CN107501414A - Streptococcus mutans CAT SYI antigens and antibody - Google Patents

Abstract

The invention belongs to field of biological pharmacy, and in particular to a kind of streptococcus mutans CAT SYI antigens and antibody.The antigen is connected by Streptococcus mutans virulence protein antigen glucosyltransferase GtfB and glucan-binding protein GbpB functional areas and formed, and the antibody is prepared by the antigen.CAT SYI antigens are made up of the linker of two amino acid fragments of two amino acid fragments (CAT and SYI) and connection.The virulence gene gtfB of streptococcus mutans is connected with gbpB through linker to obtain tandem gene CAT SYI, CAT SYI antigens are prepared first, is immunized by the antigen as vaccine, CAT SYI antibody is prepared.The CAT SYI antibody is found through zoopery, there is more preferable anti-caries effect compared with for single virulence gene and the antibody of full bacterium.The candidate antigens of genetic engineering vaccine for decayed tooth can be used as by confirming CAT SYI antigens, and CAT SYI antibody is available for reach anti-caries purpose, having a good application prospect in the commodity such as toothpaste or in medicine.

Description

Streptococcus mutans CAT-SYI antigens and antibody

Technical field

The invention belongs to field of biological pharmacy, and in particular to the CAT-SYI antigens and antibody of streptococcus mutans.

Background technology

Dental caries (dental caries), are commonly called as decaying tooth, and are to produce acid by bacterial metabolism carbohydrate, and cause tooth to take off A kind of communicable disease of mineralising.It is non-renewable due to adamantine layer and dentin layer, thus dental caries will not be voluntarily cured Close, if not treated, dental caries will occur until whole tooth is destroyed always.Yellow is presented to the face between black in carious tooth Color, patient has the symptoms such as pain and eating difficulties, and triggers periodontitis, swelling and aching of gum, bleeding gums, loss of tooth etc. simultaneously Send out disease.The whole world of J Dent Res magazine rans in 2017 does not receive the dental caries patient populations of dental care by the 2500000000 of nineteen ninety People has just risen to 3,500,000,000 people by 2015, and this number is also by sustainable growth.In 2010, drawn by global mouth disease The direct economy expenditure risen just has 298,000,000,000 dollars, about account for the 4.6% of the hygienic total expenditure in the whole world, then by the World Health Organization (WHO) shown with the data of offer of National Public Health research institute (PZH), the existing 60%-90% in whole world teenager by The influence of dental caries.The history of human caries is very remote, just there is the vestige of carious tooth, 1900s people before 16-65 is 10000 years It is bacterial by mutans streptococcus group and lactic acid bacteria realm just to recognize dental caries, but also indefinite mainly any bacterium causes , until nineteen twenty-four is just separated first by Clarke and has named the Main Pathogenic Bacteria " streptococcus mutans " of dental caries.

Streptococcus mutans (Streptococcus mutans, S.mutans) abbreviation mutans streptococcus, it is considered to be cause dental caries One of Main Pathogenic Bacteria, and its recall rate is up to 74%-94% in the oral cavity, and streptococcus mutans is that Gram-positive is facultative Microaerobion, belong to Lactobacillaceae-Stomatostreptococcus-streptococcus mutans flora (mutans steptococci), deform chain Streptococcus sobrinus, Streptococcus macacae, ferus, hamster streptococcus, Streptococcus cricetus, Down streptococcus are included in coccus group And seven kinds of streptococcus mutans.

Streptococcus mutans one shares tetra- kinds of serotypes of c, e, f, k, and K-type bacterial strain, which is that Japanese scholars Nakana is new in 2004 years, to be sent out Existing One serotype, the serological type strain is in endocarditis, bacteremia and atherosclerotic plaque blood samples of patients Recall rate is higher, in addition, Bae J S etc. and Naka S etc. research find that K-type bacterial strain in addition to causing dental caries, also participates in non-wine The formation of essence fatty liver, and laminins Cnm and SpaP participate in the formation of the disease.On glycoprotein polysaccharide composition, c, E, the polysaccharide main chain of f types bacterial strain is rhamnose, and side chain is glucose, and the polysaccharide main chain of K-type bacterial strain is rhamnose, unprotected side chain. Four kinds of serotype gene orders are variant on rgpF-ORF12 genes, therefore the serotype of bacterial strain can be identified by PCR methods.Mesh Before, c types are recall rate highest serotype in oral cavity, account for 70%-80%, next to that e types, account for 20%, and f types and K-type are in mouth Recall rate in chamber is minimum, ratio<2-5%.Although the ratio of K-type in the oral cavity is very low, there are document report non-c types recent years Ratio it is on the rise.

Three big virulence factors of streptococcus mutans be to be formed biomembrane, production it is sour and acidproof, its cariogenic process is by three phases Composition, first stage are bacterial strains " field planting " in tooth surface, and field planting initial stage is by non-sucrose dependent form adhesion protein SpaP mediations 's；Second stage is bacterium " aggregation ", and this stage is mediated by SpaP, Gtfs and Gbps, and Gtfs Polysaccharides are single Sugar, then α -1,3 glycosidic bonds and α -1 are catalyzed respectively, 6 glycosidic bonds aggregate into water-soluble and water-insoluble glucan；Phase III It is " formation of biomembrane ", a large amount of glucans combine with albumen such as SpaP, Gbps, Gtfs in the stage, under interaction Bacterium largely assembles, and the biomembrane of one layer of production acid, i.e. bacterial plaque are formed in dental surface.Bacterium based on streptococci The big volume production acid of carbohydrate being metabolized in oral cavity, cause the unbalance (Ca10 (PO4) 6 of adamantine layer " demineralized " and " remineralization process " (OH) 2+14H+ → 10Ca2++6H2PO4-+H2O), when tooth surface microenvironment pH value<5.4 will cause adamantine layer demineralization Change, final carious tooth is formed.Because streptococcus mutans has the production acid and acid-fast ability stronger compared with other oral bacterias, thus more can The relatively low sour environment of pH value is adapted to, is that it is more easy to turn into cariogenic bacteria main in oral cavity.

Treatment for carious tooth mainly by " prevent demineralized process-be directed to pathogenic bacteria " and " promotion remineralization process " this Two aspects are carried out.The mode of " prevention demineralized process-be directed to pathogenic bacteria " has following several：Chemical drugs species such as penicillin, ten thousand Ancient mycin, chlorhexidine, SDS, triclosan etc.；Crude drug species such as tea oil, green tea, honey etc.；Antibacterial peptide：To broad spectrum of bacteria kind Class (including antibody-resistant bacterium) has strong lethal effect；Sugar substitute class such as xylitol, sorbierite may be added to that chewing gum is used In preventing decayed tooth；And immune anticaries involved in the present invention.Immune anticaries include " active immunity preventing decayed tooth " and " passive immunity preventing decayed tooth " Two aspects, " active immunity preventing decayed tooth " refer to will inactivation streptococcus mutans, surface antigen protein, polypeptide fragment, DNA etc. be made can be with Body is set to produce the biological products of specific immune response, so that body adaptive immune is protected.The table of streptococcus mutans at present Face albumen such as adhesion protein SpaP, glucan-binding protein Gbps, glucosyltransferase Gtfs this three major types have been shown to Evoke the mucosal immune response of body and produce specific IgA." passive immunity preventing decayed tooth " refers to by ox or chicken injections of antigens, Specific antibody is obtained from milk, yolk again, then antibody is directly used in a kind of new way of Caries therapy.By passively exempting from Epidemic disease treatment can make body obtain specific antibody immediately, and be directly targeted in target antigen.Have more on immune anti- Its effect of the document report of dental caries.

SpaP A areas pass through Escherichia coli protokaryon table comprising sialoprotein land (SBR), Hajishengallis G etc. Up to SBR functional areas, antigen and immune rat are prepared, has evoked the immune response of T cell in rat body, and generated special Property antibody, obtain the protective effect of immune suppression dental caries in animal body.Batista M T in 2014 etc. pass through Escherichia coli respectively SpaP39-512 antigen proteins are expressed with bacillus subtilis, antigen immune rat is prepared, effectively inhibits and become in rat oral cavity The streptococcic field planting of shape.

R.D.Nogueira in 2008 etc. has been evoked mucous membrane and exempted from by mucosa-immune SD rats GtfB CAT and GLU fragments Epidemic disease response simultaneously generates Specific IgA antibody, obtains the effect of immune suppression dental caries.The prokaryotic expression GtfB such as Kim M A in 2012 N sections antigen (gtfB193-1530), be immunized BALB/c mouse, from spleen cell isolate production specific antibody cell simultaneously Merged with SP2/0 myeloma cell, filter out the monoclonal hybridoma for secreting anti-GtfB antibody.The monoclonal prepared resists Body can effectively suppress GtfB enzymatic activity in testing in vitro.

Smith in 2001 purifies GbpB albumen by anion-exchange chromatography from the culture supernatant of streptococcus mutans, Obtained special yolk antibody feeding SD rats achieve preferably suppression dental caries effect.

Domestic scholars Yang De qins etc. expand spaP the and gtfB genes of streptococcus mutans by external PCR, and build PcDNA3-spaP and pcDNA3-gtfB nucleic acid vaccine immunity rats, the results showed that polyvalent vaccine achieves identical with whole-bacterial-vaccine Suppression dental caries effect.Li Huang in 2013 etc. go here and there the GLU functional areas of spaP genes (A areas and P areas functional areas) and gtfB genes Connection, eucaryon plasmid is built, and prepare DNA vaccination PGJA-P/VAX, Wistar rats are immunized, the DNA vaccination is in Wistar rats Evoke mucosal immune response in vivo, experiment in vitro shows, the IgA secreted in rat saliva can suppress streptococcus mutans and be wrapped in saliva By sticking on hydroxyapatite.

Patent CN102488898A discloses a kind of vaccine combination for the carious tooth being used for caused by being infected by streptococcus mutans Thing, the vaccine combination are included from the Region of Surface Protein of Streptococcus Mutans PAC antigens derived from and the adjuvant derived from from flagellin.And The method that offer prepares vaccine combination.

Patent CN102973939A discloses a kind of Streptococcus mutans and streptococcus sobrinus mixing specific IgY antibody system Agent, it is characterised in that by the streptococcus mutans thalline and bacterial chip of 10~70 parts by weight and the remote edge chain of 30~90 parts by weight Coccus thalline and bacterial chip are mixed into antigen immune bird inlay and prepared.The invention is used for pre- anti-caries, gingivitis and tooth All scorching and its halitosis toothpaste has a significant effect to pre- anti-caries, gingivitis and periodontitis and its halitosis germ.

The vaccine for being presently used for pre- anti-caries is specificity mostly for single streptococcus mutans virulence gene or for complete Bacterium, and the vaccine that specificity is prepared for the functional area of two or more virulence genes is less, and it might have more Significant anti-caries effect.

Therefore develop a kind of GtfB functional areas CAT connected with GbpB functional areas SYI the neoantigen CAT-SYI to be formed and Its antibody, and experiment in vitro shows, and the CAT-SYI antibody has compared with for single virulence gene and the antibody of full bacterium More preferable anti-caries effect.Confirm that CAT-SYI antigens can be as the candidate antigens of genetic engineering vaccine for decayed tooth, CAT-SYI antibody can For reaching anti-caries purpose in the commodity such as toothpaste or in medicine, have a good application prospect.

The content of the invention

In view of this, an object of the present invention is to provide a kind of CAT-SYI antigens, and the antigen is by streptococcus mutans Connect to be formed in surface virulence protein antigen glucosyltransferase GtfB and glucan-binding protein GbpB functional areas.

To achieve the above object, the technical scheme is that：

Streptococcus mutans attaches to dental surface using its surface protein, and main surface protein includes attachment proteins SpaP, glucanotransferase GtfB, glucan-binding protein GbpB, these albumen can promote bacterial adhesion and dental surface, enter And biomembrane is formed, and it is metabolized carbohydrate production acid corrosion tooth.If sticking for bacterium can be prevented, then will suppress raw The formation of thing film, and then the formation of pre- anti-caries.

Existing research has confirmed that the specific antibody of above-mentioned three kinds of surface proteins has anti-caries effect.

The present invention provides a kind of CAT-SYI antigens, it is characterised in that the CAT-SYI antigens are by two amino acid fragments It is formed by connecting, amino acid sequence is respectively：SEQ ID NO:1, SEQ ID NO:2.The amino acid fragment be GtfB and GbpB two functional areas, respectively CAT and SYI.Clone obtains corresponding two DNA fragmentations and connected with linker, By technique for gene engineering, tandem sequence is expressed in cell and obtains recombinant protein, as CAT-SYI antigens.

Connected between two tandem genes by linker, as preferable scheme, linker amino acid sequence is three groups Amino acid chain is repeated, its sequence is：SEQ ID NO:3, it is to connect one section of the two albumen flexible chain for being rich in glycine, amino acid Corresponding codon is designed as e. coli bl21 (DE3) preferred codons.

The second object of the present invention is to provide a kind of CAT-SYI antibody being prepared by CAT-SYI antigens.

To achieve the above object, the technical scheme is that：

It is immunized using CAT-SYI antigens, specific antibody, i.e. CAT-SYI antibody can be prepared.

As preferable scheme, the CAT-SYI antibody is Yolk antibody.

The third object of the present invention is to provide a kind of preparation method of CAT-SYI antigens.

To achieve the above object, the technical scheme is that：

The preparation method of CAT-SYI antigens comprises the following steps：

1. design primer：The streptococcus mutans reference culture UA159 genomic DNAs announced on selection GenBank are masterplate, The primer in CAT regions and SYI regions is designed, adds linker base sequence in the R chains of CAT primers, the F chains of SYI primers add Upper linker base sequence；

2. SOE-PCR amplification tandem genes CAT-SYI：Touchdown PCR expands CAT and SYI respectively, is used as down after product purification One step SOE-PCR template.SOE-PCR expands to obtain tandem gene, and purified product is purpose fragment.The purpose fragment arrived CAT-SYI is that gtfB CAT regions and gbpB SYI region series are formed, and is connected between two tandem genes by linker.

3. construction recombination plasmid：Double digestion purpose fragment and plasmid vector, digestion products connection obtain recombinant plasmid；

4. recombinant plasmid transformed competence colibacillus cell is simultaneously screened；

7. IPTG induces expression of recombinant proteins and detected；

8. purification of recombinant proteins, obtain CAT-SIY antigens.

As preferable scheme, the amino acid sequence of the linker is three groups of repetition amino acid chains, and its sequence is：SEQ ID NO:3, it is one section of flexible chain for being rich in glycine for connecting two albumen, amino acid corresponds to codon and is designed as Escherichia coli BL21 (DE3) preferred codons.

As preferable scheme, described competent cell is e. coli bl21 competent cell, while linker Amino acid sequence corresponds to the preferred codons that codon is designed as e. coli bl21.

As preferable scheme, the described final concentration of 0.25mM of IPTG derivants, inducing temperature is 30 DEG C, time 6- 8h。

As preferable scheme, two kinds of approach of affinity chromatography and renaturing inclusion bodies are carried out respectively and take purification of recombinant proteins egg In vain.

The fourth object of the present invention is to provide a kind of preparation method of CAT-SYI antibody.

To achieve the above object, the technical scheme is that：

The preparation method of CAT-SYI antibody, comprises the following steps：

1. obtained CAT-SYI antigens are prepared into vaccine and for being immunized；

2. extract specific antibody from by immune body.

As preferable scheme, described by immune body is laying hen, and the specific antibody is the spy extracted in yolk Different in nature yolk antibody IgY.

The fifth object of the present invention is to provide purposes of the CAT-SYI antigens in the medicine for preparing treatment carious tooth.

To achieve the above object, the technical scheme is that：

CAT-SYI antigens can be used for the medicine for preparing treatment carious tooth or the candidate antigens as genetic engineering vaccine for decayed tooth, The antigen can be used for the preparation of the medicine of active immunity preventing decayed tooth.

The sixth object of the present invention is to provide purposes of the CAT-SIY antibody in the medicine for preparing treatment carious tooth.

To achieve the above object, the technical scheme is that：

CAT-SIY antibody can be used for the medicine for preparing treatment carious tooth.CAT-SIY antibody can be used for passive preventing decayed tooth, described Antibody can be used for the preparation of the medicine of passive immunity preventing decayed tooth.

Recombinant plasmid of the seventh object of the present invention in CAT-SYI Process of Antigen is prepared in offer is treated for preparing The purposes of the medicine of carious tooth.

To achieve the above object, the technical scheme is that：

Prepare medicine or vaccine that the recombinant plasmid in CAT-SYI Process of Antigen can be used for preparing treatment carious tooth, i.e., it is described Recombinant plasmid can be used for the preparation of the medicine of active immunity preventing decayed tooth.

The eighth object of the present invention is to provide a kind of medicine for being used to treat carious tooth, and the medicine can be used for immune anticaries.

To achieve the above object, the technical scheme is that：

A kind of medicine for being used to treat carious tooth, it is characterised in that the medicine is CAT-SYI antibody and assigns its medicine Carrier.

Further, in order to how probe into the suppression dental caries effect of CAT-SYI antibody, the caries model of CAT-SYI antibody has been carried out Animal experiment study.Feed is the high cariogenic feeds of sugar of Diet-2000, and Streptococcus mutans serotype c bacterium solutions are injected into SD rat mouths Chamber feeds antibody with infected rats according to packet.Finally carry out the Keyes score of carious tooth.Six kinds of antibody are employed, are respectively Anti- GtfB, GbpB, SpaP, CAT-SYI, the specific antibody of whole-bacterial-vaccine, and non-immunized control antibodies.

The beneficial effects of the present invention are：

1) CAT-SYI antigens provided by the invention are a kind of series connection antigen, by the surface protein work(of two streptococcus mutanses Energy area is together in series by linker.The research and development of the novel antigens provide new feasible scheme for suppressing streptococcus mutans.

2) present invention provides the preparation method of CAT-SYI antigens and antibody, and the CAT-SYI prepared by this method recombinates matter Grain, antigen and antibody, more possibility are provided for the exploitation of the medicine of immune anticaries.

3) CAT-SYI antibody provided by the invention has suppression dental caries effect more more preferable than the antibody of single-gene albumen, is immune The commodity and medicine preparation of preventing decayed tooth, there is provided more preferable material.

Brief description of the drawings

Fig. 1 is that SOE-PCR expands CAT-SYI schematic diagrams.

Fig. 2 is SOE-PCR amplification of DNA fragments nucleic acid electrophoresis figures.Caption：1 swimming lane is CAT-linker in a, and 2 swimming lanes are linker-SYI；CAT-SYI is that tandem gene DNA, M are standard DNA marker in b.

Fig. 3 is restructuring plasmid map.

Fig. 4 is that recombinant plasmid is transferred to the bacterium colony PCR electrophoretograms after T10 competent cells.Caption：M is standard DNA marker。

Fig. 5 is the SDS-PAGE of recombinant protein.Caption：A hollow carriers pET32a；Recombination fusion protein in b GtfB；Recombination fusion protein GbpB in c；Recombination fusion protein SpaP in d；Recombination fusion protein CAT-SYI in e；M is standard egg White marker, the recombinant protein band that red arrow instruction induces.

Fig. 6 is the SDS-PAGE of recombinant protein expression-form.Caption：Tri- kinds of fusions of GtfB, GbpB, SpaP in a Albumen；CAT-SYI fusion proteins in b, M are standard protein marker, the main expression-form of red arrow indicator protein matter.

Fig. 7 is recombinant protein SDS-PAGE after purification.Caption：GtfB fusion proteins in a, about 35KDa；In b GbpB fusion proteins, about 70KDa；SpaP fusion proteins in c, about 80KDa, M are standard protein marker.

Fig. 8 is Yolk antibody SDS-PAGE.Caption：1st, 2,3,4 swimming lanes are respectively GtfB, GbpB, SpaP, CAT- SYI Yolk antibody water crude extract, M are standard protein marker.

Fig. 9 is the ELISA testing results of antibody titer.Caption：GtfB Yolk antibodies in a；GbpB Yolk antibodies in b；In c SpaP Yolk antibodies；CAT-SYI Yolk antibodies in d；The curve of circular dot represents control group, is non-deformed streptococcal antigens, side The curve of form point represents recombinant protein.

Figure 10 is SD rat carious tooth figures.Caption：Blank antibody control group in a；Whole-bacterial-vaccine antibody control group group in b；In c GtfB antibody assay groups；CAT-SYI antibody assays group in d；GbpB antibody assays group in e；SpaP antibody assays group in f.

Figure 11 is carious tooth score figure.Caption：1 is control group；2 be full bacterium group；3 be GtfB groups；4 be CAT-SYI groups；5 are GbpB groups；6 be SpaP groups；Black round dot represents the Keyes scoring value of a SD rat carious tooth, and bar shaped block diagram is equal for score Value.

Embodiment

It detailed description of a preferred embodiment of the present invention will be given below.The reality of unreceipted actual conditions in preferred embodiment Proved recipe method, generally according to normal condition, illustrated embodiment is to preferably be illustrated to present disclosure, but is not Present disclosure is only limitted to illustrated embodiment.So those skilled in the art according to foregoing invention content to embodiment party Case carries out nonessential modifications and adaptations, still falls within protection scope of the present invention.

One gene magnification

Tandem gene CAT-SYI amplification methods are as follows：

1. design of primers

Streptococcus mutans reference culture UA159 (AE014133.2) genomic DNAs announced on selection GenBank are mould Version, design the primer in CAT regions and SYI regions.The CAT regions and the gbpB SYI regions (molecules of MHC II that CAT-SYI is gtfB Land) 741bp (bp of CAT 300bp connections linker 45 reconnect the bp of SYI 396 have 741bp altogether), two tandem genes it Between by one section of 45bp linker connections, linker amino acid sequence is three groups of repetition amino acid chains, and sequence is：SEQ ID NO:3, it is one section of flexible chain for being rich in glycine for connecting two albumen, amino acid corresponds to codon and is designed as e. coli bl21 (DE3) preferred codons.Linker base sequence is added in the R chains of CAT primers, its primer sequence is：SEQ ID NO: 10 and SEQ ID NO:4.The F chains of SYI primers add linker base sequence, and primer sequence is：SEQ ID NO:11 and SEQ ID NO:12。

2SOE-PCR amplification tandem gene CAT-SYI (see Fig. 1)

(1) touchdown PCR expands CAT and SYI respectively

Due to two pairs of primer Tm differences farther out, therefore touchdown PCR is selected to complete the amplification of two segment DNAs, PCR reactants System is as follows：DNTPmix 4 μ L, 10 × buffer 4 μ L, 50ng/ μ L DNA 1 μ L, 20uM each 0.5 μ of upstream and downstream primer L, the μ L of Pfu polymerase 0.4, adds water to 40 μ L.PCR reaction conditions：95 DEG C of pre-degeneration 3min, 95 DEG C of denaturation 1min, 65 DEG C are annealed 40s, 72 DEG C of extension 1min 40s, expands 19 circulations；95 DEG C of pre-degenerations 1min, 50 DEG C of denaturation 40s, 72 DEG C of extension 1min 40s, 16 circulations are expanded, 72 DEG C extend 5min eventually.Product is detected by 1% agarose gel electrophoresis, and kit is pure Change purpose fragment, the template as next step SOE-PCR.

(2) SOE-PCR expands CAT-SYI

SOE-PCR expands CAT-SYI, PCR reaction systems：4 μ L, CAT and the SYI moulds of μ L, 10 × buffer of dNTPmix 4 Each 0.5 μ L of plate, the μ L of Pfu polymerase 0.4, add water to 40 μ L.PCR reaction conditions：95 DEG C of pre-degenerations 3min, 95 DEG C of denaturation 1min, 65 DEG C of annealing 40s, 72 DEG C of extension 1min 40s, after 5 circulations of amplification terminate, add each 0.5 μ L of 20uM upstream and downstream primers, PCR programs ibid continue 25 circulations of amplification.Purified product is purpose fragment.See Fig. 2.

Three kinds of major surface protein single-gene amplification methods of streptococcus mutans are as follows：

1 design of primers

Streptococcus mutans reference culture UA159 (AE014133.2) genomic DNAs announced on selection GenBank are masterplate Carry out design of primers.The functional areas of target gene are chosen, wherein gtfB includes CAT regions (sucrose hydrolysis catalytic domain) 300bp, its Primer is：SEQ ID NO:4 and SEQ ID NO:5；GbpB is that full length DNA sequence is 1296bp, and its primer is：SEQ ID NO: 6 and SEQ ID NO:7；SpaP includes region (A-region) 1422bp combined with sialoprotein, and its primer is：SEQ ID NO:8 and SEQ ID NO:9.

2PCR expands single-gene

It is as follows by the DNA fragmentation of tri- kinds of genes of standard PCR amplification gtfB, gbpB, spaP, reaction system：dNTPmix 4 μ L, the 50ng/ μ L of μ L, 10 × buffer 4 DNA 1 μ L, 20uM forward and reverse primer each 0.5 μ L, the μ of Pfu polymerase 0.4 L, add water to 40 μ L.PCR reaction conditions：94 DEG C of pre-degeneration 3min, 94 DEG C of denaturation 1min, 52 DEG C of annealing 45s, 72 DEG C extend (gtfB 1.5, min, gbpB 3.0min, spaP 3.5min), 30 circulations are expanded, 72 DEG C extend 5min eventually.Product passes through 1% agarose gel electrophoresis is detected, kits purpose fragment.

The structure of two recombinant plasmids

1 double digestion

Corresponding reactant is added into EP pipes respectively according to following systems, 37 DEG C stand digestion 2.5h.gtfB、spaP、 CAT-SYI digestion systems are as follows：The μ L of CutSmart buffer 2, DNA fragmentation 200ng, EcoR Ι-HF and Xho Ι restriction enzymes Each 0.3 μ L of enzyme, add ddH2O to 30 μ L.Double digestion gbpB systems are as follows：CutSmart buffer 2 μ L, DNA fragmentation 200ng, EcoR Ι-HF and Sal each 0.3 μ L of Ι-HF restriction enzymes, add ddH2O to 30 μ L.This experimental selection pET32a plasmids are as load Body, the resistant gene that pET32a carriers include ampicillin are located at the 4450-5360 bit bases of carrier, plasmid double digestion PET32a vector plasmid systems are as follows：μ L, pET32a 100ng, the EcoR Ι-HF and Sal Ι-HF (Xho of CutSmart buffer 3 Ι) each 0.3 μ L of restriction enzyme, add ddH2O to 50 μ L.After endonuclease reaction, all digestion products are inactivated in 80 DEG C of water-baths 5min, so that restriction endonuclease inactivates, without influenceing coupled reaction below.Nucleic acid electrophoresis detect four kinds of digestion target gene fragments and Digested plasmid concentration, four kinds of digestion products.

2 construction recombination plasmids

By above-mentioned endonuclease bamhi, it is attached according to following systems：Purpose fragment (gtfB, gbpB, spaP, CAT-SYI) The μ L of 2 μ L, T4 ligase of 250ng, pET32a 120ng, buffer 0.5, moisturizing to 30 μ L, linked system are gently mixed with pipette tips Close uniformly, be positioned over 16 DEG C of connections overnight.Recombinant plasmid collection of illustrative plates is shown in Fig. 3.

Three recombinant plasmid transformed competence colibacillus cells

1 conversion T10 competent cells

(1) strain of -80 DEG C of preservations is taken, an activated spawn in super-clean bench, i.e., Escherichia coli TOP10 is inoculated in LB In fluid nutrient medium in shaking table overnight incubation, 37 DEG C of temperature, revolution 220rpm.Take and once activate bacterium solution, by 1:100 volume Than re-activation strain, when between OD600 values=0.3-0.5, stop culture.By bacterium solution and 0.1M CaCl2 while ice bath 30min, 1.0mL bacterium solutions are taken, 5,000rpm centrifugation 3min, supernatant is abandoned, adds 1mL CaCl2 that (must gently blow outstanding) is resuspended, ice 20min is bathed, 5,000rpm centrifugation 3min, abandons supernatant.Add 100 μ L CaCl2 that (more weight is hanged) is resuspended, that is, obtain competent cell, Ice bath 3h is stand-by.Remaining adds final concentration of 30% glycerine, dispenses to 1.5mL centrifuge tubes, standby in -80 DEG C of preservations.

(2) connection product is transferred to TOP10 competent cells

Operated in super-clean bench, take 100mL TOP10 competent cells and be separately added into the above-mentioned μ L of connection product 30, used Liquid-transfering gun gently blows outstanding mixing, and ice bath places 20min, 42 DEG C of heat shock 90s, immediately 3~5min of ice bath.All it is coated on benzyl containing ammonia The LB flat boards of Benzylpenicillin sodium salt.37 DEG C just put 15min, then the 12-16h that puts upside down, observe result.

2 screenings and sequencing

(1) screen：

8~10 single bacterium colonies of picking, expansion are incubated at (ampicillin in the 1.5mL centrifuge tubes containing ampicillin：LB Liquid=1:1,000) 4~6h of culture, is expanded.8000rpm centrifuges 3min, abandons supernatant, adds 1mL aqua sterilisas and thalline is resuspended, 8000rpm centrifuges 3min, abandons supernatant, adds 1.0mL aqua sterilisas and is resuspended, standby as pcr template.PCR system：2×Taq The μ L of PCR Mix 5, bacterium solution 1.0 μ L, 20uM each 0.5 μ L of forward and reverse primer, add water to 20 μ L.PCR reaction conditions：94℃ Pre-degeneration 3min, 94 DEG C of denaturation 1min, 53 DEG C of annealing 45s, 72 DEG C of extension 1.0min, expands 30 circulations, 72 DEG C of extensions eventually 5min.Product is detected using 1% agarose gel electrophoresis.See Fig. 4.

(2) recombinant plasmid extracts：

1. taking bacterium solution 3mL, centrifuge at twice.8,000 × g centrifugations 2min collects thalline.Aspirate medium；

2. adding 250 μ L buffer P1 in bacterial sediment, suction, which is beaten or shaken, extremely arrives thorough suspension thalline；

3. adding 250 μ L buffer P2,5-10 mixing of centrifuge tube is leniently overturned immediately.Room temperature places 2-4min；

4. adding 350 μ L buffer P3,5-10 mixing of centrifuge tube is leniently overturned immediately, is now occurred in centrifuge tube A large amount of white flock precipitates；

5. under centrifuge maximum (top) speed 12,000 × g, 5-10min is centrifuged, supernatant is all moved into adsorption column, 9000 × g centrifuges 30s, outwells the liquid in collecting pipe, adsorption column is put into same collecting pipe；

6. adding 500 μ L wash buffer, 9,000 × g centrifugation 30s into adsorption column, the liquid in collecting pipe is outwelled, Adsorption column is put into same collecting pipe；

7. repeat step is 6. once；

8. suction attached column and collecting pipe be put into centrifuge, 9,000 × g centrifugation 1min, then the 2min that dries in the air of uncapping fill ethanol Divide volatilization；

9. adding 50-100 μ L elution buffer in adsorption column center, 1-2min, 9,000 × g centrifugations are stored at room temperature 1min, by resulting plasmid DNA solution in -20 DEG C of preservations.Elution buffer can be preheated with 37-60 DEG C can be further Improve yield；

By the plasmid of above-mentioned extracting, 2.5 μ L are taken to carry out 1% nucleic acid electrophoresis detection, Labworks image acquisition and analysis software photographs to record.

(3) it is sequenced：Recombinant plasmid is sent Hua Da gene and is sequenced.

2 recombinant plasmid transformed BL21 competent cells

Take 1 μ L to add 50 μ L BL21 competent cells four kinds of recombinant plasmids of extraction, convert TOP10 competent cells, Specific steps are the same as above-mentioned conversion T10 competent cells.

Four IPTG induce the expression of recombinant protein

1 induction

Picking BL21 monoclonal bacterium are inoculated in the LB fluid nutrient mediums containing 5mL, add the final concentration of of ampicillin 50mg/L, it is incubated at constant-temperature table, 37 DEG C of temperature, revolution 200rpm.When bacterium solution OD600 values=0.6, add final concentration of 0.25mM IPTG derivants, temperature are reduced to 30 DEG C, revolution 150rpm, continue to cultivate 6-8h.

2SDS-PAGE is detected

(1) processing of sample and electrophoresis are set

The thalline of 1mL induced expressions is taken in 1.5mL centrifuge tubes, 5,000rpm centrifugation 1min, deionized water is washed 2 times. Add 20 μ L deionized waters and 20 μ L loading buffer, boiling water bath 5min into bacterial sediment, then ice bath 5min, 12,000rpm 2min is centrifuged, takes supernatant to be used for SDS-PAGE electrophoresis detections, electrophoretic procedures are arranged to constant current 18mA, and by albumen marker points Sample terminates electrophoresis to Far Left when bromjophenol blue electrophoresis to separation gel bottom.

(2) dyeing and decolouring of PAGE gel

Gel is carefully peeled away between two glass plates, gel is washed with deionized once, gel is transferred to culture Ware simultaneously adds Coomassie brilliant blue dye liquor, is put into 37 DEG C of shaking table 50rpm dyeing 45min.Dye liquor is reclaimed, and is washed with deionized 2~3 times, add destainer, boiling water bath 10min, during which replaceable destainer, untill observing clearly protein band. See Fig. 5.

The expression-form identification of 3 recombination fusion proteins

Detected respectively in the supernatant precipitation after four kinds of recombinant bacterium carrying out ultrasonic bacteria breaking centrifugations by PAGE gel electrophoresis Protein component, see Fig. 6.GtfB is mainly expressed with soluble form, can take affinitive layer purification mode, GbpB is mainly with bag Contain body form expression recombinant protein, need to carry out repurity after renaturing inclusion bodies processing, and SpaP and CAT-SYI have it is soluble and Two kinds of expression-forms of inclusion body, it is necessary to carry out two kinds of approach of affinity chromatography and renaturing inclusion bodies to purify the albumen respectively.

The purifying of quintet albumen

1 cell cracks

Induced expression bacterium solution is collected into 500mL, 5,000rpm centrifugation 5min, supernatant is abandoned, is washed with deionized 3 times, from The heart is same as above.1 × purifying buffer 30mL are added into bacterial sediment, add 500 μ L lysozymes (concentration 50mg/mL), fully Mix, 4 DEG C of placement 2.5h, during which shaken several times.In -20 DEG C of refrigerator multigelations 4 times, each 30min, 10,000rpm low temperature Centrifuge 10min, carrying out ultrasonic bacteria breaking (it is 2 grades to set power, each ultrasonic 5s, is spaced 10s), until bacterium solution clarify it is not sticky, and will Supernatant and precipitation carry out SDS-PAGE electrophoresis detections respectively, to determine expression of the recombinant protein in e. coli bl21.

The renaturation of 2 inclusion bodys

(1) denaturation of inclusion body, washing inclusion body is resuspended with the PBS 50mL of the urea containing 0.1%Triton and 2M first and sinks Form sediment；10,000rpm low-temperature centrifugation 10min, precipitation, repeated washing 2 times (foreigh protein removings) is resuspended with the PBS 50mL of the urea containing 2M； 10,000rpm low-temperature centrifugation 10min, with the Tris buffer solutions inclusion body of the urea containing 8M, (whether observation liquid becomes viscous It is thick), room-temperature dissolution 20min；10,000rpm low-temperature centrifugation 10min, supernatant is collected, take 10 μ L to be examined for SDS-PAGE electrophoresis Survey,；

(2) preparation of bag filter, by bag filter with 50% ethanol boiling water bath 10min, cleaned with deionized water, finally It will be rinsed 5 times inside bag filter with ultra-pure water, outside is rinsed 3 times, is put into standby in ultra-pure water；

(3) the gradient renaturation of albuminate, i.e., it is saturating the denaturation supernatant of above-mentioned inclusion body to be moved into bag filter progress gradient Renaturation is analysed, initial dialyzate is the Tris buffer solutions of the urea containing 6M, takes out part dialyzate afterwards and adds new Tris and delays Fliud flushing, by such as Gradient 6M (6h~8h), 4M (6h~8h), 2M (6h~8h), 1.5M (4h) carries out gradient renaturation successively.Renaturation Bag filter is transferred in the PBS of 5% glycerine the 4h that dialyses after end, to remove the impurity such as urea, finally in the ultra-pure water of 5% glycerine Middle dialysed overnight, temperature are 4 DEG C.Protein after dialysis is centrifuged into 10min in 10,000rpm, supernatant is collected and is freeze-dried Protein concentrate.

3 affinity chromatography purification of soluble albumen

The pre-treatment of agarose polymeric adsorbent, is comprised the following steps that：

(1) opening cap flows completely out alcohol；

(2) add 8mL aqua sterilisas to be resuspended, 4 DEG C of placement 5min；

(3) precipitated resin (vertical) 5~10min, washing lotion is flowed out, is repeated 3 times and (opens cap up and down)；

(4) 6mL binding buffer are added；

(5) plus 6mL binding buffer, precipitated resin, trickle (open cap up and down)；

(6) (4) are repeated, (5) are common three times.

The concrete operation step of affinity chromatography is as follows：

(1) add 10mL cell pyrolysis liquids in post, resin is resuspended, 4 DEG C of placement 2h, opens cap up and down, collection effluent, treats After liquid flows to end in post, the processing of 10mL cell pyrolysis liquids is added ditto, until adding cell pyrolysis liquid, by the efflux of collection again Cross same root pillar three times；

(2) 8mL wash buffer are added resin is resuspended, 4 DEG C of standings keep flat 5min, open cap and flow to end washing lotion；

(3) repeat step (2) 3~4 times；

(4) 5mL Elution buffer are added in purification column, open cap, collect effluent；

(5) after the effluent for collecting step (4) loads bag filter, dialyse 4h in the PBS of 5% glycerine, finally 5% Dialysed overnight in the ultra-pure water of glycerine.And the protein liquid after dialysis is concentrated by being freeze-dried；

(6) when carrying out step (5), purification column preservation processing is carried out, 0.5M NaOH 8mL is added into post tree is resuspended Fat, 4 DEG C of standings keep flat trickle after 30min, resin are resuspended 3 times with aqua sterilisa, add 25% alcoholic solution, 4 DEG C of preservations.

Four kinds of recombinant proteins after purification are subjected to SDS-PAGE electrophoresis detections, see Fig. 7.Four kinds of restructuring fusions after purification Albumen is rendered as single protein band on PAGE gel, and molecular size range is with expected consistent, and purity is more than 90%.

The preparation and detection of six antibody

The preparation of 1 whole-bacterial-vaccine and immunization laying hen

(1) preparation of streptococcus mutans whole-bacterial-vaccine

Streptococcus mutans (serotype is c types) is pressed 1:1,000 ratio is inoculated in BHI culture mediums, in the micro- need of constant temperature In oxygen case, temperature setting is 37 DEG C and cultivated 2 days, and nutrient solution is transferred into 5,000rpm in sterile centrifugation tube centrifuges 10min.Sterilizing Brine bacterial sediment 3 times, centrifugation is same as above.Add the formaldehyde physiological saline of 25mL 0.4%, 4 DEG C of inactivation 24h.Physiology salt Water washing 3 times, centrifugation is same as above, and dilutes bacterial sediment with PBS, to OD660 value=1.0, as whole-bacterial-vaccine, -20 DEG C of preservations.

(2) whole-bacterial-vaccine immunization laying hen

Whole-bacterial-vaccine (OD660 value=1.0) adds isometric Freund's adjuvant and is well mixed, and is emulsified in shaking table, turns Number 200rpm, 4 DEG C of temperature, emulsifies 4h.One group of whole-bacterial-vaccine group has 3 laying hens, and every chicken is immune 3 times altogether, immunization wayses To choose 3 points of progress intramuscular injection in pigeon breast portion, 30 degree of inclined needle spines enter subcutaneously, then are vaccinated after tilting to 45 degree.It is first It is secondary to be immunized as Freund's complete adjuvant, immunizing dose 1mL, the 2nd week it is immune once, after January booster immunization once, using Freund Freund's incomplete adjuvant, immunizing dose 1mL.Start to collect egg after 3rd time immune one week.

The preparation of 2 recombinant protein vaccines and immunization laying hen

The recombinant protein (CAT, GbpB, SpaP, CAT-SYI) of 4 kinds of purifying is adjusted to suitable concentration with PBS and Freund is helped Agent mixes in equal volume, is emulsified (the same whole-bacterial-vaccine of emulsification condition).4 kinds of every group of recombinant protein vaccines have 3 laying hens, every Chicken is immune 3 times altogether, and first immunisation is Freund's complete adjuvant, and immunizing dose is 500 μ g, and second week is immune once, adds after January It is strong to be immunized once, using incomplete Freund's adjuvant, the μ g of immunizing dose 300.Start to collect egg after 3rd time immune one week.

The extraction of 3 Yolk antibodies

By egg broken shell, egg white is removed, collects all egg yolk liquids, and measure egg yolk liquid volume, add 7 times of bodies of yolk body Product deionized water, adjust pH value=5.0,4 DEG C to stand overnight with watery hydrochloric acid, 10,000rpm low-temperature centrifugation 10min, collect supernatant.To 8.8%NaCl (w/v) is added in supernatant, watery hydrochloric acid adjusts pH value=4.0,4 DEG C to stand 2h, and centrifugation is same as above, and collects precipitation.Add PBS Deng egg yolk liquid volume dissolves, and is transferred in bag filter, is placed in 4 DEG C of refrigerators, dialyse 4h in ultra-pure water, changes per hour once Ultra-pure water.Antibody liquid is freeze-dried, and -20 DEG C save backup.

By four species specificity Yolk antibodies through being denatured buffer processing, SDS-PAGE electrophoresis detections, Fig. 8 is seen.GtfB、 The crude extract of four kinds of Yolk antibodies is consistent with expected result corresponding to tetra- kinds of recombinant proteins of GbpB, SpaP, CAT-SYI.Ovum Yellow antibody is after denaturation buffer processing, weight that the light chain and molecular weight that unwind as 20~25KDa of molecular weight are 60~70KDa Chain.

The ELISA detections of 3 Yolk antibodies

The ELISA detecting steps of four kinds of Yolk antibodies are as follows：

(1) envelope antigen：It is 10 μ g/mL that antigen is diluted into concentration with coating buffer, adds (96 holes in XPS Plate), per the μ L of hole 100,4 DEG C stand overnight；

(2) wash：Liquid in plate hole is use up, cleaning solution is filled it up with hole, it is quiet to put 3min, wash repeatedly three times, finally by plate Tip upside down on blotting paper, light buckle bottom, flow to end liquid in hole；

(3) confining liquid is added：Add 200 μ L confining liquids, 37 DEG C of incubation 1.5h；

(4) washing is same as above；

(5) primary antibody is added：Primary antibody is diluted by certain dilution ratio with antibody diluent, 100 μ L are added per hole.Do the moon simultaneously Property control, 37 DEG C incubation 1.0h；

(6) wash four times；

(7) secondary antibody is added：Antibody diluent is with 1:30,000 dilution enzyme labelled antibodies, per hole 100 μ L, 37 DEG C of incubation 0.5h；

(8) wash four times；

(9) substrate is added：Add the μ L of tmb substrate solution 100, dark place 2~30min of standing (color change is observed therebetween, hence it is evident that When terminate)；

(10) terminate liquid is added：Per the μ L of hole 100；

(11) result is observed：OD450 absorbance is read with ELIASA.

As a result Fig. 9 is seen.By map analysis, with the increase of antibody dilution ratio, OD450 values gradually reduce, when four species specificity Yolk antibody is diluted to maximum multiple 1：When 100,000, experimental group OD450 values>(control group represents 2.1 times of control group OD450 values Compare the ELISA detected values of antigen and four species specificity Yolk antibodies), it is considered as positive findings, the results showed that four species specificity The potency of Yolk antibody is up to 1:More than 100,000.

4 dot hybridizations (Yolk antibody and four kinds of serotype streptococcus mutanses)

Deformed by experiment in vitro dot hybridization (dot-blotting) to detect four kinds of Yolk antibodies and four kinds of serotypes Streptococcic combination effect.Comprise the following steps that, pvdf membrane is cut into suitable size, and be soaked in methanol solution, until film Transparent rear (about 30s) is switched to by milky, then film is turned to steep in PBS solution.The dilution of antigen, with coating buffer (0.05mM Carbonic acid buffer, pH value=9.6) by antigen (the whole-bacterial-vaccine cell of formalin-inactivated, OD660 value=0.60) successively according to 1: 10、1:100、1:500、1:1,000 dilution, and successively by each 2 μ L point samples of antigenic dilution on the pvdf membrane that methanol activates, treat Sampling liquid envelope repeats point sample once after absorbing, and room temperature places 2h.Film is washed four times with cleaning solution, each 5min, in envelope Close in liquid (content is the PBS solution of 5% skimmed milk power), 37 DEG C of placement 2h.Washing is same as above, and it is 0.005mg/mL to be soaked in concentration In primary antibody dilution (content is the PBS solution of 1% skimmed milk power), 4 DEG C are placed overnight.Washing is same as above, and is soaked in 1:3,000 is dilute In the secondary antibody released, room temperature places 1.5h.Washing is same as above, and is added the DAB liquid now prepared, lucifuge colour developing, about 60s, is added deionization Water terminating reaction.

As a result show, CAT-SYI antibody and GbpB antibody and four kinds of serotype antigens, which have, on the whole preferably combines energy Power, and GtfB antibody and SpaP antibody are relative with the binding ability of four kinds of serotype antigens weaker.With respect to tetra- kinds of serum of c, e, f, k Among type, the binding ability of four species specificity Yolk antibodies and K-type streptococcus mutans is most weak, and reason for that is also indefinite.

The caries model animal experiment study of seven Yolk antibodies

The selection and raising of 1 experimental animal

This experiment one shares the female sd inbred rats that 48 ages are 6 week old, and SD rat feedings are in mouse case, and every 2 days more A bedding and padding are changed, SD rats feeding room is toilet, and indoor temperature is arranged to 25 DEG C, natural lighting.The drinking water of SD rats For aqua sterilisa, feed is the high cariogenic feeds of sugar of Diet-2000.

48 SD rats of experiment are randomly divided into 6 groups (GtfB, GbpB, CAT-SYI, SpaP, full bacterium, control), often Group 8.The method being grouped at random is that first SD rats are numbered from 1-48, digital 1-48 labels are then write on 48 paper slips, Pinch agglomerating, be put into carton.8 one group of conducts are randomly selected from carton, are extracted 5 times altogether, remaining 8 one group of conducts.

GtfB groups：Feed anti-GtfB special yolk antibody；

GbpB groups：Feed anti-GbpB special yolk antibody；

CAT-SYI groups：Feed anti-CAT-SYI special yolk antibody；

SpaP groups：Feed anti-SpaP special yolk antibody；

Full bacterium group：Feed the special yolk antibody of anti-whole-bacterial-vaccine；

Control group：The Yolk antibody of the not immune chicken of feeding；

The infection of 2 SD rats

Streptococcus mutans serotype c is inoculated in BHI culture mediums, micro- aerobic culture 48h, and adjust bacterium solution OD600 values= 1.0, the bacterium solution (bacterium solution that fresh cultured is needed per subinfection) as 6 groups of SD rats of infection.1st~5 day, drawn with liquid-transfering gun 100 μ L streptococcus mutans bacterium solutions, are slowly injected into SD rats oral cavity, to increase the time for staying in oral cavity, infection terminates, in 2h Prohibit water, fasting.

The scheme of 3 feeding special yolk antibodies

Experimental group：1st~50 day, feeding respectively was added content and caused for the Diet 2000 of 0.4% special yolk antibody Dental caries feed.51st~104 day, Diet 2000 cariogenic feed of the feeding without Yolk antibody.1st~5 day, added in drinking water Special yolk antibody, final concentration of 100 μ g/mL, the 6-145 days, do not add Yolk antibody in water, drinking water be sterilizing go from Sub- water, put to death SD rats within the 146th day.

Control group：1st~50 day, the 2000 cariogenic feeds of Diet for the control Yolk antibody that feeding content is 0.4%.The 51~104 days, Diet 2000 cariogenic feed of the feeding without Yolk antibody.1st~5 day, addition control yolk resisted in drinking water Body (non-immunized egg), final concentration of 100 μ g/mL, the 6-145 days, Yolk antibody is not added in water, drinking water is sterilizing Deionized water, put to death SD rats within the 146th day.

The processing of 4 carious teeth and Keyes score

(1) pre-treatment of carious tooth：All SD rats are put to death through anesthesia in experiment.To the intraperitoneal injection 1mL of every SD rat, Concentration is 10% chloraldurate sodium-chloride water solution, after SD rats enter anesthetic stage, is breaked end with surgical scissors, and carry out mark Note.SD rats head handles 5min through high-pressure sterilizing pot, removes soft tissue, and cleans up, and leaves and takes mandibular, and will with needle point The swill at dental caries bad position is cleared, and 12h is soaked in ammoniacal liquor weak solution, most after 55 DEG C of oven for drying.Upper lower jaw Tooth is cleaned 3 times, and dry through 0.4% murexide stained over night with deionized water.

(2) the Keyes score of carious tooth：It is symmetrical by SD rat molar rip cuttings using carborundum disk along tooth axis Two parts, observe dental caries damage degree under the microscope, measurement dental caries damage yardstick, and scored according to Keyes point-scores.Specific mark Note refers to Keyes, and rat one shares 12 and ground one's teeth in sleep, and grinding one's teeth in sleep for every has four faces (buccal surface, lingual surface, jaw face nest ditch, proximal surface), and this four The dental caries damage depth in individual face is divided into four grades, respectively E, Ds, Dm, Dx, and the judgment criteria of four grades is as follows：E enamel caries：Dental caries Tooth only involves enamel surfaces；Ds is slight carious dentin：Dental caries damage destructiveness is about enamel to the 1/4 of pulp cavity distance；Dm moderate teeth Essential dental caries：Dental caries damage destructiveness is about 1/4-3/4 of the enamel to pulp cavity distance；The extensive carious dentins of Dx：Dental caries damage destructiveness is about For enamel to pulp cavity distance more than 3/4.(buccal surface, lingual surface, jaw face nest ditch are adjacent in four faces ground one's teeth in sleep respectively to every of rat Face) four grades score above are carried out, and add and count total score, the dental caries damage facing as a rat accumulates scoring value.

Six groups of rats for having infected streptococcus mutans form different degrees of carious tooth, see Figure 10.Visible 8 in control group Rat Mandibular tooth is respectively formed larger cavity.The rat of full bacterium group also forms cavity, but formation cavity is obvious not as good as control group, says Bright whole-bacterial-vaccine can reduce the caries prevalence rate of rat to a certain extent.In each experimental group of GtfB, CAT-SYI, GbpB, SpaP In, this four groups of rats to suffer from dental caries degree lower than control group.Rat carious tooth is scored according to Keyes point systems standard, seen Figure 11, each group score average is as follows, CAT-SYISpaPGbpB GtfBWith full bacteriumThis 5 groups are substantially less than control group(P<0.05), table The bright special yolk antibody for taking full bacterium and recombination fusion protein is respectively provided with effective suppression dental caries effect, also illustrates what is developed herein The special yolk antibody of four kinds of recombinant proteins can reach the suppression dental caries effect of the Yolk antibody of whole-bacterial-vaccine.

Statistical analysis, tandem gene CAT-SYISubstantially less than single-gene GtfB, GbpB, SpaP(P<0.05) special yolk antibody of tandem gene albumen, is shown Anti-caries effect better than single-gene albumen special yolk antibody suppression dental caries effect.

Experiment in vitro indicates CAT-SYI antibody to be had preferably compared with for single virulence gene and the antibody of full bacterium Anti-caries effect.Confirm CAT-SYI antigens can the candidate antigens as genetic engineering vaccine for decayed tooth or the preparation for anticaries agent, CAT-SYI antibody is available for, to reach anti-caries purpose, the present invention is with before good application in the commodity such as toothpaste or in medicine Scape.

Finally illustrate, the above embodiments are merely illustrative of the technical solutions of the present invention and it is unrestricted, although with reference to compared with The present invention is described in detail good embodiment, it will be understood by those within the art that, can be to the skill of the present invention Art scheme is modified or equivalent substitution, and without departing from the objective and scope of technical solution of the present invention, it all should cover at this Among the right of invention.

<110>Sichuan University of Science ＆ Engineering

<120>Streptococcus mutans CAT-SYI antigens and antibody

<160> 12

<170> PatentIn Version 2.1

<210> 1

<211> 100

<212> PRT

<213>Glucosyltransferase B of Streptococcus mutans GtfB functional area CAT amino acid sequence

<400> 1

Leu Met Ala Asn Asp Val Asp Asn Ser Asn Pro Val Val Gln

1 5 10

Ala Glu Gln Leu Asn Trp Leu His Phe Leu Met Asn Phe Gly

15 20 25

Asn Ile Tyr Ala Asn Asp Pro Asp Ala Asn Phe Asp Ser Ile

30 35 40

Arg Val Asp Ala Val Asp Asn Val Asp Ala Asp Leu Leu Gln

45 50 55

Ile Ala Gly Asp Tyr Leu Lys Ala Ala Lys Gly Ile His Lys

60 65 70

Asn Asp Lys Ala Ala Asn Asp His Leu Ser Ile Leu Glu Ala

75 80

Trp Ser Asp Asn Asp Thr Pro Tyr Leu His Asp Asp Gly Asp

85 90 95

Asn Met

100

<210> 2

<211> 132

<212> PRT

<213>Streptococcus mutans glucan-binding protein GbpB functional area SYI amino acid sequence

<400> 2

Leu Ser Ser Ala Thr Thr Leu Ser Ala Val Lys Ala Asp Asp

1 5 10

Phe Asp Ala Gln Ile Ala Ser Gln Asp Ser Lys Ile Asn Asn

15 20 25

Leu Thr Ala Gln Gln Gln Ala Ala Gln Ala Gln Val Asn Thr

30 35 40

Ile Gln Gly Gln Val Ser Ala Leu Gln Thr Gln Gln Ala Glu

45 50 55

Leu Gln Ala Glu Asn Gln Arg Leu Glu Ala Gln Ser Ala Thr

60 65 70

Leu Gly Gln Gln Ile Gln Thr Leu Ser Ser Lys Ile Val Ala

75 80

Arg Asn Glu Ser Leu Lys Gln Gln Ala Arg Ser Ala Gln Lys

85 90 95

Ser Asn Ala Ala Thr Ser Tyr Ile Asn Ala Ile Ile Asn Ser

100 105 110

Lys Ser Val Ser Asp Ala Ile Asn Arg Val Ser Ala Ile Arg

115 120 125

Glu Val Val Ser Ala Asn

130

<210> 3

<211> 15

<212> PRT

<213>Artificial sequence

<220>

<223>One section of flexible chain for being rich in glycine of two albumen is connected, for connecting CAT and SYI.

<400> 3

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

1 5 10

Ser

15

<210> 4

<211> 28

<212> DNA

<213>Engineer's primer

<400> 4

CCGGAATTCCTTATGGCTAACGATGTGG 28

<210> 5

<211> 29

<212> DNA

<213>Engineer's primer

<400> 5

CCGCTCGAGCATATTGTCGCCATCATCAT 29

<210> 6

<211> 29

<212> DNA

<213>Engineer's primer

<400> 6

CCGGAATTCATGAAAAAAAGAATTTTATC 29

<210> 7

<211> 29

<212> DNA

<213>Engineer's primer

<400> 7

CCGGTCGACTTAGTTTGGATAGATATAGC 29

<210> 8

<211> 29

<212> DNA

<213>Engineer's primer

<400> 8

CCGGAATTCGATGAAACGACCACTACTAG 29

<210> 9

<211> 29

<212> DNA

<213>Engineer's primer

<400> 9

CCGCTCGAGATCATAGACCAAATTTTGAG 29

<210> 10

<211> 70

<212> DNA

<213>Engineer's primer

<400> 10

GCTACCACCACCGCTACCACCACCACCGCTACCACCACCACCCATATTGTCGCCATCATC 70

GGTGGTGGTG

<210> 11

<211> 50

<212> DNA

<213>Engineer's primer

<400> 11

GTAGCGGTGGTGGTGGTAGCGGTGGTGGTAGCCTTAGTTCTGCGACAACA 50

<210> 12

<211> 27

<212> DNA

<213>Engineer's primer

<400> 12

CCGCTCGAGATTAGCAGATACAACTTC 27

Claims (9)

1.CAT-SYI antigens, it is characterised in that the CAT-SYI antigens are formed by connecting by two amino acid fragments, amino acid sequence Row are respectively：SEQ ID NO:1, SEQ ID NO:2.

2. antigen according to claim 1, it is characterised in that the linker amino acid sequences of described two amino acid fragments For：SEQ ID NO:3.

3. the antibody prepared as the antigen described in claim 1.

4. the preparation method of the antigen described in claim 1, it is characterised in that comprise the following steps：

1. design primer：Streptococcus mutans reference culture UA159 (AE014133.2) genome announced on selection GenBank DNA is masterplate, designs the primer in CAT regions and SYI regions, adds linker base sequence in the R chains of CAT primers, SYI draws The F chains of thing add linker base sequence；

2. SOE-PCR amplification tandem genes CAT-SYI：Touchdown PCR expands CAT and SYI respectively, is used as in next step after product purification SOE-PCR template.SOE-PCR expands to obtain tandem gene, and purified product is purpose fragment；

3. construction recombination plasmid：Double digestion purpose fragment and plasmid vector, digestion products connection obtain recombinant plasmid；

4. recombinant plasmid transformed competence colibacillus cell simultaneously screens；

7. IPTG induces expression of recombinant proteins and detected；

8. purification of recombinant proteins, obtain CAT-SIY antigens.

5. the preparation method of the antibody described in claim 3, it is characterised in that comprise the following steps：

1. Prepare restructuring protein vaccine is simultaneously immunized；

2. extract specific antibody.

6. the CAT-SYI antigens described in claim 1 are in the purposes for preparing the medicine for treating carious tooth.

7. the CAT-SIY antibody described in claim 3 is in the purposes for preparing the medicine for treating carious tooth.

8. the recombinant plasmid in preparation process described in claim 4 is in the purposes for preparing the medicine for treating carious tooth.

9. a kind of medicine for being used to treat carious tooth, it is characterised in that the medicine is the antibody and imparting described in claim 3 The carrier of its pharmacy.