CN107513557B - 24:1n-9 level related locus, detection method and kit - Google Patents
24:1n-9 level related locus, detection method and kit Download PDFInfo
- Publication number
- CN107513557B CN107513557B CN201610430530.9A CN201610430530A CN107513557B CN 107513557 B CN107513557 B CN 107513557B CN 201610430530 A CN201610430530 A CN 201610430530A CN 107513557 B CN107513557 B CN 107513557B
- Authority
- CN
- China
- Prior art keywords
- population
- gene
- kit
- st8sia5
- level
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention relates to a 24:1n-9 level related locus, a detection method and a kit. Specifically, the invention discloses a 24:1n-9 level relevant locus discovered based on a whole genome association analysis research. The invention also provides a method for predicting the level of 24:1n-9, which comprises the step of detecting whether the ST8SIA5 gene, transcript and/or protein of an individual has variation compared with the normal, and the variation indicates that the level of 24:1n-9 of the individual is possibly lower than that of the normal population. The invention also discloses a corresponding detection kit.
Description
Technical Field
The invention relates to the fields of molecular biology and medicine, in particular to a 24:1n-9 level-related locus, a detection method and a kit.
Background
Monounsaturated fatty acids (MUFA) are derived from food or human endogenous synthetic pathways. Elevated MUFA levels in plasma and red cell membranes are associated with an elevated risk of chronic metabolic disease. For example, high levels of plasma and erythrocyte membrane MUFA levels in european populations are associated with type 2 diabetes and metabolic abnormalities and cardiovascular disease. In addition, high levels of erythrocytic Palmitoleic acid (Palmitoleic acid,16:1n-7), hexadecenoic acid (Hypogeic acid,16:1n-9), Vaccenic acid (18: 1n-7), and Oleic acid (Oleic acid,18:1n-9) have also been found to be significantly associated with increased risk of metabolic syndrome in the Han nationality population of China.
In addition, genetic factors may also affect MUFA levels. Previous Genome-wide association studies (GWAS) in the European population have found 6 sites associated with plasma and/or red cell membrane levels of 16:1n-7 and 18:1n 9. However, genetic loci associated with levels of 18:1n-9, eicosa-11-enoic acid (Gondoic acid,20:1n-9), erucic acid (22: 1n-9), and Nervonic acid (24: 1n-9) have yet to be discovered. Also, previous sites were found in the european population and were not validated in a population of different ethnic groups.
Therefore, there is an urgent need in the art to develop monounsaturated fatty acid-related sites for asian populations, especially chinese populations.
Disclosure of Invention
The invention aims to provide a 24:1n-9 level related locus, a detection method and a kit.
In a first aspect of the present invention, there is provided an in vitro non-diagnostic method for detecting the presence of a single nucleotide polymorphism in the ST8SIA5 gene in a sample, comprising the steps of:
(a) amplifying the ST8SIA5 gene of the sample by using a specific primer to obtain an amplification product; and
(b) detecting the presence or absence of a single nucleotide polymorphism in the amplification product selected from the group consisting of:
rs328134 of ST8SIA5 gene: i.e., C → T at position 210 in SEQ ID No. 1.
In another preferred embodiment, the nucleotide sequence of the ST8SIA5 gene corresponds to position 42510512 of human chromosome 18.
In another preferred embodiment, the amplification product has a length of 80-2000bp and contains position 210 of SEQ ID NO. 1.
In another preferred embodiment, the sample comprises genomic DNA.
In another preferred embodiment, the sample comprises a blood sample, a body fluid, and hair.
In another preferred embodiment, the blood sample comprises serum and plasma.
In another preferred embodiment, the detection is carried out on Asian population.
In another preferred example, the detection is to detect Chinese population.
In another preferred embodiment, the mutation includes a single-stranded mutation and a double-stranded mutation.
In a second aspect of the invention, there is provided a kit for predicting the 24:1n-9 level, the kit comprising primers for specifically amplifying the ST8SIA5 gene or transcript, said primers amplifying an amplification product having a length of 80-2000bp and comprising position 210 of SEQ ID NO. 1.
In another preferred embodiment, the kit further comprises a reagent selected from the group consisting of:
(a) a probe that binds to a mutation at position 210 in SEQ ID NO. 1;
(b) a restriction enzyme recognizing the 210 th mutation in SEQ ID NO. 1.
In another preferred embodiment, the mutation is the following single nucleotide mutation (SNV):
nucleotide sequence of ST8SIA5 gene: i.e., C → T at position 210 in SEQ ID No. 1.
In another preferred embodiment, the kit is further used for predicting the risk of having a disease selected from the group consisting of:
metabolic syndrome, type 2 diabetes, cardiovascular disease, or a combination thereof.
In another preferred embodiment, the kit further comprises reagents for specifically amplifying and detecting single nucleotide mutations selected from the group consisting of:
rs174601, chromosome 11, C → T61379716 of FADS1/2 gene;
rs12579775, chromosome 12, position 6955432G → A of LPCAT3 gene.
In a third aspect of the invention, there is provided the use of the ST8SIA5 gene in the preparation of a reagent or kit for predicting 24:1n-9 levels.
In another preferred embodiment, the reagent or kit is used for detecting the following single nucleotide mutations (SNV):
the nucleotide sequence of the ST8SIA5 gene is shown as SEQ ID NO. 1C → T at position 210.
In another preferred embodiment, the reagents include primers for specifically amplifying the ST8SIA5 gene or transcript, amplification products containing the mutation site, probes specifically binding to the mutation site, and a nucleic acid chip for specifically detecting the mutation site.
In another preferred embodiment, the kit comprises instructions for use and one or more of the following reagents:
a container (a) and a primer located within the container that specifically amplifies an ST8SIA5 gene or transcript;
a container (b) and a probe located within the container that specifically binds to the mutation site;
a container (c) and a nucleic acid chip located in the container for specifically detecting the mutation site.
In another preferred embodiment, the nucleic acid chip further comprises a detection point for detecting additional monounsaturated fatty acid-related sites.
In another preferred embodiment, said additional monounsaturated fatty acid related sites are selected from the group consisting of:
rs174601, chromosome 11, C → T61379716 of FADS1/2 gene;
rs12579775, chromosome 12, position 6955432G → A of LPCAT3 gene.
In a fourth aspect of the invention there is provided the use of a polynucleotide molecule comprising a primer that specifically amplifies an amplification product comprising a mutation site and/or a probe that specifically binds to the SNV site for the preparation of a kit for predicting a 24:1n-9 level, and wherein the mutation site is selected from the group consisting of:
the nucleotide sequence of the ST8SIA5 gene is shown as SEQ ID NO. 1C → T at position 210.
In another preferred embodiment, the mutation site is the nucleotide sequence of the ST8SIA5 gene, and the kit is used for predicting the 24:1n-9 level of a test subject.
In another preferred embodiment, the kit further comprises an instruction, and the instruction describes the following contents:
when the detection object has the mutation site, the 24:1n-9 level of the detection object is lower than that of the normal population.
In another preferred embodiment, the sub-normal population is a test subject with a 24:1n-9 reduction of 0.205% of total fatty acid levels for each additional T site mutation.
In another preferred embodiment, the addition of a T site mutation is a T site mutation on a single nucleotide strand.
In another preferred embodiment, the lower than normal population means that the ratio V1/V2 of the total fatty acid content V1 of 24:1n-9 in the test subject to the total fatty acid content V2 of 24:1n-9 in the normal population is 0.90-0.99, preferably 0.95-0.98, more preferably 0.96-0.98.
In another preferred embodiment, the kit is used for detecting the 24:1n-9 level of Asian population (especially Chinese population).
In a fifth aspect of the invention, there is provided a method of predicting a level of 24:1n-9 in an individual, the method comprising the steps of:
detecting the individual's ST8SIA5 gene, transcript and/or protein and comparing with normal ST8SIA5 gene, transcript and/or protein,
wherein the presence of the difference indicates that the individual has a 24:1n-9 level that is lower than that of the normal population.
In another preferred embodiment, the ST8SIA5 gene or transcript is detected and compared to the nucleotide sequence of normal cellular DNA for differences.
In another preferred embodiment, the difference is the following mutation site:
the nucleotide sequence of the ST8SIA5 gene is shown as SEQ ID NO. 1C → T at position 210.
It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
Drawings
FIG. 1 shows a complete genomic map of significant sites with specific fatty acids in the Chinese population and the European population.
FIG. 1A shows sites significantly associated with 18:1n-9 in the Chinese population.
FIG. 1B shows sites significantly associated with 24:1n-9 in the Chinese population.
FIG. 1C shows sites significantly associated with 18:1n-7 in the European population.
FIG. 1D shows sites significantly associated with 20:1n-9 in the European population.
FIG. 2 shows a region diagram of ST8SIA5-rs 328134.
Detailed Description
The inventor of the invention extensively and deeply researches and discovers that the ST8SIA5 gene is closely related to the 24:1n-9 level for the first time, wherein the correlation research result shows that the rs328134 of the ST8SIA5 gene is as follows: that is, position 210 (C → T) in SEQ ID No. 1 was significantly associated with 24:1n-9 levels, and could be used as a specific SNP to predict 24:1n-9 levels. The present invention has been completed based on this finding.
In particular, Monounsaturated fatty acids (MUFA) have been shown to have protective effects on metabolic syndrome, type 2 diabetes, cardiovascular disease, and the like. Previous genome-wide association studies have found several sites in the european population that correlate with plasma and erythrocyte membrane palmitoleic and oleic acid levels. To discover new sites associated with other MUFA levels (including isooleic, eicosa-11-enoic, erucic, nervonic acids), the inventors performed population-specific genome-wide association studies and cross-species meta-analyses in over 1 million 5 thousand chinese and european people from 9 cohorts of people. In a cross-species meta-analysis study, 6 sites with whole genome significance (log) were found10(Bayes factor)>6) Including 1 new site (ST8SIA5) and 5 reported sites (FADS1/2, PKD2L1, GCKR, HIF1AN and LPCAT 3). In this study, new relationships of the reported sites (FADS1/2, PKD2L1 and GCKR) to other unreported MUFAs were found. In addition, the reported palmitoleic acid-related sites in the european population (PKD2L1, FADS1, GCKR, and HIF1AN) and oleic acid-related sites (FADS1/2 and LPCAT3) were validated in the chinese population and in cross-family meta-analysis. This study provides new clues to the genetic basis of lipid metabolism and highlights the important role of cross-species meta-analysis in complex traits.
Term(s) for
24:1n-9
24:1n-9 is an important monounsaturated fatty acid, widely distributed in the central nervous system, is a main component of sphingolipid, and is important for normal development and function of brain. Epidemiological studies in the european population have recently shown that increased levels of 24:1n-9 in plasma have increased the incidence of congestive heart failure.
ST8SIA5 Gene
The ST8SIA5 gene is designated as ST8 α -N-acetyl-neuraminidase α -2,8-sialyltransferase 5(ST8alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5) and is located on chromosome 18. The protein encoded by this gene is a type II membrane protein on the golgi apparatus and is one of the members of the glycosyltransferase family 29. This protein may be involved in the conversion of the gangliosides GD1a, GT1b, GM1b and GD3 to GD1c, GT1a, GQ1b and GT3, respectively.
The partial sequence of the ST8SIA5 gene is shown below:
CAGGGACGACGTTTTGTTCATCACTAGCTCCCCGGCACCTGGCACCATGCCTGGCACAACATGAGCACTCAATAAATATAATTTATTCACCAATTCACTCACTAAATTGGCCAGCACTCTACTCTGCCTCAGTTGTTTCTAAGCACTGCTCTGCTTCCTCCCTGCTCTCAGCAAAGTCAAGGGCGATGAGCACATGCTGTCTCTGGGCACCAGGTGATTAGTGGGCAGAGCTGCCGCAGCAGCATTGCTGAAATGGTCTCAGACGCTGCCTCTGACCTTGAGCCACCTTTCTTTGTGCTTGGCTAAGCACTGAGTCATTTACTTGTTTTTGCTGCCTTTCAAGCCTGGAGCAGTGGGTTTAGCACAAAGGAAGACATGATGGTTGTTTTGTTTACGGGA(SEQ ID NO.:1)
the underlined 210 th base C indicates a target mutation site, namely ST8SIA5-rs 328134.
Detection method, detection reagent and kit
The polynucleotide associated with the ST8SIA5 gene can be used for prediction of 24:1n-9 levels. In another aspect, the assay of the invention can be used to assess an individual's risk for a disease associated with a 24:1n-9 level.
One skilled in the art will recognize that there are a number of analytical techniques available for detecting the presence of a single nucleotide polymorphism at the site in a gene. These techniques include (but are not limited to): DNA sequencing and hybridization sequencing; enzymatic mismatch cleavage, heteroduplex analysis, dot hybridization, oligonucleotide arrays (DNA chips), Mini-sequencing, Taqman technology, molecular beacons, etc., Denaturing High Performance Liquid Chromatography (DHPLC).
The test sample used in the present invention is not particularly limited, and for detecting SNP, DNA or mRNA extracted from a sample such as blood, tissue or the like may be used.
A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also called a "gene chip" or a "nucleic acid chip") for analyzing differential expression analysis of genes in tissues and gene diagnosis. The corresponding transcript can also be detected by in vitro amplification using primers specific for the ST8SIA5 gene by the RNA-polymerase chain reaction (RT-PCR).
The detection can be performed on cDNA as well as on genomic DNA. The mutated form of the ST8SIA5 gene includes point mutation, translocation, deletion, recombination and any other abnormality compared with the normal wild-type DNA sequence. The mutation can be detected by known techniques such as Southern blotting, DNA sequencing, PCR and in situ hybridization. In addition, since mutation may affect the expression of protein, the presence or absence of mutation in a gene can be indirectly determined by Northern blotting or Western blotting.
The most convenient method for detecting the SNP of the invention is to amplify the ST8SIA5 gene of a sample by using ST8SIA5 gene specific primers to obtain an amplification product; then, the presence or absence of the single nucleotide polymorphism of the present invention in the amplification product is detected.
It is understood that, after the present invention reveals the correlation between the SNP of ST8SIA5 gene and the level of 24:1n-9 for the first time, one skilled in the art can easily design an amplification product that can specifically amplify the position containing the SNP, and then determine whether the polynucleotide polymorphism of the present invention exists by sequencing or the like. In general, the length of the primer is 15-50bp, preferably 20-30 bp. Although complete complementarity of the primer to the template sequence is preferred, it is known to those skilled in the art that specific amplification (i.e., amplification of only the desired fragment) is also possible in the presence of a primer that is not necessarily complementary to the template, particularly at the 5' end of the primer. Kits containing these primers and methods of using these primers are within the scope of the invention, provided that the primers amplify an amplification product containing the corresponding position of the SNP of the invention. A preferred primer pair amplifies a sequence having position 210 of SEQ ID NO. 1.
Although the length of the amplification product is not particularly limited, the length of the amplification product is generally 100-2000bp, preferably 150-1500bp, more preferably 200-1000 bp. These amplification products should contain the 210 th position in SEQ ID NO: 1.
The main advantages of the invention include:
(a) SNPs of the invention have very high associations with the 24:1n-9 level
(b) The SNP of the invention can be used for auxiliary judgment of the susceptibility of diseases related to 24:1n-9 level
The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, in which specific conditions are not noted in the following examples, are generally carried out under conventional conditions or conditions recommended by the manufacturers. Unless otherwise indicated, percentages and parts are by weight.
Universal materials and methods
1. Research population
The chinese population GWAS study included 3521 chinese from two cohort studies of NHAPC (2865) and MESA (656). The european population GWAS study included 12020 europeans from the eight cohort studies of ARIC, cartia, CHS, GOLDN, NHS, HPFS, InCHIANTI and MESA. In the cross-species meta-analysis, all from the two populations in central europe were included in the analysis. All people signed written informed consent and all cohort studies were approved by the relevant ethical committees.
2. Fatty acid determination
In the ARIC, CARDIA, CHS, InCHIANTI and MESA cohorts, fasting plasma phospholipids were separated by thin layer chromatography followed by gas chromatography for fatty acid determination. The percentage of fatty acids in plasma phospholipids was determined in the ARIC, CARDIA, CHS and MESA cohorts, while the percentage of fatty acids in plasma was determined in the InCHIANTI cohort. In the GOLDN, NHS, HPFS and NHAPC cohort, fatty acids in the erythrocyte membranes were determined by gas chromatography or gas liquid chromatography. The level of fatty acid in each cohort represents the percentage content of fatty acid. GWAS studies were performed at levels of 16:1n-7,18:1n-7,18:1n-9,20:1n-9,22:1n-9 and 24:1n-9 in the Chinese population, and at levels of 18:1n-7,20:1n-9,22:1n-9 and 24:1n-9 in the European population (Table 1).
3. Genotyping and quality control
The CHS, InCHIANTI and NHAPC cohorts were genotyped with Illumina 370, Illumina 550 and Illumina 660W gene chips, respectively, and ARIC, CARDIA, GOLDN, NHS, HPFS and MESA with Affymetrix 6.0 gene chips. SNP sites with a response rate of < 95% (ARIC, CARDIA, MESA, NHS and HPFS) or with a response rate of < 97% (CHS, GOLDN, InCHIANTI and NHAPC) were deleted. SNPs that do not meet Hardy-Weinberg equibrium (HWE) and minor allele frequencies < 1% were also deleted. MACH software is adopted in ARIC, GOLDN, NHS, HPFS and InCHIANTI queues for calculation, BEAGLE software is adopted in CARDIA queues for calculation, BIMBAM software is adopted in CHS queues for calculation, and IMPUTE software is adopted in MESA and NHAPC queues for calculation.
4. GWAS in Chinese and European populations
In each cohort, the GWAS for each fatty acid was calculated separately. Linear regression models were used to study the association of SNPs with each fatty acid under an overlay-type genetic model, and correct age, gender, recruitment site (if needed), and principal components. Genomic control (Genomic control) was performed prior to meta-analysis to reduce the potential effects of population stratification. GWAS results for each cohort in the middle European population were analyzed meta-by the inverse variance meta-analysis method using the METAL software (http:// www.sph.umich.edu/csg/abecasis/METAL).
5. Cross-ethnic meta-analysis
In order to find new MUFA-associated sites and to reduce the genetic region where action sites may exist, cross-ethnic meta-analysis was performed in the middle and European population using the MANTRA software. The MANTRA software employs a Bayesian framework, allowing for heterogeneity among different ethnic groups and better performance and resolution than other analysis methods. Log10SNP sites of (BF) ≥ 6 have genome-wide significance, while Phet>0.5 has significant heterogeneity.
Example 1
Research population
The Study Population included 3521 Chinese from the two cohort studies of the Nutrition and Health of the elderly Population in China (NHAPC) and the multiple-Etanic Study of Atherosclerosis (MESA), as well as from the community resident Atherosclerosis Risk Study (the Atherosclerosis Risk in complications Study, ARIC), the Young Cardiovascular Risk Development Study (the Coronary Artery Development in Young patients, CARDIA), the Cardiovascular Health Study (the Cardiovascular Health Study, CHS), the Lipid-Lowering Drugs and the dietary Network Study (the Genetics of Lipid Lowering Drugs, Network, Health Study (the Health care Study', the CHS), the Health tracking Study (the Health and Health Study, the Health research in the Health of the elderly Population, the Health tracking Study (the Health research of the Health and Health Study, the Health research in the Health research of the Health of the elderly people, the Health research of the Health and research of the Health care workers (the Health research of the Health and research of the Health care workers, InCHIANTI) and MESA eight cohort studies 12020 european (table 1). The study population was predominantly middle to elderly individuals (average age not 45.8-750 years of age in each cohort study) and approximately 50% women (except all women in NHS and all men in HPFS). Cohort studies of NHAPC, GOLDN, NHS and HPFS detected erythrocyte membrane fatty acids, and other cohort studies detected plasma phospholipid fatty acids.
Example 2
GWAS study of Chinese population
In the research of the GWAS of Chinese population, the relation between 2200000 multiple Single Nucleotide Polymorphism Sites (SNPs) and the levels of 16:1n-7,18: 1n-9,20:1n-9,22:1n-9 and 24:1n-9 is researched. The results are shown in table 2, 1 new locus reached a significant level of whole genome: ST8SIA5 correlated with 24:1n-9 levels (β ═ 0.205P ═ 1.49 × 10-12Fig. 1 and 2). The ST8SIA5 site remained significant after Boferroni correction (P.ltoreq.5X 10)-8/6). In addition, the 16:1n-7 related sites (PKD2L1, FADS1/2, GCKR and HIF1AN) and the 18:1n-9 related sites (FADS1/2, MBOAT5 and TRIM58) reported in the European population were also confirmed in the Chinese population (P.ltoreq.0.012). However, the correlation between 16:1n-7 and 2p13-rs6722456 could not be verified, and PHB2-rs2110073 was not included in the calculation in the Chinese population due to its low frequency.
Example 3
GWAS study of the European population
In the study of the European population GWAS, the relationship of multiple SNPs 2200000 to levels of 18:1n-7,20:1n-9,22:1n-9 and 24:1n-9 was studied. As shown in table 2, 2 sites reached a significant level of whole genome (fig. 1). PKD1L2 and FADS1/2 have been reported to be associated with 16:1n-7 and/or 18:1n-9 in this studyAnd found to be associated with 18:1n-7 and/or 20:1n-9 (Table 2). These sites remained significant after Boferroni correction (P.ltoreq.5X 10)-8/4)。
The new site found in the chinese population (ST8SIA5) was not validated in the european population (P ═ 0.545, table 3). The relation between FADS1-rs174528 and 18:1n-7 and 20:1n-9 is verified in Chinese population (P is less than or equal to 3.67X 10)-3Table 3).
Example 4
Cross-ethnic meta-analysis
In the cross-family meta-analysis, the results of GWAS in the chinese population and the european population were analyzed together using the MANTRA (meta-analysis of trans-experimental association students) software, and the new site found in the GWAS of the chinese population (ST8SIA5) also reached a genome-wide significance level in the cross-family meta-analysis. PKD2L1 and GCKR, previously reported to be associated with 16:1n-7, which were also found in this study to be associated with 18:1n-7 and 20:1n-9, respectively; FADS1/2, previously reported to be associated with 16:1n-7 and 18:1n-9, was also found to be associated with 18:1n-7 and 20:1n-9 in this study (Table 3).
The previously reported 16:1n-7 related sites (FADS1/2, PKD2L1, GCKR and HIF1AN) and 18:1n-9 related sites (FADS1/2 and LPCAT3) were validated in a cross-species meta-analysis (Table 3).
The results of the probability of Posterior heterogeneity (Phet) in the middle european population are shown in table 3, with Phet 1 indicating significant heterogeneity. ST8SIA5 has significant heterogeneity in the middle european population (Phet ═ 1, table 3).
Example 5
Gene and pathway analysis
Further gene and pathway analysis was performed to find more new sites and to investigate the relevant mechanisms. In gene analysis, the new site ST8SIA5 reaches the gene significance level (P is 1.03 multiplied by 10)-8) The pathway in which it is located (ganglia glycosphingolipid synthesis pathway) reaches pathway significance levels (P ═ 1.54 × 10-7). These results suggest that the effect of the ST8SIA5 gene on the 24:1n-9 level may be achieved by regulating glycosphingolipid synthesis. Furthermore, FADS1/2 and PKD2L 1-The SCD gene is enriched in unsaturated fatty acid synthesis path, ALA synthesis path and PPAR signal path (P is less than or equal to 1.42 multiplied by 10)-5) These pathways are closely related to fatty acid levels.
All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.
Claims (2)
1. Use of a polynucleotide molecule comprising primers for specifically amplifying an amplification product comprising a mutation site and/or probes for specifically binding to a SNV site, for the preparation of a kit for predicting a nervonic acid level, wherein said mutation site is:
the nucleotide sequence of the ST8SIA5 gene, C → T at position 210 in SEQ ID NO: 1.
2. The use of claim 1, wherein the kit further comprises an instruction which describes:
when the detection object has the mutation site, the nerve acid level of the detection object is suggested to be lower than that of the normal population.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610430530.9A CN107513557B (en) | 2016-06-16 | 2016-06-16 | 24:1n-9 level related locus, detection method and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610430530.9A CN107513557B (en) | 2016-06-16 | 2016-06-16 | 24:1n-9 level related locus, detection method and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107513557A CN107513557A (en) | 2017-12-26 |
| CN107513557B true CN107513557B (en) | 2020-12-11 |
Family
ID=60719897
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610430530.9A Active CN107513557B (en) | 2016-06-16 | 2016-06-16 | 24:1n-9 level related locus, detection method and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107513557B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1192116C (en) * | 1999-03-30 | 2005-03-09 | 内诺金有限公司 | Single nucleotide polymorphic discrimination by electronic dot blot assay on semiconductor microchips |
| US20140045702A1 (en) * | 2012-08-13 | 2014-02-13 | Synapdx Corporation | Systems and methods for distinguishing between autism spectrum disorders (asd) and non-asd development delay |
-
2016
- 2016-06-16 CN CN201610430530.9A patent/CN107513557B/en active Active
Non-Patent Citations (1)
| Title |
|---|
| ST8SiaV基因启动子的克隆及功能鉴定;夏丽萍等;《军事医学科学院院刊》;20050630;第29卷(第3期);第248-253页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107513557A (en) | 2017-12-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Howell et al. | DNA methylation and transcription patterns in intestinal epithelial cells from pediatric patients with inflammatory bowel diseases differentiate disease subtypes and associate with outcome | |
| Padmanabhan et al. | Towards precision medicine for hypertension: a review of genomic, epigenomic, and microbiomic effects on blood pressure in experimental rat models and humans | |
| Viguerie et al. | Determinants of human adipose tissue gene expression: impact of diet, sex, metabolic status, and cis genetic regulation | |
| Wakai et al. | Profile of participants and genotype distributions of 108 polymorphisms in a cross-sectional study of associations of genotypes with lifestyle and clinical factors: a project in the Japan Multi-Institutional Collaborative Cohort (J-MICC) Study | |
| Naukkarinen et al. | Use of genome-wide expression data to mine the “Gray Zone” of GWA studies leads to novel candidate obesity genes | |
| Grant et al. | Microarray technology and applications in the arena of genome-wide association | |
| KR20110018909A (en) | Genetic markers for weight management and methods of use thereof | |
| Bruno et al. | Use of copy number deletion polymorphisms to assess DNA chimerism | |
| Karmelić et al. | Adiponectin level and gene variability are obesity and metabolic syndrome markers in a young population | |
| CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
| WO2023142619A1 (en) | Marker for dilated cardiomyopathy genetic detection and use thereof | |
| WO2020061072A1 (en) | Method of characterizing a neurodegenerative pathology | |
| Shah et al. | Differential methylation of the type 2 diabetes susceptibility locus KCNQ1 is associated with insulin sensitivity and is predicted by CpG site specific genetic variation | |
| JP2010535501A (en) | Methods to identify individuals at risk of thiopurine drug resistance and thiopurine drug intolerance | |
| CN110564837B (en) | Genetic metabolic disease gene chip and application thereof | |
| Yang et al. | Prevalence of hyperuricemia among the Chinese population of the southeast coastal region and association with single nucleotide polymorphisms in urate‑anion exchanger genes: SLC22A12, ABCG2 and SLC2A9 | |
| Kefi et al. | Association of apolipoprotein A5 gene variants with metabolic syndrome in Tunisian population | |
| JP5427352B2 (en) | A method for determining the risk of developing obesity based on genetic polymorphisms associated with human body fat mass | |
| CN107513557B (en) | 24:1n-9 level related locus, detection method and kit | |
| Dissanayake et al. | Prevalence of genetic thrombophilic polymorphisms in the Sri Lankan population—implications for association study design and clinical genetic testing services | |
| CN111662973B (en) | SNP locus related to auxiliary diagnosis of susceptibility of chronic obstructive pulmonary disease and application thereof | |
| US20220002809A1 (en) | Dna methylation based estimator of telomere length | |
| JP6494356B2 (en) | Nonalcoholic fatty liver disease and / or nonalcoholic steatohepatitis risk and / or severity risk determination method, and oligonucleotide kit for determination | |
| JP5904501B2 (en) | Method for detecting type 2 diabetes | |
| Cox et al. | Gene expression profiles in whole blood and associations with metabolic dysregulation in obesity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 200031 Yueyang Road, Shanghai, No. 319, No. Applicant after: Shanghai Institute of nutrition and health, Chinese Academy of Sciences Address before: 200031 Yueyang Road, Shanghai, No. 319, No. Applicant before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |