CN107523576B - Glutamine synthetase gene of achromobacter xylosoxidans and application thereof - Google Patents
Glutamine synthetase gene of achromobacter xylosoxidans and application thereof Download PDFInfo
- Publication number
- CN107523576B CN107523576B CN201710976262.5A CN201710976262A CN107523576B CN 107523576 B CN107523576 B CN 107523576B CN 201710976262 A CN201710976262 A CN 201710976262A CN 107523576 B CN107523576 B CN 107523576B
- Authority
- CN
- China
- Prior art keywords
- glufosinate
- glutamine synthetase
- ammonium
- synthetase gene
- gly
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/93—Ligases (6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8274—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for herbicide resistance
- C12N15/8277—Phosphinotricin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y603/00—Ligases forming carbon-nitrogen bonds (6.3)
- C12Y603/01—Acid-ammonia (or amine)ligases (amide synthases)(6.3.1)
- C12Y603/01002—Glutamate-ammonia ligase (6.3.1.2)
Abstract
The invention discloses a strain derived from achromobacter xylosoxidans (A)Achromobacter xylosoxidans) The glutamine synthetase gene and its application. The glutamine synthetase gene contains 1413 basic groups and codes 471 amino acids; the nucleotide sequence is shown as SEQ ID NO 1, and the coded amino acid sequence is shown as SEQ ID NO 2. The glutamine synthetase gene derived from the achromobacter xylosoxidans has higher tolerance to glufosinate-ammonium, and can be used for cultivating transgenic crops resistant to glufosinate-ammonium.
Description
Technical Field
The invention belongs to the field of microbial genetic engineering, and particularly relates to a glutamine synthetase gene derived from achromobacter xylosoxidans and application thereof.
Background
Glufosinate-ammonium (DL-phosphinotricin) is a broad-spectrum contact-type herbicide. The action principle of the plant growth regulator is that the activity of Glutamine Synthetase (GS) in plants is inhibited, so that Glutamine synthesis is hindered, nitrogen metabolism is disturbed, and ammonium ions are accumulated, so that plant cell membranes are damaged, and plant photosynthesis is prevented from withering. Conventional crops do not have the ability to resist or degrade glufosinate, which would also kill the conventional crop if directly contacted. Therefore, in order to be able to selectively weed when crops are grown, crops need to have the ability to resist glufosinate or the ability to degrade glufosinate.
To date, the genes successfully used in commercial glufosinate-resistant transgenic crops are Bar or Pat genes derived from Streptomyces. The glufosinate acetyltransferase (PAT) coded by the two genes can catalyze acetyl coenzyme A to be combined with free amino of glufosinate-ammonium, and glufosinate-ammonium absorbed by plants is degraded, so that the interference of glufosinate-ammonium on glutamine synthetase inhibition and plant ammonia metabolism is eliminated, and the tolerance of the plants to glufosinate-ammonium is endowed. However, since only these two genes are currently used for breeding of glufosinate-resistant transgenic crops, all of them are liable to cause a fear of reduction in glufosinate resistance of transgenic crops in field management. Therefore, in order to improve the resistance level of the transgenic crops and increase the diversity of resistance genes, a new glufosinate-resistant gene and a glufosinate-resistant transgenic crop based on the gene still need to be excavated in production.
Disclosure of Invention
One of the main problems to be solved by the invention is to provide a glutamine synthetase gene derived from achromobacter xylosoxidans, wherein the nucleotide sequence of the glutamine synthetase gene is shown as SEQ ID NO 1, and the coded amino acid sequence is shown as SEQ ID NO 2.
Another main problem to be solved by the invention is to provide a glutamine synthetase gene derived from achromobacter xylosoxidans, and expression, purification and application thereof in plants. According to the invention, through the research on the kinetic parameters of the glutamine synthetase and the resistance of glufosinate in plants, the glutamine synthetase gene can be used for cultivating transgenic crops resistant to glufosinate.
In order to achieve the above object, the present invention adopts the following technical solutions:
1) Screening of Glufosinate-resistant strains
Collecting a sample of orchard soil in which glufosinate-ammonium is frequently used, mixing the sample with 0.9% (w/v) sodium chloride solution, then coating the mixture on LB solid culture medium containing glufosinate-ammonium with different concentrations for culture, and screening out the glufosinate-ammonium-resistant strain.
2) Extraction and identification of strain genome DNA
The genomic DNA of the selected bacteria was extracted and stored at 4 ℃ for further use. Then, 16S rRNA was amplified by PCR using the DNA of the strain as a template to identify the genus of the strain.
3) Construction of genomic libraries
The bacterial genomic DNA extracted above was digested with Sau3A I and ligated into the pACYC184 plasmid vector which was also dephosphorylated. The ligation product is transformed into Escherichia coli DH5 alpha by electric shock, coated on LB solid culture medium, cultured for 24h at 37 ℃ and then subjected to plasmid mass extraction. Thus, a genomic library containing the desired gene is constructed.
4) Acquisition of novel glufosinate-ammonium resistance gene
The plasmids extracted in large quantity are transferred into Escherichia coli JW3841-1 strain (CGSC #10775, genetic resource center of Yale university, USA), and respectively coated in LB solid culture medium containing glufosinate-ammonium with different concentrations for culture, positive transformants capable of resisting glufosinate-ammonium are determined, and plasmid extraction and sequencing are carried out on the transformants. And synthesizing a primer according to a sequencing result, and performing PCR amplification by using the sequenced plasmid as a template to obtain a PCR amplification product, namely the novel glufosinate-ammonium resistance gene.
4) Artificial synthesis of novel glufosinate-ammonium resistance gene
The novel glufosinate-ammonium resistance gene is artificially synthesized by designing 34 pairs of primers by a gene synthesis method [ Nucleic Acids Research, 2004, 32, e98 ]. The nucleotide sequence is shown as SEQ ID NO 1 through sequence determination, and the coded amino acid sequence is shown as SEQ ID NO 2.
5) In vitro glufosinate resistance test for novel genes
The novel glufosinate-ammonium resistance gene obtained as described above was ligated to a prokaryotic expression vector pG251. In vitro glufosinate-ammonium spotting resistance tests were performed after transformation with E.coli strain JW 3841-1.
6) Protein expression purification and enzymatic characterization of novel genes
The novel glufosinate-ammonium resistance gene obtained as described above was ligated to a pET-28a vector. This plasmid was then transformed into E.coli BL21 (DE 3) (Novagen), and the transformants were purified for protein expression using HisTrap HP kit (Amersham Biosciences) and subjected to determination of kinetic parameters of glutamine synthetase.
7) Functional verification of arabidopsis thaliana transformed with novel glufosinate-ammonium resistance gene
The obtained novel glufosinate-ammonium resistance gene is transferred into arabidopsis thaliana by a flower dipping method (Nature Protocol, 2006, (2): 641-646), and the root growth test of arabidopsis thaliana seeds and the glufosinate-ammonium spraying test of arabidopsis thaliana plants are carried out to show that the glutamine synthetase gene derived from achromobacter xylosoxidans is possibly used for cultivating glufosinate-ammonium resistant transgenic crops.
Drawings
FIG. 1 in vitro test of the resistance of Glutamine synthetase gene derived from Achromobacter xylosoxidans according to the invention.
FIG. 2 is an SDS-PAGE electrophoresis of glutamine synthetase derived from Achromobacter xylosoxidans according to the present invention. 1: the glutamine synthetase protein from xylose oxide achromobacter of the invention purified by HisTrap HP kit; 2: (ii) a glutamine synthetase protein derived from Achromobacter xylosoxidans of the present invention overexpressed in E.coli BL21 (DE 3); m: protein molecular weight MARKER.
FIG. 3 is a graph showing the root length experiment of Arabidopsis thaliana seeds of the glutamine synthetase gene derived from Achromobacter xylosoxidans according to the present invention on plates containing glufosinate-ammonium at various concentrations. Left: a strain transformed with a glutamine synthetase gene of achromobacter xylosoxidans of the present invention; and (3) right: CK control.
FIG. 4 is a table showing the spraying treatment of an Arabidopsis thaliana plant derived from the glutamine synthetase gene of Achromobacter xylosoxidans of the present invention with BASTA solution (upper row: strain transformed with the glutamine synthetase gene of Achromobacter xylosoxidans of the present invention; lower row: CK control). A: a phenotype plot 7 days after spraying; b: a phenotype plot after 14 days of spraying; c: phenotype plot after 21 days of spraying.
Detailed Description
The technical scheme of the invention is described in detail in the following with reference to the accompanying drawings. Although the present invention has been described in detail with reference to the preferred embodiments, it will be understood by those skilled in the art that various changes may be made and equivalents may be substituted without departing from the true spirit and scope of the present invention, which is defined by the claims appended hereto.
The reagents used in the present invention were purchased from Sigma-Aldrich (Sigma-Aldrich) unless otherwise specified.
The experiments in molecular biology referred to in this invention, unless otherwise noted, are all referred to from the book molecular cloning (J. SammBruke, E.F. Furrich, T. Mannich Abies, 1994, scientific Press)
EXAMPLE 1 acquisition of Glutamine synthetase Gene which is a novel Glufosinate-ammonium resistance Gene
1. Collection of soil samples
Soil samples were collected from soil from orchards that were used at least four times a year and for more than ten years in succession.
2. Screening of Glufosinate-resistant strains
Weighing 1g of a frequently used orchard soil sample of glufosinate-ammonium, adding 1ml of 0.9% (w/v) sodium chloride solution, shaking and mixing uniformly at 5000 r/min, centrifuging lightly at 3000 r/min, pouring off supernatant, adding 1ml of 0.9% (w/v) sodium chloride solution, shaking and mixing uniformly at 5000 r/min, standing on ice for 10min, and sucking 150 mu l of solution to coat the solution and culturing in LB solid culture medium containing 20mM glufosinate-ammonium for 24h. The grown single colony is inoculated and added into a test tube of LB liquid culture medium of 1.6ml, and cultured for 48h at 28 ℃, then 150 mu l of culture solution is sucked and spread again and cultured for 24h in LB solid culture medium containing 50mM glufosinate-ammonium, and finally one colony which grows well is selected for further study.
3. Extraction and identification of total DNA of strain
The bacterial single colonies obtained by the above separation were cultured in 10ml of liquid LB medium (5 g/L yeast extract, 5g/L NaCl,10g/L tryptone, phosphate buffer pH = 7.5) for 16 hours, and the bacterial culture broth was centrifuged at 6000 rpm for 5 minutes to obtain bacterial pellets, which were frozen at-20 ℃ for 1 hour. Then, the plate was washed once with a TE (10 mM Tris-HCl,1mM EDTA, pH = 8.0) solution. Sterile aqueous suspension containing 20. Mu.l of lysozyme (Sigma-Aldrich) at a concentration of 10mg/mL was added and shake-cultured at 37 ℃ for 1h. Add 50. Mu.L of 0.5M EDTA, 50. Mu.l of 10% (w/v) SDS and 50. Mu.l of 5M NaCl and mix by gentle shaking. Then, 10. Mu.l of protein kinase K (Takara Japan) was added at a concentration of 20mg/mL, and the reaction was incubated at 37 ℃ for 1 hour. The DNA was extracted with a phenol/chloroform/isoamyl alcohol mixture (25. The aqueous phase was extracted with a chloroform/isoamyl alcohol mixture (24. Adding isoamyl alcohol with the volume equivalent to 1 time of the water phase volume into the water phase, shaking and mixing uniformly, and centrifuging for 15min. The pellet was taken, the DNA was washed with 70% (v/v) ethanol, dried and then resuspended in TE buffer, and the resulting total DNA was stored at 4 ℃ until use.
The extracted total DNA was used as a template, and amplification was performed using 16s R RNA-specific primers. The primers for amplification were 16SR (5- & AGAGTTTGATCCTGGCTCAG- & lt 3 + & gt) and 16SF (5- & lt ACGGCTACCTTGTTGTTACGA CTTC- & lt 3 + & gt). KOD Plus (Toyobo Japan) was used as DNA polymerase, and the amplification conditions were, in order: amplification was carried out for 30 cycles at 94 ℃ for 30s,55 ℃ for 30s, and 72 ℃ for 120 s. After the circulation is finished, 2U rtaq enzyme (Dalianbao bioengineering company) is added, the extension is carried out for 90s at 72 ℃, and the length of the amplified fragment is 1500bp. After the PCR was completed, 1% (w/v) agarose gel was recovered, 10. Mu.l was taken and directly connected to T/A cloning vector (Dalianbao bioengineering Co., ltd.), and connected overnight at 4 ℃. The vector was then transformed into DH 5. Alpha. Competence. The sequence was determined by ABI3700 capillary automated sequencer from ABI Prism Big Dye, and the determined sequence was analyzed by Blast program in comparison with nucleic acid data in GenBank, and the obtained strain had 99% homology with 16s rRNA in Achromobacter xylosoxidans, thereby confirming that the selected strain was Achromobacter xylosoxidans.
4. Construction of a genome library of Achromobacter xylosoxidans
The DNA of the obtained achromobacter xylosoxidans is usedSau3AI enzyme digestion in 10 u l reaction system for partial enzyme digestion test,Sauthe 3A I enzyme is diluted according to the ratio of 1. Then, the same system is selected for enzyme digestion for 30min for carrying out a large amount of enzyme digestion. After 0.7% (w/v) agarose gel electrophoresis, the DNA fragment of 2-4kb in length was excised and recovered with a gel kit (Shanghai Biotech Co., ltd.). For plasmid vector pACYC184 (NEB Co.)BamHAnd (3) carrying out terminal dephosphorylation by SAP alkaline phosphatase after complete enzyme digestion to reduce vector self-ligation. The recovered strain DNA (200 ng) and the end-dephosphorylated plasmid vector pACYC184 (150 ng) were ligated with 2U of T4 ligase at 4 ℃ for 16h.
After the ligation product is precipitated by n-butanol, the ethanol of 70% (v/v) is used for centrifugal washing, finally, 10 mul of ultrapure water is used for dissolving, the ligation product is subjected to electric shock to transform escherichia coli DH5 alpha competent cells, and electric shock parameters are as follows: the electric pulse is 2.5 muF, the voltage is 2.5kV, the resistance is 200 omega, and the electric shock time is 4.5.S. After recovery, the suspension was spread on LB plates (containing 50. Mu.g/mL ampicillin) and cultured at 37 ℃ for l2-16h. Then, plasmid extraction was carried out using a plasmid mass extraction kit (Omega, U.S.A.), and a genomic library containing the desired gene was constructed.
5. Screening for Glufosinate-ammonium resistant transformants
The plasmids extracted in large quantities are transferred into Escherichia coli JW3841-1 strain and spread on M9 plates containing 20mM glufosinate-ammonium to be cultured for 48h, and three colonies are found to grow well. The three colonies were inoculated on M9 plates containing 50mM glufosinate, and only 1 colony was found to grow on the M9 plate containing 50mM glufosinate, and the colony was again tested for resistance with a sterile toothpick on M9 solid medium containing 50mM glufosinate, which proved to have indeed the anti-glufosinate property. This clone was then subjected to plasmid extraction and DNA sequencing using stepwise sequencing methods. The sequencing result shows that: the fragment has a size of 2100bp, and comprises a 1413 reading frame, the nucleotide sequence of which is shown as SEQ ID NO 1, and the coding amino acid sequence of which is shown as SEQ ID NO 2. According to the sequencing result, primers PZ (5 'gagagagagagagcatagcaagccccgaaagaacgt-3') and PF (5 'gtctcgag tcaggctgtgtatatacatgt-3') are synthesized, PCR amplification is carried out by taking the plasmids as templates, and the amplification conditions are as follows: amplification was carried out for 30 cycles at 94 ℃ for 30s,55 ℃ for 30s, and 72 ℃ for 120 s. The obtained PCR product is the novel glutamine synthetase gene of the invention.
EXAMPLE 2 Artificial Synthesis of Glutamine synthetase Gene which is a novel Glufosinate-ammonium resistance Gene
Synthesis of the peptide of example 1 by Gene Synthesis [ Nucleic Acids Research, 2004, 32, e98 ]
The novel glutamine synthetase gene of the present invention. 34 pairs of primers are designed in total, and the designed primers are as follows:
1. P1: Tm=54, 60mer
GGA,TCC,ATG,GCA,AGC,CCG,AAA,GAC,GTC,CTG,AAA,CAG,ATC,GCC,GAT,AAC,GAA,GTG,AAA,TTC
2. P2: Tm=54, 60mer
GGT,GCT,CAC,GGC,CAA,CCG,TAT,CGG,TAA,AGC,GGA,AAT,CCA,CGA,ATT,TCA,CTT,CGT,TAT,CGG
3. P3: Tm=54, 60mer
TAC,GGT,TGG,CCG,TGA,GCA,CCA,CGT,TTC,CGT,GCC,CAC,CAC,CGC,TAT,CGA,TGA,AGA,CAA,GCT
4. P4: Tm=54, 60mer
GCC,CGG,GAT,CGA,CGA,ACC,GTC,GAA,AGC,CTG,CCC,GCT,TTC,CAG,CTT,GTC,TTC,ATC,GAT,AGC
5. P5: Tm=54, 60mer
ACG,GTT,CGT,CGA,TCC,CGG,GCT,GGA,AGG,GCA,TCG,AAG,CCT,CCG,ACA,TGC,TCC,TCA,TCC,CCG
6. P6: Tm=54, 60mer
GGC,TCT,TCG,CGG,AAC,GGA,TCC,AGG,TTG,GCG,GTG,GCG,CAG,TCG,GGG,ATG,AGG,AGC,ATG,TCG
7. P7: Tm=54, 60mer
GAT,CCG,TTC,CGC,GAA,GAG,CCG,ACC,CTG,ATC,CTG,TCG,TGC,GAC,GTG,GTC,GAA,CCG,TCG,GAC
8. P8: Tm=54, 60mer
GCT,TGG,CCA,GCG,AGC,GCG,GGT,CGC,GGT,CAT,AGC,CCT,TCA,GGT,CCG,ACG,GTT,CGA,CCA,CGT
9. P9: Tm=54, 60mer
CCC,GCG,CTC,GCT,GGC,CAA,GCG,CGC,TGA,AGC,CTA,CCT,CAA,GTC,CTC,CGG,CCT,GGG,CGA,CAC
10. P10: Tm=54, 60mer
GTC,GAA,CAC,GAA,GAA,TTC,GGG,TTC,CGG,ACC,GAA,GTA,CGC,GGT,GTC,GCC,CAG,GCC,GGA,GGA
11. P11: Tm=54, 60mer
CCG,AAT,TCT,TCG,TGT,TCG,ACG,GCG,TGA,CCT,GGA,ACA,CCG,ACA,TGT,CGG,GCA,CGT,TCG,TCA
12. P12: Tm=54, 60mer
TCC,AGG,CCG,GTC,GAC,CAC,GGG,GCT,TCT,TCG,GAC,TTG,ATC,TTG,ACG,AAC,GTG,CCC,GAC,ATG
13. P13: Tm=54, 60mer
CCG,TGG,TCG,ACC,GGC,CTG,GAA,TTC,GAA,GGC,GGC,AAC,ACC,GGC,CAC,CGT,CCG,GGC,GTG,AAG
14. P14: Tm=54, 60mer
CCT,GGA,ACG,AAT,CGA,CCG,GCG,GAA,CGG,GGA,AGT,AGC,CGC,CCT,TCA,CGC,CCG,GAC,GGT,GGC
15. P15: Tm=54, 60mer
GCC,GGT,CGA,TTC,GTT,CCA,GGA,TAT,GCG,TTC,GGA,AAT,GTG,CCT,GCT,GAT,GGA,ACA,GAT,GGG
16. P16: Tm=54, 60mer
GGG,AGC,AGC,CAC,TTC,GTG,GTG,GTG,CAC,TTC,AAC,CGG,CAC,GCC,CAT,CTG,TTC,CAT,CAG,CAG
17. P17: Tm=54, 60mer
ACC,ACG,AAG,TGG,CTG,CTC,CCG,GCC,AGC,TCG,AAA,TCG,GCA,CCA,AGT,TCA,GCA,CGC,TGG,TGC
18. P18: Tm=54, 60mer
TGC,ACG,ACG,TAC,TTG,ACG,ATC,TGG,GTC,CAG,TCG,GCG,CGC,TGC,ACC,AGC,GTG,CTG,AAC,TTG
19. P19: Tm=54, 60mer
ATC,GTC,AAG,TAC,GTC,GTG,CAC,AAC,GTG,GCC,CAT,GCC,TAC,GGC,AAG,ACC,GCC,ACG,TTC,ATG
20. P20: Tm=54, 60mer
CGT,GCA,TGC,CGG,AGC,CGT,TGT,CGC,CAA,CGA,TGG,GCT,TGG,GCA,TGA,ACG,TGG,CGG,TCT,TGC
21. P21: Tm=54, 60mer
CAA,CGG,CTC,CGG,CAT,GCA,CGT,CCA,CCA,GTC,CAT,CTG,GAA,GGA,CGG,CCA,GAA,CCT,GTT,CGC
22. P22: Tm=54, 60mer
GTA,CAG,GGC,GAA,TTC,GGA,CAG,GCC,GGC,GTA,GCC,GTT,GCC,CGC,GAA,CAG,GTT,CTG,GCC,GTC
23. P23: Tm=54, 60mer
TGT,CCG,AAT,TCG,CCC,TGT,ACT,ACA,TCG,GCG,GCA,TCA,TCA,AGC,ACG,CCA,AGG,CCC,TGA,ACG
24. P24: Tm=54, 60mer
ACC,AGA,CGC,TTG,TAC,GAG,TTC,GTG,CCC,GGG,TTG,GTG,ATG,GCG,TTC,AGG,GCC,TTG,GCG,TGC
25. P25: Tm=54, 60mer
AAC,TCG,TAC,AAG,CGT,CTG,GTC,CCG,CAC,TTC,GAA,GCG,CCC,GTG,AAG,CTG,GCC,TAC,TCG,GCC
26. P26: Tm=54, 60mer
TGC,CGA,CGT,ACG,GAA,TGC,GGA,TCG,AAG,CCG,AAC,GGT,TGC,GGG,CCG,AGT,AGG,CCA,GCT,TCA
27. P27: Tm=54, 60mer
CCG,CAT,TCC,GTA,CGT,CGG,CAA,CCC,GAA,GGG,CCG,CCG,CGT,CGA,AGC,GCG,CTT,CCC,GGA,CCC
28. P28: Tm=54, 60mer
CAT,CAT,CAG,GGC,CGA,GAA,AGC,CAG,GTA,CGG,GTT,GGC,CAG,GGG,GTC,CGG,GAA,GCG,CGC,TTC
29. P29: Tm=54, 60mer
CTT,TCT,CGG,CCC,TGA,TGA,TGG,CCG,GCC,TGG,ACG,GCG,TCC,AGA,ACA,AGA,TCC,ACC,CGG,GCG
30. P30: Tm=54, 60mer
TCT,TCC,GGC,GGC,AGG,TCG,TAC,AGG,TTC,TTG,TCG,GCC,GGA,TCG,CCC,GGG,TGG,ATC,TTG,TTC
31. P31: Tm=54, 60mer
TAC,GAC,CTG,CCG,CCG,GAA,GAA,GAC,GCG,AAG,ATC,CCG,ACC,GTC,TGC,GCC,TCG,CTG,GAA,GAA
32. P32: Tm=54, 60mer
GGG,TCA,GGA,ACT,CGC,GAT,CCT,TGT,CCA,GCG,ATT,CCA,GCG,CTT,CTT,CCA,GCG,AGG,CGC,AGA
33. P33: Tm=54, 60mer
GGA,TCG,CGA,GTT,CCT,GAC,CCG,TGG,CGG,CGT,GTT,CAG,CAA,CGA,CAT,GAT,CAA,CGC,CTA,CAT
34. P34: Tm=54, 60mer
GGA,TCG,CGA,GTT,CCT,GAC,CCG,TGG,CGG,CGT,GTT,CAG,CAA,CGA,CAT,GAT,CAA,CGC,CTA,CAT
performing amplification by using PCR, wherein the addition amount of 32 inner primers from P2 to P33 is 2ng, the addition amounts of outer primers P1 and P34 are 30ng in a 100 microliter reaction system, and the amplification conditions are as follows: preheating at 94 ℃ for 1min; the DNA polymerase used was KOD FXtaq enzyme (Toyobo Co., ltd., japan) for 25 cycles of 94 ℃ 30s,50 ℃ 30s,72 ℃ for 2 min.
After the PCR is finished, 1% agarose gel is recovered, and 10 μ l of agarose gel is directly connected with a T/A clone carrier (Dalianbao bio-company). Ligation was performed overnight at 4 ℃ and efficiently transformed into DH 5. Alpha. Competence. Obtaining positive clone, extracting plasmid and sequence determination, its nucleotide sequence is shown in SEQ ID NO 1, its coding amino acid sequence is shown in SEQ ID NO 2, and said positive clone is the invented glutamine synthetase gene (namedglnA A.xylosoxidans ）。
Example 3 in vitro glufosinate resistance test
The glutamine synthetase gene obtained in example 2 is subjected to double digestion by BamH I and Sac I, and then is constructed into a prokaryotic expression vector pG251 to obtain a recombinant plasmid pG251-glnA A.xylosoxidans . The recombinant plasmid pG251-glnA A.xylosoxidans Spread on an M9 plate for culturing for 48h, pick out the transformant by using a toothpick and inoculate the transformant in an LB liquid culture medium for culturing until the concentration reaches 5 multiplied by 10 3 At cells/. Mu.L, 2. Mu.L of cell culture broth and 1/5 and 1/25 diluted cell culture broth were spotted on M9 plates containing glufosinate ammonium (0, 30 mM, 50mM and 70 mM) at different concentrationsCulturing for 48h. It was subsequently observed that 50mM glufosinate had begun to inhibit the growth of the glutamine synthetase gene cells of the present invention. However, the glutamine synthetase gene cells of the present invention still proliferated at a glufosinate concentration of 70 mM. It can be seen that the glutamine synthetase gene of the present invention has relatively high tolerance to glufosinate in vitro (see FIG. 1).
EXAMPLE 4 prokaryotic expression of Glutamine synthetase Gene, a novel Glufosinate-ammonium resistance Gene
The glutamine synthetase gene of the present invention artificially synthesized in example 2 was PCR-amplified with primers PZ (5-gagagagagagagagcatagccaagcccgaaagaagacgt-3 ') and PF (5-gtctcgag tcaggctgtgttacatgt-3'), using KOD Plus (Toyobo Japan) as DNA polymerase under the following conditions: 30 cycles of amplification at 94 ℃ 30s,55 ℃ 30s,72 ℃ 90 s. After the cycle was completed, 2U of rtaq enzyme (Dalianbao bioengineering Co.) was added, and the extension was carried out at 72 ℃ for 90s, and the amplified fragment was 1413bp long. For PCR productsNcoI and XhoAfter the digestion, the recombinant plasmid was obtained by ligating pET-28a (NEB) which was the same digestion vector, and transformed into E.coli BL21 (DE 3) (Novagen) and the transformant was spread on LB solid medium and cultured for 24 hours. Protein expression was purified using HisTrap HP (Amersham Biosciences) which is a gel-protein purification kit, and detected by SDS-PAGE electrophoresis. The protein size was about 50kDa, as detected by SDS-PAGE, which is consistent with the predicted value (see FIG. 2).
EXAMPLE 5 enzymatic characterisation of the novel Glutamine synthetase Gene for Glutamine resistance
1. Measurement method
1) The enzyme activity determination reaction solution of the glutamine synthetase comprises: 100 mM Tris-HCl (pH 7.5), 20mM ATP, 10mM L-glutamate, 30 mM hydroxyethylamine, 20mM MgCl 2 . 190. After preheating the reaction solution at 35 ℃ for 5 minutes, adding 10 mul of enzyme solution to start reaction, and after reacting for 30 minutes, adding 200 mul of color development solution (55 g/L FeCl) 3 ·6H 2 O, 20 g/L trichloroacetic acid, 2.1% concentrated hydrochloric acid). The light absorption at 540nM was determined. Enzyme activity is defined as the enzyme required for releasing 1 micromol gamma-glutamyl hydroximic acid per minuteAmount (v).
2）K m (L-glutamate) assay: the enzyme reaction rate was measured in the above reaction system at various L-glutamate concentrations (0.05, 0.067, 0.1, 0.2, 0.5, 1.0 mM) and the measured values were as V-V/, respectivelyS](Eadic-Hofstee) method.
3）K i (glufosinate-ammonium) assay: glutamine synthetase reaction rates were determined at L-glutamate concentrations of 0.05, 0.067, 0.1, 0.2, 0.5, 1.0mM at various glufosinate concentrations (0, 10, 50, 100. Mu.M). The double reciprocal plot is taken to obtain 1/V-1/, [ 2 ]S]Taking the slope of each straight line as the ordinate and the concentration of the glufosinate-ammonium as the abscissa to obtain a new straight line, wherein the intersection point of the straight line and the X axis is K i (glufosinate) value.
2. Measurement results
TABLE 1 kinetic parameters of the Glutamine synthetase of the present invention
| K m （L-glutamate, mM） | K i (Glutinosa, glum) | |
| Glutamine synthetase | 13.05±0.017 | 47.4±0.011 |
From the kinetic parameters of table 1, it can be seen that: the glutamine synthetase provided by the invention not only has higher glufosinate resistance, but also maintains stronger affinity with L-glutamate, and the characteristics provide possibility for the glutamine synthetase provided by the invention to be used for cultivating transgenic crops.
Example 6 transformation of Arabidopsis thaliana and testing of its Glufosinate resistance
(one) obtaining of transgenic Arabidopsis
1. Preparation of agrobacterium:
1) A single strain of Agrobacterium was inoculated into 5mL of LB liquid medium (rifampicin 50. Mu.g/mL, chloramphenicol 100. Mu.g/mL) and cultured at 28 ℃ at 250 rpm for 20 hours.
2) Transferring 1mL of the bacterial solution into 20-30mL of LB liquid medium (rifampicin 50. Mu.g/mL, chloramphenicol 100. Mu.g/mL), culturing at 28 deg.C for about 12h at 250 rpm, and measuring OD 600 ≈1.5。
3) The cells were collected by centrifugation at 8000rpm at 4 ℃ for 10min, resuspended in Agrobacterium transformation-permeate (5 wt% sucrose, 0.05wt% Silwet L-77) and diluted to OD 600 ≈0.8。
2. Transformation of Arabidopsis by flower dipping method
1) Immersing the flower bolt of the arabidopsis into penetrating fluid, slightly stirring for about 10s, taking out, after all the transformation is finished, adding water into a tray, covering the arabidopsis with a preservative film to keep a humid environment, horizontally placing the arabidopsis at 22 ℃ in a dark place for culturing, and after 24h, removing the preservative film for upright culturing.
2) After four days of primary transformation, the transformation can be carried out again for two times, and the transformation is totally carried out for three times, so that buds at different periods on inflorescences can be transformed, and the transformation efficiency is improved.
3) After about two months of growth, the seeds were collected and stored in a refrigerator at 4 ℃ for future use.
After arabidopsis transformed by the dipping flower method grows for about two months, the arabidopsis flowers normally bloom and bear seeds.
Glufosinate resistance test of transgenic Arabidopsis thaliana
1. Positive lines of the glutamine synthetase gene of the invention transferred in the T3 generation and control CK seeds were first sterilized with 1ml of 75% ethanol for 1min (shaking constantly), centrifuged at 8000rpm for 5 seconds, and the supernatant was removed. Then adding 1ml filtered bleaching powder for disinfection for 15min (shaking continuously, fully disinfecting), centrifuging at 8000rpm for 5 s, removing supernatant, and washing with sterile water for 3-4 times. And then uniformly placing the seeds on an MS0 flat plate containing glufosinate-ammonium with different concentrations, sealing by a Parafilm membrane, placing the seeds in a refrigerator at the temperature of 4 ℃ for two days, vertically culturing the seeds for 10 days at the temperature of 22 ℃ for 16 hours under illumination, and observing the growth condition. As a result, it was found that: the control seeds had been severely inhibited from growing root at a glufosinate concentration of 10mg/L, whereas the seeds transformed with the glutamine synthetase gene of Achromobacter xylosoxidans of the present invention still grew well and had a normal morphology at a glufosinate concentration of 30mg/L (see FIG. 3).
2. The glufosinate-ammonium spraying test is carried out by spraying a positive line of transglutaminase gene of the present invention and a plant of control CK, which grow for about 4 weeks, with a BASTA solution containing 150 mg/L glufosinate-ammonium, observing the growth of the plants at intervals of 7 days, and photographing. After 14 days, it was found that: CK plants are stressed and the leaves initially begin to wilt and yellow and die after 21 days. The plants of the strain transformed with the glutamine synthetase gene of achromobacter xylosoxidans of the present invention still grew well after 21 days and had normal morphology (see FIG. 4).
Glutamine synthetase genes of the invention are further demonstrated by glufosinate resistance tests of transgenic Arabidopsis thaliana which are likely to be used for the cultivation of glufosinate-resistant transgenic crops.
Sequence listing
<110> Shanghai city academy of agricultural sciences
<120> xylose oxide achromobacter glutamine synthetase gene and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1413
<212> DNA
<213> Achromobacter xylosoxidans (Achromobacter xylosoxidans)
<400> 1
atggcaagcc cgaaagacgt cctgaaacag atcgccgata acgaagtgaa attcgtggat 60
ttccgcttta ccgatacggt tggccgtgag caccacgttt ccgtgcccac caccgctatc 120
gatgaagaca agctggaaag cgggcaggct ttcgacggtt cgtcgatccc gggctggaag 180
ggcatcgaag cctccgacat gctcctcatc cccgactgcg ccaccgccaa cctggatccg 240
ttccgcgaag agccgaccct gatcctgtcg tgcgacgtgg tcgaaccgtc ggacctgaag 300
ggctatgacc gcgacccgcg ctcgctggcc aagcgcgctg aagcctacct caagtcctcc 360
ggcctgggcg acaccgcgta cttcggtccg gaacccgaat tcttcgtgtt cgacggcgtg 420
acctggaaca ccgacatgtc gggcacgttc gtcaagatca agtccgaaga agccccgtgg 480
tcgaccggcc tggaattcga aggcggcaac accggccacc gtccgggcgt gaagggcggc 540
tacttccccg ttccgccggt cgattcgttc caggatatgc gttcggaaat gtgcctgctg 600
atggaacaga tgggcgtgcc ggttgaagtg caccaccacg aagtggctgc tcccggccag 660
ctcgaaatcg gcaccaagtt cagcacgctg gtgcagcgcg ccgactggac ccagatcgtc 720
aagtacgtcg tgcacaacgt ggcccatgcc tacggcaaga ccgccacgtt catgcccaag 780
cccatcgttg gcgacaacgg ctccggcatg cacgtccacc agtccatctg gaaggacggc 840
cagaacctgt tcgcgggcaa cggctacgcc ggcctgtccg aattcgccct gtactacatc 900
ggcggcatca tcaagcacgc caaggccctg aacgccatca ccaacccggg cacgaactcg 960
tacaagcgtc tggtcccgca cttcgaagcg cccgtgaagc tggcctactc ggcccgcaac 1020
cgttcggctt cgatccgcat tccgtacgtc ggcaacccga agggccgccg cgtcgaagcg 1080
cgcttcccgg accccctggc caacccgtac ctggctttct cggccctgat gatggccggc 1140
ctggacggcg tccagaacaa gatccacccg ggcgatccgg ccgacaagaa cctgtacgac 1200
ctgccgccgg aagaagacgc gaagatcccg accgtctgcg cctcgctgga agaagcgctg 1260
gaatcgctgg acaaggatcg cgagttcctg acccgtggcg gcgtgttcag caacgacatg 1320
atcaacgcct acatcgacct gaagatggcc gatgtgacgc gtctgcgcat gacgacgcac 1380
ccggtcgaat tcgacatgta ctacagcctc tga 1413
<210> 2
<211> 470
<212> PRT
<213> Achromobacter xylosoxidans
<400> 2
Met Ala Ser Pro Lys Asp Val Leu Lys Gln Ile Ala Asp Asn Glu Val
1 5 10 15
Lys Phe Val Asp Phe Arg Phe Thr Asp Thr Val Gly Arg Glu His His
20 25 30
Val Ser Val Pro Thr Thr Ala Ile Asp Glu Asp Lys Leu Glu Ser Gly
35 40 45
Gln Ala Phe Asp Gly Ser Ser Ile Pro Gly Trp Lys Gly Ile Glu Ala
50 55 60
Ser Asp Met Leu Leu Ile Pro Asp Cys Ala Thr Ala Asn Leu Asp Pro
65 70 75 80
Phe Arg Glu Glu Pro Thr Leu Ile Leu Ser Cys Asp Val Val Glu Pro
85 90 95
Ser Asp Leu Lys Gly Tyr Asp Arg Asp Pro Arg Ser Leu Ala Lys Arg
100 105 110
Ala Glu Ala Tyr Leu Lys Ser Ser Gly Leu Gly Asp Thr Ala Tyr Phe
115 120 125
Gly Pro Glu Pro Glu Phe Phe Val Phe Asp Gly Val Thr Trp Asn Thr
130 135 140
Asp Met Ser Gly Thr Phe Val Lys Ile Lys Ser Glu Glu Ala Pro Trp
145 150 155 160
Ser Thr Gly Leu Glu Phe Glu Gly Gly Asn Thr Gly His Arg Pro Gly
165 170 175
Val Lys Gly Gly Tyr Phe Pro Val Pro Pro Val Asp Ser Phe Gln Asp
180 185 190
Met Arg Ser Glu Met Cys Leu Leu Met Glu Gln Met Gly Val Pro Val
195 200 205
Glu Val His His His Glu Val Ala Ala Pro Gly Gln Leu Glu Ile Gly
210 215 220
Thr Lys Phe Ser Thr Leu Val Gln Arg Ala Asp Trp Thr Gln Ile Val
225 230 235 240
Lys Tyr Val Val His Asn Val Ala His Ala Tyr Gly Lys Thr Ala Thr
245 250 255
Phe Met Pro Lys Pro Ile Val Gly Asp Asn Gly Ser Gly Met His Val
260 265 270
His Gln Ser Ile Trp Lys Asp Gly Gln Asn Leu Phe Ala Gly Asn Gly
275 280 285
Tyr Ala Gly Leu Ser Glu Phe Ala Leu Tyr Tyr Ile Gly Gly Ile Ile
290 295 300
Lys His Ala Lys Ala Leu Asn Ala Ile Thr Asn Pro Gly Thr Asn Ser
305 310 315 320
Tyr Lys Arg Leu Val Pro His Phe Glu Ala Pro Val Lys Leu Ala Tyr
325 330 335
Ser Ala Arg Asn Arg Ser Ala Ser Ile Arg Ile Pro Tyr Val Gly Asn
340 345 350
Pro Lys Gly Arg Arg Val Glu Ala Arg Phe Pro Asp Pro Leu Ala Asn
355 360 365
Pro Tyr Leu Ala Phe Ser Ala Leu Met Met Ala Gly Leu Asp Gly Val
370 375 380
Gln Asn Lys Ile His Pro Gly Asp Pro Ala Asp Lys Asn Leu Tyr Asp
385 390 395 400
Leu Pro Pro Glu Glu Asp Ala Lys Ile Pro Thr Val Cys Ala Ser Leu
405 410 415
Glu Glu Ala Leu Glu Ser Leu Asp Lys Asp Arg Glu Phe Leu Thr Arg
420 425 430
Gly Gly Val Phe Ser Asn Asp Met Ile Asn Ala Tyr Ile Asp Leu Lys
435 440 445
Met Ala Asp Val Thr Arg Leu Arg Met Thr Thr His Pro Val Glu Phe
450 455 460
Asp Met Tyr Tyr Ser Leu
465 470
Claims (2)
1. The application of glutamine synthetase gene from Achromobacter xylosoxidans in cultivating glufosinate-resistant transgenic crops is characterized in that: the nucleotide sequence of the glutamine synthetase gene is shown as SEQ ID NO:1 is shown.
2. Use according to claim 1, characterized in that: the amino acid sequence of the glutamine synthetase gene code derived from the achromobacter xylosoxidans is shown as SEQ ID NO:2, respectively.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710976262.5A CN107523576B (en) | 2017-10-19 | 2017-10-19 | Glutamine synthetase gene of achromobacter xylosoxidans and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710976262.5A CN107523576B (en) | 2017-10-19 | 2017-10-19 | Glutamine synthetase gene of achromobacter xylosoxidans and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107523576A CN107523576A (en) | 2017-12-29 |
| CN107523576B true CN107523576B (en) | 2023-02-03 |
Family
ID=60684803
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710976262.5A Active CN107523576B (en) | 2017-10-19 | 2017-10-19 | Glutamine synthetase gene of achromobacter xylosoxidans and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107523576B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757033A (en) * | 2013-12-25 | 2014-04-30 | 上海市农业科学院 | Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof |
| CN107022555A (en) * | 2016-04-02 | 2017-08-08 | 华中农业大学 | A kind of glutamine synthetase gene and its application with glufosinate resistance |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7910805B2 (en) * | 2006-06-08 | 2011-03-22 | Athenix Corp. | Bacterial glutamine synthetases and methods of use |
| CN101429499B (en) * | 2007-11-09 | 2010-08-11 | 中国农业科学院生物技术研究所 | Glyphosate highly-tolerant EPSP synthase and coded sequence thereof |
-
2017
- 2017-10-19 CN CN201710976262.5A patent/CN107523576B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103757033A (en) * | 2013-12-25 | 2014-04-30 | 上海市农业科学院 | Rice glutamine synthetase mutant gene capable of improving resistance of plant glufosinate, and preparation method and applications thereof |
| CN107022555A (en) * | 2016-04-02 | 2017-08-08 | 华中农业大学 | A kind of glutamine synthetase gene and its application with glufosinate resistance |
Non-Patent Citations (1)
| Title |
|---|
| 氨基酸生物合成抑制剂类除草剂作用机理及耐除草剂转基因植物研究进展;王秀君等;《中国生物工程杂志》;20080215(第02期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107523576A (en) | 2017-12-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101892247B (en) | Herbicide resistance gene and application thereof | |
| CN111996181B (en) | Application of DRK protein and coding gene thereof in drought resistance of plants | |
| CN111574605B (en) | Application of rice gene OsLAT5 in regulation of absorption and accumulation of diquat | |
| CN108624596B (en) | Gene for regulating growth of leguminous root noduleGmSPX5And uses thereof | |
| CN109879944B (en) | EAR1 protein related to plant drought resistance and coding gene and application thereof | |
| CN110804090B (en) | Protein CkWRKY33 and coding gene and application thereof | |
| CN109762795A (en) | A kind of relevant Sesame SiGolS2 of drought resisting and its application | |
| CN112626084B (en) | Strawberry MYB transcription factor FvMYB24 gene, expression protein and application | |
| CN109971766A (en) | A kind of and plant stress tolerance-associated protein PwRBP1 and its encoding gene and application | |
| CN104232600A (en) | Preparation of glyphosate resistance enhanced EPSPS (5-enolpyruvyl shikimate-3-phosphate synthase) mutant of Vitis vinifera and application of EPSPS mutant of Vitis vinifera | |
| CN101748144B (en) | Torch pear haloduric gene PpGST and application thereof | |
| CN113621643A (en) | Application of GhTULP34 in regulation and control of plant resistance to abiotic adversity stress and regulation and control method | |
| CN107523576B (en) | Glutamine synthetase gene of achromobacter xylosoxidans and application thereof | |
| CN110713994B (en) | Plant stress tolerance associated protein TaMAPK3, and coding gene and application thereof | |
| CN110373417A (en) | Cotton GhMADS41-A04 gene is promoting the application in flowering of plant | |
| CN113234731B (en) | GmARF16 gene for coding soybean ARF transcription factor and application thereof | |
| CN111560055B (en) | Application of rice gene OsLAT3 in regulation of absorption and accumulation of diquat | |
| CN111826380B (en) | Application of gene derived from Klebsiella pneumoniae | |
| CN105566468B (en) | Plant fertility GAP-associated protein GAP and its application | |
| CN103205404B (en) | EPSP (5-enolpyruvyl shikimate-3-phosphate) synthase multisite mutant from Malus domestica, and coding gene and application of mutant | |
| CN106916213A (en) | A kind of albumin A sT and its encoding gene and the application in plant stress tolerance | |
| JP5164093B2 (en) | Method for increasing resistance of rice to pathogens and pathogen-resistant rice transformants | |
| CN102876690A (en) | EPSP synthase gene from Klebsiella pneumoniae 342 and application of EPSP synthase gene | |
| CN104450732B (en) | Gene DnFCA-belta of dendrobium nobile and application thereof to regulation of plant growth and development | |
| CN116121269B (en) | Gene TrMYB118 for regulating synthesis of plant anthocyanin and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |