccine area research is more at present.

It is intracellular homologous that RNA interference refers to that double-stranded RNA (double-strand RNA, dsRNA) can specifically make MRNA degrades, and so as to block the expression of target gene, causes to occur transcribing in vivo or the gene of post-transcriptional level sinks Silent phenomenon (post-transcriptional gene silencing, PTGS).Because RNA has, stability is low, degradable Feature, be not in residual, for food, security is high.

RNAi technology is achieved in terms of the preventing and treating of plant insect compared with ten-strike, for low animals and plants insect (such as nematode Class) and the fatal rate of virus it is more apparent, will homologous genetic transcription synthesis RNA import after can be in primosome RNAi mechanism. Wang etc. utilizes the rdrp gene fragment of luteovirus (Barley yellow dwarfvirus, BYDV) pav strains Inverted repeat sequence vector (hpBYDVpol) conversion barley, so as to obtain the virus immunity strain, through a series of detections after experiment Do not monitor virus.Meanwhile in terms of nematode, RNAi technology is also widely used, research finds Meloidogyne incognita and big The cysteine proteinase gene of beans SCN disturbs the gene can be significantly to helping to play an important role in nematode invaded plantses Reduce the amount of infecting of nematode.The research, Liu Lihong et al. that RNAi is also widely used for various nematode functional genes utilizes RNAi The western gene of aphelenchoides acetylcholinesterase 2 of shellfish is carried out silence by technology, so as to study the gene function.Ma Yujie et al. is in show Suppress the expression of associated homologous gene in beautiful hidden rhabditida by RNAi, recovery polypide survival rate is used to study base after detection is dried Because of resist drying function.

In the lower eukaryotes body such as nematode, MAPK (mitogen-activated protein Kinases, map kinases, mapk) chain has signal transmission effect, and in the expression regulation and cytoplasm functional activity of gene Play key effect.Mapk chains are made up of 3 albuminoid kinases map3k-map2k-mapk, under being activated by phosphorylation successively Molecule is swum, is transmitted successively so as to play a part of signal.It has been investigated that the mutation of rtk/ras/mapk signal pathways can cause people The a variety of diseases of class, such as cancer.How activated cell is to specific for this typical ras signal pathways general structure and the approach Stimulation is reacted to interact with other signal pathways, and forefathers have done clear research in pattern nematode.And it there is now Research is found, by RNAi technology Study Mouse smooth muscle cell mapk function, it is found that mapk can pass through phosphorus after being activated Acidification activating transcription factor and other enzymes related to growth.And in plant, mapk phosphorylation activation effect and base Because expression regulation, grow, resistance is closely related.

It is respectively two kinds of 44kD and 45kD that MAPK (mapk), which has molecular weight, i.e. mek1 and mek2.When After raf is phosphorylated activation, its catalytic domain can be combined with mek, and make two Ser phosphorylations in its subprovince of catalytic domain the VIIIth, from And activate mek.Mek has the activity of dual specificity kinase, makes two regulatory site phosphorylations of Tyr and Thr and activates mapk.Know that Tyr and Thr dual specificity phosphataseization effects of the mek to mapk is significant to organism at present, there is research table Bright, mek signal paths are in extremely important effect in cell signal transfer chain, once related activation makes a mistake, that Cell physiological, growth can be had an impact, exactly the specific recognition and activation mechanism of the type, substantially increase signal and turn The accuracy led, in order to prevent mapk Abnormal Phosphorylation.Research finds, raf-mek-erk signal transduction paths and cell Canceration is also closely related, and esophageal carcinoma 9706 cells film can be raised by suppressing raf-mek-erk signal transduction paths using inhibitor Surface C AR expression.

The content of the invention

In view of the deficienciess of the prior art, the invention provides a kind of double base target dsRNA synthetic methods and application, solution Certainly existing the problem of preventing and treating low pine wood nematode method fatal rate, environmental pollution and energy waste, provided new selection.

Solves above-mentioned technical problem, the present invention adopts the following technical scheme that：A kind of double base target dsRNA, it is characterised in that Its sequence is as shown in SEQ ID No.1.

Above-mentioned double base target dsRNA synthetic method, it is characterised in that comprise the following steps：

1) construction of recombinant vector

Using pine wood nematode cDNA as template, mapk genetic fragments, its core are expanded by primer of MK-28i-R and MK-28i-F Acid sequence is as shown in SEQ ID No.2；

Using pine wood nematode cDNA as template, ras genetic fragments, its core are expanded by primer of RAS-28i-F and RAS-28i-R Acid sequence is as shown in SEQ ID No.3；

Obtained ras genetic fragments will be expanded and carrier pLITMUS-28i uses BamH I and the double digestions of Hind III respectively, then Obtained endonuclease bamhi is attached, obtains recombinant vector LITMUS-28i-RAS；

Obtained mapk genetic fragments will be expanded and recombinant vector LITMUS-28i-RAS uses Hind III and Xba I couple respectively Digestion, then obtained endonuclease bamhi is attached, obtain recombinant vector LITMUS-28i-RAS-MAPK；

Primer sequence is as follows：

MK-28i-F：5’-GCTCTAGAGCCAAGATATGGATGAGCAAGAG-3’

MK-28i-R：5’-CCAAGCTTGGGAGAGGGCTAAAGTACATTCA-3’

RAS-28i-F：5’-CGGCATCCCGTGGTGGGCGACGGTGGCGTGG-3’

RAS-28i-R：5’-CCAAGCTTGGCGCGCTGAGGCAGGTCGCACT-3’

Wherein, MK-28i-R, MK-28i-F, RAS-28i-F and RAS-28i-R underscore part be respectively Hind III, Xba I, BamH I and the sequences of Hind III；

2) dsRNA of ras-mapk genes is expanded

The recombinant vector LITMUS-28i-RAS-MAPK obtained using step 1) is entered performing PCR as primer as template, using T7 and expanded Increase, then the ddH of 20 μ LDEPC processing is dissolved in after pcr amplification product is reclaimed₂In O；

Using the PCR primer after recovery as template, under t7 rna polymerase catalytic action, transcription synthesis ras-mapk genes DsRNA, i.e. double base target dsRNA, the t7 rna polymerase catalytic condition is：2h is first reacted at 37 DEG C, then in 70 DEG C of reactions 15min.Its sequence is as shown in SEQ ID No.1.

Further, after described responsive transcription terminates, the DNase and 20 μ g ﹒ μ L-1RNase that 2U is added in reaction system are each 1 μ L, 30min is handled in 37 DEG C.Remove template DNA and single-stranded RNA molecule.Described 37 DEG C can be water bath or PCR On instrument.

The T7 primer sequences are as follows：

T7TAATACGACTCACTATAGGG

Further, the double base target dsRNA can be used for preventing and treating pine wood nematode.

Compared with prior art, the present invention has the advantages that：

1st, the double base target dsRNA that the present invention synthesizes has SEQ ID No.1 gene order, and the sequence includes base simultaneously Because of ras and mapk dsRNA, research finds that the lethal efficiency of the target gene disturbed as RNA by the use of double base target gene will The result that significantly larger than two genes act on respectively.

2nd, the present invention uses ras the and mapk gene double base targets in pine wood nematode RAS-MAPK kinase pathways as pine Elegans rna disturbs lethal target gene, blocks its signal transmission, and inhibition of gene expression regulates and controls and grown etc. important physiology Function, the death of pine wood nematode is ultimately resulted in, so as to reach the purpose of preventing and treating.In addition, simultaneously synthesizing 2 target gene dsRNA Production cost is not only reduced, improves operating efficiency, and there is good prevention effect.Exploitation to pine wood nematode molecular vaccine has Progradation, subsequently more target genes can use to be tested.

3rd, cost of material of the present invention is relatively low, and environment-friendly, convenient, fast, has universal application value.

Brief description of the drawings

Fig. 1 is pLITNUS-28i Vector maps；

Fig. 2 is T7PCR products and dsRNA agarose gel electrophoresis figures；M is marker Trans 2kplus；1 is amplification Ras-mapk genetic fragments；2：The ras-makp-dsRNA genetic fragments of amplification；3 be the mapk genetic fragments of amplification；4 be to expand The makp-dsRNA genetic fragments of increasing；5 be amplification ras genetic fragments；6 be the ras-dsRNA of amplification；7 be the gfp genes of amplification Fragment；8 be the gfp dsRNA genetic fragments of amplification；

Fig. 3 is that fluorescence quantitative PCR detection dsRNA handles ras changes in gene expression；

Fig. 4 is that fluorescence quantitative PCR detection dsRNA handles mapk changes in gene expression；

Fig. 5 is the The dead quantity of pine wood nematode after dsRNA processing；

Fig. 6 is influence of the dsRNA processing to Reproduction In Bursaphelenchus Xylophilus amount.

Embodiment

The present invention is described in further detail with reference to specific embodiment.

The pine wood nematode (Bursaphelenchus xylophilus) used in embodiment picks up from Zhejiang Province Fenghua City, ash Botrytis (Botrytis cinerea) are provided by College of Life Science, Beijing Normal University.

Pine wood nematode is cultivated on the PDA plate with the pathogen of Botrytis cinerea, and nematode is separated using the graceful funnel method of improved shellfish, Extracted for Total RNAs extraction, DNA, and infusion method RNA interference tests etc..

Trizol Reagent, reverse transcription reagent box (SuperScript^TMⅢ First-strand Synthesis System for RT-PCR), kit be purchased from Invitrogen companies；PMD-18T is purchased from Takara companies；In restricted Enzyme cutting is purchased from Thermo Scientific companies, Tag enzymes, DNA Marker, gel purification kit, connection kit, Host Strains Escherichia coli TOP10 and QPCR SuperMix are golden biotech firm's product；Hybridization kit (Roche)； PLITMUS-28i and RNA polymerase are purchased from NEB companies.Carrier pCH-sGFP is given by other people.

First, embodiment

Embodiment 1

Double base target dsRNA (ras-mapk-dsRNA) synthetic method, step are as follows：

1st, pine wood nematode cDNA preparation

Total serum IgE is extracted using TRIZOL Reagent, step is as follows：

1) in RNA extraction process ddH2O, centrifuge tube and pipette tips used etc. with 0.1% DEPC processing.

2) pine wood nematode is collected in 1.5ml centrifuge tubes, liquid nitrogen flash freezer, adds 200 μ l Trizol, use microcomponent After homogenizer is fully ground, 800 μ l Trizol are added, 5min is stored at room temperature after fully mixing.

3) 200 μ l chloroforms, fully vibration are added, room temperature places 3min, and 4 DEG C of 12000rpm centrifuge 15min.

4) supernatant is drawn into another new 1.5ml centrifuge tubes, is added 550 μ l isopropanols, is mixed, be stored at room temperature 10min, 4 DEG C 12000rpm centrifugation 10min.

5) supernatant is abandoned, the ethanol of 1ml 75% washing precipitation is often added in pipe, 4 DEG C of 7500rpm centrifuge 5min；

6) supernatant is abandoned, after alcohol volatilization in pipe, adds 20 μ LDEPC H2O dissolving RNA, RNA is in -80 DEG C

Refrigerator preserves；

Use the First-Strand Synthesis System for RT-PCR of SuperScriptTM III (Invitrogen) kit synthesis cDNA, step are as follows：

1) mixed liquor I is configured：

Composition	Volume (μ L)
		Total serum IgE	5
dNTPs(10mM)	1
		Oligo(dt)	1

2) 65 DEG C of 5min of warm bath mixed liquor I, are placed in 2min on ice；

3) mixed liquor II is prepared：

Composition	Volume (μ L)
		10×RTBuffer	2
25mMMgCl2	4
		0.1MDTT	2
RNaseOUTTM	1

4) mixed liquor II is added in mixed liquor I, mixed, it is of short duration to be collected by centrifugation to ttom of pipe；

5) 50 DEG C of warm bath 50min, 85 DEG C of 5min terminating reactions, are placed in 2-3min on ice；

6) 1 μ l RNaseH, 37 DEG C of warm bath 20min is added；Obtain pine wood nematode cDNA

It is standby by 5-10 times of obtained cDNA dilutions.

2nd, PCR amplification genes fragment

Using pine wood nematode cDNA as template, with MK-28i-F, MK-28i-R primers amplification mapk genetic fragments.With RAS- 28i-F and RAS-28i-R is that primer expands ras genetic fragments.

Primer sequence is as follows：

MK-28i-F：5’-GCTCTAGAGCCAAGATATGGATGAGCAAGAG-3’

MK-28i-R：5’-CCAAGCTTGGGAGAGGGCTAAAGTACATTCA-3’

RAS-28i-F：5’-CGGCATCCCGTGGTGGGCGACGGTGGCGTGG-3’

RAS-28i-R：5’-CCAAGCTTGGCGCGCTGAGGCAGGTCGCACT-3’

Wherein, MK-28i-R, MK-28i-F, RAS-28i-F and RAS-28i-R underscore part be respectively Hind III, Xba I, BamH I and the sequences of Hind III；

PCR reaction conditions：94 DEG C of pre-degeneration 3min, (94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C extend 40sec) 35 circulations, 72 DEG C are continued to extend 10min.PCR primer separates in 1.0% agarose gel electrophoresis.

3rd, vector construction

1) by ras gene PCR products and carrier pLITMUS-28i (shown in Fig. 1) [Cheng XY, Dai S M, Xiao L, et al.Influence ofcellulase gene knockdown by dsRNA interference on the development and reproduction of the pine wood nematode,Bursaphelenchus xylophilus[J].Nematology,2010,12(2):225-233.] carry out double digestion.

Digestion system：Ras gene PCR products/pLITMUS-28i plasmids 50 μ L, the quick general μ of buffer 20 of restriction endonuclease Each 2 μ L of L, restriction endonuclease BamH I and Hind III, supply ddH₂0 to 200 μ L, 37 DEG C of digestion 20min.

(conventional linked system) is attached with T4-DNA enzymes after digestion products are recovered, ras genes are connected to carrier At Hind III, the restriction enzyme sites of BamH I between the double T7 promoters of LITMUS-28i, connection product conversion e. coli jm109 (Takara companies).The monoclonal grown on picking flat board, 37 DEG C in the LB fluid nutrient mediums containing 100mg/l ammonia benzyls, 220rpm cultivates 16h, enters through primer MK-28i-R and MK-28i-F after performing PCR is accredited as positive colony, is named as LITMUS- 28i-RAS；

2) mapk gene PCR products and carrier LITMUS-28i-RAS are subjected to double digestion (Hind III and Xba I), digestion System is same as above.

Digestion products are attached (conventional linked system) with T4-DNA enzymes, and mapk genes are connected into carrier LITMUS- At Hind III, the restriction enzyme sites of Xba I between the double T7 promoters of 28i-RAS, connection product conversion e. coli jm109 (Takara companies).The monoclonal grown on picking flat board, 37 DEG C in the LB fluid nutrient mediums containing 100mg/l ammonia benzyls, 220rpm cultivates 16h, enters through primer MK-28i-R and RAS-28i-F after performing PCR is accredited as positive colony, is named as LITMUS- 28i-RAS-MAPK, it is stand-by.

4th, the dsRNA of ras-mapk genes is expanded

Using the recombinant vector LITMUS-28i-RAS-MAPK of acquisition as template, performing PCR amplification is entered with T7 primers.

PCR reaction systems：3 μ L, 25Mm dNTP of LITMUS-28i-RAS-MAPK plasmids, 3 μ L, T7 primers 4 μ L, 10 × (taq) 5 μ L, taqDNA polymerases of buffer 1 μ L, ddH₂O 34μL。

PCR reaction conditions：95 DEG C of pre-degeneration 4min, (94 DEG C denaturation 30s, 58 DEG C annealing 30s, 72 DEG C extension 2min, 32 Circulation), 72 DEG C of extension 10min.

The ddH of 20 μ LDEPC processing is dissolved in after pcr amplification product is reclaimed₂In O.Using the PCR primer after recovery as template, After t7 rna polymerase is catalyzed 37 DEG C of reaction 2h, 70 DEG C of reaction 15min, synthesis obtains the dsRNA of ras-mapk genes.Its sequence Row are as shown in SEQ ID No.1.

After reaction terminates, 2U DNase and 20 μ g ﹒ μ L are added^-1Each 1 μ L of RNase, handle 30min in 37 DEG C and remove removing template DNA and single-stranded RNA molecule, ultraviolet specrophotometer measure dsRNA concentration, electrophoresis detection dsRNA integrality.Will be synthetic DsRNA saved backup in -80 DEG C.

Comparative example 1

Prepare makp-dsRNA, the same embodiment of preparation method.Wherein using pine wood nematode cDNA as template, restriction enzyme site is Hind III and Xba I, carrier LITMUS-28i.Primer is MK-28i-F and MK-28i-R.

Comparative example 2

Prepare ras-dsRNA, the same embodiment of preparation method.Wherein using pine wood nematode cDNA as template, restriction enzyme site is BamH I and Hind III, carrier LITMUS-28i.Primer is RAS-28i-F and RAS-28i-R.

Comparative example 3

Prepare gfp-dsRNA.The same embodiment of preparation method.Wherein using carrier pCH-sGFP as template, restriction enzyme site is Hind III and Xba I, carrier LITMUS-28i, primer are GFP-28i-F and GFP-28i-R.

Primer sequence is as follows：

GFP-28i-F：5’-CCAAGCTTGGACGGCGTGCAGTGCTTCAGCC-3’

GFP-28i-R：5’-GCTCTAGAGCGTCGCCGATGGGGGTGTTCTG-3’.

2nd, row agarose gel electrophoresis detection is entered to the dsRNA of synthesis

Obtained ras-mapk genetic fragments, ras-makp dsRNA, ras genetic fragments, ras dsRNA, gfp will be expanded Genetic fragment, gfp dsRNA enter row agarose gel electrophoresis (1% agarose), as shown in Fig. 2 expanding as can be seen from Figure 2 DsRNA fragments it is identical with corresponding genetic fragment size, show successfully to obtain ras-makp-dsRNA, makp- DsRNA, ras-dsRNA and gfp-dsRNA.

3rd, Genes ras and mapk mrna expression amount are analyzed in pine wood nematode after dsRNA processing

Concentration sterilized water/the ddH for the dsRNA for respectively preparing embodiment 1, comparative example 1, comparative example 2 and contrast 3₂O is dilute Release to 1.5mg ﹒ mL^-1, collect the pine wood nematode mixing worm state of fresh cultured and be immersed in the above-mentioned dsRNA aqueous solution.With contrast Gfp-dsRNA prepared by example 3 compares as non-target property dsRNA, with ddH₂O is as blank control, each experimental group processing 10000 pine wood nematodes, test 3 repetitions every time, and each processing uses ddH immediately after being placed in 25 DEG C of shaking tables 200rpm, 24h₂O is eluted Nematode.

Be again cDNA with RNA and reverse transcription is extracted after liquid nitrogen flash freezer by nematode, respectively with Ras-AF, Ras-AR, MK-AF, MK-AR is the primer of relative fluorescence quantitative PCR, using Bx-Actin-F and Bx-Actin-R as internal control primer.Wherein RNA extract and Reverse transcription step is routine operation, is no longer repeated herein.Analysis after dsRNA is handled in pine wood nematode Genes ras and Mapk mrna expression amount change.As shown in Figure 3 and Figure 4.

Wherein, primer sequence is as follows：

Ras-AF：5’-CGTCGAATACGATCCAACAA-3’

Ras-AR：5’-TGAGTTCATTGAGGGCAAAA-3’

MK-AF：5’-TTGTTTGGAGTGGGCCCGAGA-3’

MK-AR：5’-AGATTTTGATCTCTCTCAATG-3’

Bx-Actin-F：5’-CCAAACCGCCAGTCAATCCT-3’

Bx-Actin-R：5’-GGATACCACCGCTCTCAAGA-3’

From figs. 3 and 4 it can be seen that (the ddH compared with blank control₂O), the pine wood nematode handled through gfp-dsRNA Genes ras and mapk expression quantity are without significant difference, nearly 6 times of its ras gene expression amount of the nematode downward handled through ras-dsRNA, Nearly 6 times of its mapk gene expression amount of the nematode downward handled through mapk-dsRNA, and the nematode handled through ras-mapk-dsRNA Ras down regulation of gene expression is nearly 6 times, nearly 7 times of mapk gene deregulations.To sum up, target bases of the ras-makp-dsRNA to pine wood nematode Because ras and mapk expression is respectively provided with interference effect, and interference effect acts on the result of sum better than two genes respectively.

4th, dsRNA processing is to the lethal effect of nematode and the influence of breeding amount

Concentration sterilized water/the ddH for the dsRNA for respectively preparing embodiment 1, comparative example 1, comparative example 2 and 3₂O is diluted to 1.5mg ﹒ mL-1, collect the pine wood nematode mixing worm state of fresh cultured and be immersed in the above-mentioned dsRNA aqueous solution.With comparative example 3 The gfp-dsRNA of preparation compares as non-target property dsRNA, with ddH₂O is as blank control, each experimental group processing 10000 Bar pine wood nematode, 3 repetitions are tested every time, the nematode statistics from each processing solution after random 2000 immersions of picking is dead Rate.As shown in Figure 5.

Random picking 5 to adult (male worm and each 5 of female adult), is placed in (1 × 1) cm in pine wood nematode after treatment simultaneously Sterile Botrytis cinerea on (the pathogen of Botrytis cinerea is placed in 16 sterile hole plastic plates, and adds appropriate amounts of sterilized water at plate bottom to protect Hold Botrytis cinerea bacterium culture medium humidity), nematode population (including dead worm also counts) is counted after 9d, and calculate nematode 9d breeding amount (removing the breeding amount that 10 nematodes added are 5 nematode 9d), each 3 repetitions of experimental group, all data DPS softwares Carry out statistical analysis.As shown in Figure 6.

From fig. 5, it can be seen that it is 25.6%, ras-dsRNA processing with the ras-mapk-dsRNA nemic death rates handled Nematode the death rate be 12.4%, mapk-dsRNA processing nemic death rate be 12.6%, use ddH₂O and gfp-dsRNA The nemic death rate of processing is respectively 7.8% and 7.7%, so it is high to handle the pine wood nematode death rate with ras, mapk double base target In the pine wood nematode of the dsRNA processing with Genes ras.

From fig. 6, it can be seen that control ddH₂The nematode breeding amount of O and gfp-dsRNA processing is 133.2 and 132.8, warp The nematode breeding amount of ras-dsRNA processing is 65.3, is only 50% of control group or so, substantially less than control group；Through mapk- The breeding amount 67.7 of the nematode of dsRNA processing, is only 51% of control group or so；The nematode handled through ras-mapk-dsRNA Breeding amount 26.5,20% or so only compareed；It can be seen that the nematode breeding amount that ras, mapk double base target are handled simultaneously is notable Less than the nematode individually handled with ras or mapk genes dsRNA.

The dsRNA for the ras-mapk genes that the present invention synthesizes, the expression to the target gene mapk of pine wood nematode have dry The effect of disturbing, the fatal rate of pine wood nematode can be greatly improved and suppress the breeding potential of pine wood nematode.Thus, the present invention provides this pair First target dsRNA is used to prevent and treat pine wood nematode.

The above embodiment of the present invention is only example to illustrate the invention, and is not the implementation to the present invention The restriction of mode.For those of ordinary skill in the field, other can also be made not on the basis of the above description With the change and variation of form.Here all embodiments can not be exhaustive.It is every to belong to technical scheme Row of the obvious changes or variations amplified out still in protection scope of the present invention.

SEQUENCE LISTING

<110>Yangtze Normal University

<120>A kind of double base target dsRNA and synthetic method and application

<160> 19

<170> PatentIn version 3.5

<210> 1

<211> 689

<212> RNA

<213>Artificial sequence

<220>

<223>SEQIDNO.1RNA sequences

<400> 1

uggguuggcc cgcgucaccg acccagggca ugaucacacc ggauuuuuga cagaguacgu 60

ggccaccaga ugguaccgug cuccagaaau uaugcucaac uccaagggcu auaccaaguc 120

aauagacguu ugguccguug gauguaucuu ggccgagaug uugaacaauc ggccuuuguu 180

cccgggaaaa cauuaccucg aucaguugaa uuugaucuug acaguggugg ggucuccuuc 240

ccaagaggau cuucaaugca uaauuaacga gaaagcccgu ucauaucucc ugucgcugcc 300

ucagaagcca aaacaaucuu ggcagaggcu guauccgaau guggugggcg acgguggcgu 360

gggcaagucc gcucucacga uacagcugau acagaaucag uucgucgucg aauacgaucc 420

aacaauugaa gacagcuacc gaaagcaagu uuuaauugau ggagagaccu gccuucugga 480

uauccucgac accgccggcc aggaagagua cucagccaug agggaucagu acaugcggac 540

gggagaaggg uuccuccucg uuuuugcccu caaugaacuc aagucauucg aaaauaucau 600

ccacuacagg gaacagauca gacgugucaa ggacucggaa gaagugccaa ugguccuagu 660

cggcaacaag ugcgaccugc cucagcgcg 689

<210> 2

<211> 1098

<212> DNA

<213>Pine wood nematode（Bursaphelenchus xylophilus）

<220>

<223>CDNA sequence shown in SEQIDNO.2

<400> 2

atggctcaac aagccgaaat aacaaataat gttgaggaag tccacaatca gttgtttgga 60

gtgggcccga gatatgtaaa tctaagctac attggagaag gcgcttatgg catggtcgta 120

tcggctctgg acacgattac taaagagaga gtggccataa agaagatttc tccgtttgag 180

catcagactt tttgtcaaag gacattgaga gagatcaaaa tcttgacgag atttaaacat 240

gaaaatatta tcaatatcca agccattctt caagctccga ctatcagtga aatgaaagat 300

atatatattg ttcaatgttt gatggaaacc gatctttaca agcttttgaa gactcagcgt 360

ttatcaaacg accatatttg ttactttttg tatcagattc tgagagggct aaagtacatt 420

cattctgcta atgttctcca cagagatttg aagccaagta atttgttgtt aaatacaaca 480

tgtgatttga agatttgcga ctttgggttg gcccgcgtca ccgacccagg gcatgatcac 540

accggatttt tgacagagta cgtggccacc agatggtacc gtgctccaga aattatgctc 600

aactccaagg gctataccaa gtcaatagac gtttggtccg ttggatgtat cttggccgag 660

atgttgaaca atcggccttt gttcccggga aaacattacc tcgatcagtt gaatttgatc 720

ttgacagtgg tggggtctcc ttcccaagag gatcttcaat gcataattaa cgagaaagcc 780

cgttcatatc tcctgtcgct gcctcagaag ccaaaacaat cttggcagag gctgtatccg 840

aatgtggaag cccgggctct ggatcttttg gataagatgc ttacctttaa tccccacaaa 900

agaatcacca ttgaagatgc tcttgctcat ccatatcttg aacaatatta cgaccccaat 960

gatgaacccg tctgcgaaga gccatttact tttgagatgg agtttgatga cctgccaaaa 1020

gaagaattga agcgactaat ttttgaagaa actgaacgat tccaagctca ggttaatgcc 1080

caagctcatg atggttga 1098

<210> 3

<211> 552

<212> DNA

<213>Pine wood nematode（Bursaphelenchus xylophilus）

<220>

<223>CDNA sequence shown in SEQIDNO.3

<400> 3

atgaccgaat acaaattggt cgtggtgggc gacggtggcg tgggcaagtc cgctctcacg 60

atacagctga tacagaatca gttcgtcgtc gaatacgatc caacaattga agacagctac 120

cgaaagcaag ttttaattga tggagagacc tgccttctgg atatcctcga caccgccggc 180

caggaagagt actcagccat gagggatcag tacatgcgga cgggagaagg gttcctcctc 240

gtttttgccc tcaatgaact caagtcattc gaaaatatca tccactacag ggaacagatc 300

agacgtgtca aggactcgga agaagtgcca atggtcctag tcggcaacaa gtgcgacctg 360

cctcagcgcg ccatggacca acgacaaatc gatgagctgg cgcgcacctt cggcgtaccc 420

tacgagcaga cgtcggccaa aacgcgagtg ggcgtggacg acgccttcca cgccctggtg 480

cgcgagatcc gcaagcacaa ggaaaaacaa cgggaaaagc cgaaaaagaa gagaaaatgt 540

accatattat ga 552

<210> 4

<211> 348

<212> RNA

<213>Pine wood nematode（Bursaphelenchus xylophilus）

<220>

<223>RNA sequence shown in SEQIDNO.4

<400> 4

uggugggcga cgguggcgug ggcaaguccg cucucacgau acagcugaua cagaaucagu 60

ucgucgucga auacgaucca acaauugaag acagcuaccg aaagcaaguu uuaauugaug 120

gagagaccug ccuucuggau auccucgaca ccgccggcca ggaagaguac ucagccauga 180

gggaucagua caugcggacg ggagaagggu uccuccucgu uuuugcccuc aaugaacuca 240

agucauucga aaauaucauc cacuacaggg aacagaucag acgugucaag gacucggaag 300

aagugccaau gguccuaguc ggcaacaagu gcgaccugcc ucagcgcg 348

<210> 5

<211> 376

<212> RNA

<213>It is unknown

<220>

<223>RNA sequence shown in SEQIDNO.5

<400> 5

acggcgugca gugcuucagc cgcuaccccg accacaugaa gcagcacgac uucuucaagu 60

ccgccaugcc cgaaggcuac guccaggagc gcaccaucuu cuucaaggac gacggcaacu 120

acaagacccg cgccgaggug aaguucgagg gcgacacccu ggugaaccgc aucgagcuga 180

agggcaucga cuucaaggag gacggcaaca uccuggggca caagcuggag uacaacuaca 240

acagccacaa cgucuauauc auggccgaca agcagaagaa cggcaucaag gugaacuuca 300

agauccgcca caacaucgag gacggcagcg ugcagcucgc cgaccacuac cagcagaaca 360

cccccaucgg cgacgc 376

<210> 6

<211> 341

<212> RNA

<213>Pine wood nematode（Bursaphelenchus xylophilus）

<220>

<223>RNA sequence shown in SEQIDNO.6

<400> 6

uggguuggcc cgcgucaccg acccagggca ugaucacacc ggauuuuuga cagaguacgu 60

ggccaccaga ugguaccgug cuccagaaau uaugcucaac uccaagggcu auaccaaguc 120

aauagacguu ugguccguug gauguaucuu ggccgagaug uugaacaauc ggccuuuguu 180

cccgggaaaa cauuaccucg aucaguugaa uuugaucuug acaguggugg ggucuccuuc 240

ccaagaggau cuucaaugca uaauuaacga gaaagcccgu ucauaucucc ugucgcugcc 300

ucagaagcca aaacaaucuu ggcagaggcu guauccgaau g 341

<210> 7

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.7

<400> 7

cggcatcccg tggtgggcga cggtggcgtg g 31

<210> 8

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.8

<400> 8

ccaagcttgg cgcgctgagg caggtcgcac t 31

<210> 9

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.9

<400> 9

ccaagcttgg gagagggcta aagtacattc a 31

<210> 10

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.10

<400> 10

gctctagagc caagatatgg atgagcaaga g 31

<210> 11

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.11

<400> 11

ccaagcttgg acggcgtgca gtgcttcagc c 31

<210> 12

<211> 31

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.12

<400> 12

gctctagagc gtcgccgatg ggggtgttct g 31

<210> 13

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.13

<400> 13

ccaaaccgcc agtcaatcct 20

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.14

<400> 14

ggataccacc gctctcaaga 20

<210> 15

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.15

<400> 15

ttgtttggag tgggcccgag a 21

<210> 16

<211> 21

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.16

<400> 16

agattttgat ctctctcaat g 21

<210> 17

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.17

<400> 17

cgtcgaatac gatccaacaa 20

<210> 18

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.18

<400> 18

tgagttcatt gagggcaaaa 20

<210> 19

<211> 20

<212> DNA

<213>Artificial sequence

<220>

<223>Nucleotide sequence shown in SEQIDNO.19

<400> 19

taatacgact cactataggg 20

Claims (4)

1. a kind of double base target dsRNA, it is characterised in that its sequence is as shown in SEQ ID No.1.

2. a kind of double base target dsRNA synthetic method, it is characterised in that comprise the following steps：

1）Construction of recombinant vector

Using pine wood nematode cDNA as template, expanded by primer of MK-28i-R and MK-28i-FmapkGenetic fragment；

Using pine wood nematode cDNA as template, expanded by primer of RAS-28i-F and RAS-28i-RrasGenetic fragment；

It will expand what is obtainedrasGenetic fragment and carrier pLITMUS-28i are used respectivelyBamHI HeHindIII double digestion, then will To endonuclease bamhi be attached, obtain recombinant vector LITMUS-28i-RAS；

It will expand what is obtainedmapkGenetic fragment and recombinant vector LITMUS-28i-RAS are used respectivelyHindIII HeXbaI double digestion, Obtained endonuclease bamhi is attached again, obtains recombinant vector LITMUS-28i-RAS-MAPK；

Primer sequence is as follows：

MK-28i-F：5’-GCTCTAGAGCCAAGATATGGATGAGCAAGAG-3’

MK-28i-R：5’-CCAAGCTTGGGAGAGGGCTAAAGTACATTCA-3’

RAS-28i-F：5’-CGGCATCCCGTGGTGGGCGACGGTGGCGTGG-3’

RAS-28i-R：5’-CCAAGCTTGGCGCGCTGAGGCAGGTCGCACT-3’

Wherein, MK-28i-R, MK-28i-F, RAS-28i-F and RAS-28i-R underscore part are respectivelyHindⅢ、XbaⅠ、BamHI HeHindIII sequence；

2）Amplificationras-mapkThe dsRNA of gene

With step 1）The recombinant vector LITMUS-28i-RAS-MAPK of acquisition is template, enters performing PCR amplification with T7 primers, then will The ddH of 20 μ L DEPC processing is dissolved in after pcr amplification product recovery₂In O；

Using the PCR primer after recovery as template, under T7 RNA polymerase catalytic action, transcription synthesisras-mapkGene DsRNA, i.e. double base target dsRNA, the T7 RNA polymerases catalytic condition are：2h is first reacted at 37 DEG C, then in 70 DEG C of reactions 15min。

3. double base target dsRNA according to claim 2 synthetic method, it is characterised in that step 2）Described transcription After reaction terminates, 2 U DNase and 20 μ g ﹒ μ L-1 each 1 μ L of RNase are added in reaction system, 30 min are handled in 37 DEG C.

4. double base target dsRNA application according to claim 1, it is characterised in that for preventing and treating pine wood nematode.