CN107488646B

CN107488646B - Lipase mutant TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val and gene and application thereof

Info

Publication number: CN107488646B
Application number: CN201610408280.9A
Authority: CN
Inventors: 李阳源; 周银华; 王建荣; 李天碧; 刘丹妮
Original assignee: Yiduoli Biological Science & Tech Co Ltd Guangdong
Current assignee: Yiduoli Biological Science & Tech Co Ltd Guangdong
Priority date: 2016-06-10
Filing date: 2016-06-10
Publication date: 2019-12-10
Anticipated expiration: 2036-06-10
Also published as: CN107488646A

Abstract

The invention relates to the field of genetic engineering, in particular to a lipase TTL mutant TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val with improved thermal stability, and a gene and application thereof. The amino acid sequence is shown in SEQ ID NO.4, the residual enzyme activity of the mutant TTL-Gly60Glu after being subjected to water bath at 80 ℃ for 5min is 31.2 percent, and the residual enzyme activity is improved to 1.70 times of that of the parent lipase.

Description

Lipase mutant TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val and gene and application thereof

Technical Field

The invention relates to the field of genetic engineering, in particular to a lipase mutant TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val, and a gene and application thereof.

Background

Lipase (EC 3.1.1.3) is known as triacylglycerol hydrolase, belongs to the alpha/beta-sheet enzyme family, and is a serine hydrolase. The lipase can not only catalyze the hydrolysis of natural substrate grease on an oil-water interface and release glyceride or glycerol with less ester bonds and fatty acid, but also catalyze reactions such as acidolysis, transesterification, ester synthesis and the like in a non-aqueous phase system. The lipase for industrial feed is mainly derived from microorganisms, and the lipase secreted by the microorganisms has a wide action pH value and action temperature. With the continuous popularization of enzyme catalysis technology, the application conditions of enzyme preparations are more and more strict, such as high temperature, strong acid and strong alkali and other special conditions. Lipases are widely used as an important enzyme species in the fields of food processing, feed, washing, medicine, and the like. The processes of oil and fat processing and feed granulation are generally performed at relatively high temperatures, and lipases with poor thermostability are subject to denaturation in the above processes, so that the development of lipases with high thermostability has been the object of academic and industrial efforts.

In order to obtain a better enzyme preparation, on one hand, a proper enzyme gene can be screened from the nature, and on the other hand, the existing industrialized enzyme protein is modified through a molecular biology technology so as to adapt to the requirements of different industries. The two major strategies for modifying enzyme protein are currently available, one of which is irrational design, and the enzyme protein which better meets the action condition is selected according to the specific modification purpose by modifying the gene of the enzyme through random mutation. The strategy has the advantages that the structure and the action mechanism of the enzyme do not need to be deeply researched, but the screening is completed by extremely large workload, and the efficiency is low.

A scientist is reported in documents to separate a thermophilic eupodium strain from a volcanic region in south of Tony, the secreted lipase of the thermophilic eupodium strain has better heat resistance, and 50 percent of enzyme activity is remained after 1 hour of treatment at 70 ℃. Pichia pastoris has simple culture conditions, is easy for industrial production, efficiently secretes and expresses exogenous proteins, and successfully expresses a plurality of exogenous lipases. The invention utilizes pichia pastoris to efficiently secrete and express the lipase from the gymnosperm thermophilum, and obtains the lipase mutant with obviously improved thermal stability by using the gymnosperm thermophilum lipase as a template and through a site-directed mutagenesis technology.

Disclosure of Invention

The invention aims to provide a lipase TTL mutant with improved thermal stability, namely TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val

It is still another object of the present invention to provide a gene encoding the above mutant.

The invention further aims to provide application of a lipase TTL mutant TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62 Val. The high thermal stability lipase TTL is a lipase mutant obtained by performing site-specific mutagenesis on parent lipase TTL. The expression vectors for expressing the lipase mutants are pPICZ alpha A and pPIC 9K; the host cells used for transformation of the expression vector are pichia pastoris X33 and GS 115. The lipase mutant is as follows: gly60 Glu.

The nucleotide sequence of the wild lipase is shown in SEQ ID No. 1.

TCTCCAGTCAGACGTGAGGTTTCTCAGGACTTGTTCGACCAGTTTAATTTGTTCGCTCAGTACTCTGCTGCTGCCTACTGTGCCAAGAATAACGATGCCCCAGCTGGTGCTAACGTTACCTGTAGAGGTTCCATCTGCCCAGAGGTTGAGAAGGCTGACGCCACCTTCTTGTACTCTTTCGAGGACTCTGGAGTTGGTGACGTTACCGGTTTCTTGGCTTTGGACAACACCAACAGATTGATCGTCTTGTCTTTCCGTGGTTCCCGTTCCCTTGAGAATTGGATCGGTAACATTAATTTGGATTTGAAGGGTATCGACGACATCTGCTCTGGTTGCAAGGGACACGATGGTTTCACCTCCTCTTGGAGATCCGTTGCCAACACCTTGACCCAACAGGTTCAGAACGCCGTTAGAGAGCATCCAGACTACCGTGTCGTCTTCACTGGTCACTCTTTGGGTGGTGCTTTGGCTACCGTTGCTGGTGCCTCTTTGAGAGGTAACGGTTACGACATCGACGTTTTCTCCTACGGTGCTCCTCGTGTTGGTAACAGAGCCTTCGCTGTCTTCTTGACCGCTCAGACCGGTGGTACCTTGTACAGAATCACCCATACCAACGATATCGTCCCACGTTTGCCACCAAGAGAGCTTGGATACTCCCACTCTTCCCCAGAGTACTGGATCACCTCCGGTACTTTGGTTCCAGTTACCAAGAACGATATTGTTAAGGTTGAGGGAATTGACTCCACCGACGGTAACAACCAGCCAAATACCCCAGACATTGCTGCCCACTTGTGGTACTTCGGTTTGATTGGTACTTGTTTGTAA

The amino acid sequence of the wild lipase is shown in SEQ ID No. 2.

SPVRREVSQDLFDQFNLFAQYSAAAYCAKNNDAPAGANVTCRGSICPEVEKADATFLYSFEDSGVGDVTGFLALDNTNRLIVLSFRGSRSLENWIGNINLDLKGIDDICSGCKGHDGFTSSWRSVANTLTQQVQNAVREHPDYRVVFTGHSLGGALATVAGASLRGNGYDIDVFSYGAPRVGNRAFAEFLTAQTGGTLYRITHTNDIVPRLPPRELGYSHSSPEYWITSGTLVPVTKNDIVKVEGIDSTDGNNQPNTPDIAAHLWYFGLIGTCL

The nucleotide sequence of the mutant is shown as SEQ ID No. 3.

TCTCCAGTCAGACGTGAGGTTTCTCAGGACTTGTTCGACCAGTTTAATTTGTTCGCTCAGTACTCTGCTGCTGCCTACTGTGCCAAGAATAACGATGCCCCAGCTGGTGCTAACGTTACCTGTTCTGAAAATGTTTGCCCAGAGGTTGAGAAGGCTGACGCCACCTTCTTGTACTCTTTCGAGGACTCTGGAGTTGGTGACGTTACCGGTTTCTTGGCTTTGGACAACACCAACAGATTGATCGTCTTGTCTTTCCGTGGTTCCCGTTCCCTTGAGAATTGGATCGGTAACATTAATTTGGATTTGAAGGGTATCGACGACATCTGCTCTGGTTGCAAGGGACACGATGGTTTCACCTCCTCTTGGAGATCCGTTGCCAACACCTTGACCCAACAGGTTCAGAACGCCGTTAGAGAGCATCCAGACTACCGTGTCGTCTTCACTGGTCACTCTTTGGGTGGTGCTTTGGCTACCGTTGCTGGTGCCTCTTTGAGAGGTAACGGTTACGACATCGACGTTTTCTCCTACGGTGCTCCTCGTGTTGGTAACAGAGCCTTCGCTGTCTTCTTGACCGCTCAGACCGGTGGTACCTTGTACAGAATCACCCATACCAACGATATCGTCCCACGTTTGCCACCAAGAGAGCTTGGATACTCCCACTCTTCCCCAGAGTACTGGATCACCTCCGGTACTTTGGTTCCAGTTACCAAGAACGATATTGTTAAGGTTGAGGGAATTGACTCCACCGACGGTAACAACCAGCCAAATACCCCAGACATTGCTGCCCACTTGTGGTACTTCGGTTTGATTGGTACTTGTTTGTAA

The amino acid sequence of the mutant is shown in SEQ ID No. 4.

SPVRREVSQDLFDQFNLFAQYSAAAYCAKNNDAPAGANVTCSENVCPEVEKADATFLYSFEDSGVGDVTGFLALDNTNRLIVLSFRGSRSLENWIGNINLDLKGIDDICSGCKGHDGFTSSWRSVANTLTQQVQNAVREHPDYRVVFTGHSLGGALATVAGASLRGNGYDIDVFSYGAPRVGNRAFAEFLTAQTGGTLYRITHTNDIVPRLPPRELGYSHSSPEYWITSGTLVPVTKNDIVKVEGIDSTDGNNQPNTPDIAAHLWYFGLIGTCL

The residual enzyme activity of the parent lipase is 18.3 percent after being soaked in water at the temperature of TTL80 ℃ for 5 min. The invention utilizes molecular biology technology to perform site-specific mutagenesis on lipase TTL to obtain a lipase mutant TTL-Gly60Glu with improved thermal stability. After the mutant TTL-Gly60Glu is subjected to water bath at 80 ℃ for 5min, the residual enzyme activity is 31.2 percent, and is improved to 1.70 times of that of the parent lipase.

Drawings

FIG. 1 shows fermentation diagram of Pichia pastoris X33 recombinant strain 50L tank containing pPICz alpha A-TTL.

FIG. 2 protein electrophoresis of enzyme solutions at various time periods of fermentation.

FIG. 3 is a diagram showing the enzymatic properties of lipase TTL.

FIG. 4 is a diagram showing the enzymatic properties of the lipase mutant TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62 Val.

Detailed Description

The molecular biology experiments, which are not specifically described in the following examples, were performed according to the specific methods listed in molecular cloning, a laboratory manual (third edition) j. sambrook, or according to the kit and product instructions; the reagents and biomaterials, if not specifically indicated, are commercially available.

Experimental materials and reagents:

1. Bacterial strains and vectors

Coli strain Topl0, Pichia pastoris X33, GS115, vector pPICz. alpha.A, Ppic9K, Zeocin were purchased from Invitrogen.

2. Enzyme and kit

PCR enzyme, restriction enzyme, plasmid extraction and gel purification kits were purchased from Shanghai Biotech.

Example 1 high expression of Lipase TTL in Pichia pastoris X33

1. Lipase gene TTL is used as a target gene, the full length of 825 bases (SEQ ID No.1) of a wild lipase gene and 274 amino acids (SEQ ID No.2) deduced from the wild lipase gene are subjected to enzyme digestion by restriction enzymes EcoRI and XbaI, an expression vector pPICz alpha A-TTL is constructed in a pPICz alpha A vector to obtain an expression vector pPICz alpha A-TTL, the pPICz alpha A-TTL is converted into a Top 10 competent cell, and the positive clone is obtained after screening by an antibiotic Zeocin. And linearizing the recombinant expression vector by SacI, and performing electric shock transformation on the linearized recombinant vector to obtain a pichia pastoris recombinant strain transformant. And (3) performing high-density fermentation culture on the recombinant bacterium single bacterial strain. The enzyme activity is measured by timing sampling in the fermentation process, the expression condition of the lipase is shown in figure 1, and the enzyme activity of the lipase is 31500U/mL at 189h of fermentation. The lipase in the fermentation liquor is subjected to fractional precipitation by ammonium sulfate, full dialysis and purification by ion exchange column chromatography, and the purified protein liquid is subjected to 12% SDS-PAGE detection, and the result is shown in figure 2. 2. The lipase activity is determined by adopting an olive oil emulsion hydrolytic titration method, and the definition of the enzyme activity is as follows: the lipase amount consumed by hydrolyzing olive oil emulsion to generate 1 mu mol/min of fatty acid under the conditions of 40 ℃ and pH7.0 is 1 lipase activity unit. The lipase heat treatment adopts a water bath method, enzyme liquid is properly diluted and then placed in a glass test tube, and the temperature is kept for 5min in water bath pots (70-90 ℃) with different temperatures.

Example 2 determination of enzymatic Properties of Lipase TTL

1. Determination of optimum reaction temperature and thermal stability of Lipase TTL

Respectively measuring the activity of lipase at 30-80 deg.C and 10 deg.C intervals, and measuring the relative activity at different temperatures by using the activity at 50 deg.C as reference. As a result, as shown in FIG. 3(a), the optimum temperature for the action of lipase was 50 ℃. And (3) placing the lipase liquid in a glass test tube, carrying out heat treatment for 5min at different temperatures (70-90 ℃), measuring the residual lipase activity, and comparing the enzyme activity after heat treatment with the untreated enzyme activity as a reference to obtain the residual relative enzyme activity at the temperature. The results are shown in FIG. 3(b), and the lipase residual activity after heat treatment at 80 ℃ for 5min was 18.3%.

2. Determination of optimum reaction pH and pH stability of Lipase TTL

And respectively measuring the enzyme activity of the lipase in buffer solution systems with different pH values (3.0-9.0), and calculating the relative enzyme activity under different pH values by taking the enzyme activity with the pH value of 7.0 as a reference. As a result, as shown in FIG. 3(c), the optimum pH for the action of lipase was 7.0. And respectively adding diluted enzyme solution into the buffer solution systems with different pH values, processing for 2h at room temperature, measuring the activity of residual lipase, and calculating the residual relative enzyme activity at the pH value by taking the untreated enzyme activity as a reference. As shown in FIG. 3(d), the enzyme has a wide pH stability range and is stable in enzyme activity within a pH range of 5.0 to 9.0.

Example 3 Lipase mutant with improved thermostability TTL-Gly60Glu

1. And (3) carrying out PCR amplification by taking the plasmid pPICZ alpha A-TTL as a template and respectively taking the primers F1 and PIC-R and the primers R1 and PIC-F, and then carrying out fusion PCR on the obtained 2 DNA fragments to obtain the recombinant vector pPICZ alpha A-TTL-R59SG60ES61NI 60V. And (3) transforming the recombinant vector into a Top 10 competent cell, and screening by an antibiotic Zeocin to obtain a positive clone. And linearizing the recombinant expression vector by SacI, and performing electric shock transformation on the linearized recombinant vector to obtain a pichia pastoris recombinant strain transformant. The total length of the mutated lipase gene is 825 basic groups (shown as a nucleotide sequence SEQ ID NO. 3), and 274 amino acids (shown as an amino acid sequence SEQ ID NO. 4) are deduced from the basic groups. The primers used were as follows:

F1:5’-CTGTTCTGAAAATGTTTGCCCAGAGGTT-3’

R1:5’-CTCTGGGCAAACATTTTCAGAACAGGTAAC-3’

PIC-F：5’-CTTGCTTGAGAAGGTTTTGGGACGC-3’

PIC-R：5’-CTTGGAGCGAACGACCTACACCGAA-3’

2. Determination of optimum reaction temperature and thermal stability of recombinant Lipase

Respectively measuring the activity of lipase at 30-80 deg.C and 10 deg.C intervals, and measuring the relative activity at different temperatures by using the activity at 50 deg.C as reference. As a result, as shown in FIG. 4(a), the optimum temperature for the action of lipase was 50 ℃. And (3) carrying out heat treatment on the lipase liquid at different temperatures (70-90 ℃) for 5min, measuring the activity of residual lipase, and calculating to obtain the residual relative enzyme activity at the temperature by taking the untreated enzyme activity as a reference. The results are shown in FIG. 4(b), and the lipase residual activity after heat treatment at 80 ℃ for 5min was 31.2%.

3. Determination of optimum reaction pH and pH stability of recombinant Lipase

And respectively measuring the enzyme activity of the lipase in buffer solution systems with different pH values (3.0-9.0), and measuring the relative enzyme activity under different pH values by taking the enzyme activity with the pH value of 7.0 as a reference. The results are shown in FIG. 4 (c): the optimum pH for the action of the lipase was 7.0. And respectively adding diluted enzyme liquid into the buffer solution systems with different pH values, processing for 2 hours at room temperature, measuring the activity of residual lipase, and comparing the enzyme activity of the processed enzyme liquid with that of the unprocessed enzyme liquid by taking the untreated enzyme activity as a reference to obtain the residual relative enzyme activity under the pH value. As shown in FIG. 4(d), the enzyme had a wide pH stability range and was stable in enzyme activity within a pH range of 5.0 to 9.0.

Claims

1. The lipase TTL mutant with improved thermal stability is TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val, and is characterized in that the amino acid sequence of the lipase TTL mutant is TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val is shown in SEQ ID No. 4.

2. A gene encoding the thermal stability-improved lipase TTL mutant according to claim 1, which is TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62 Val.

3. The TTL mutant gene according to claim 2, wherein the nucleotide sequence is represented by SEQ ID No. 3.

4. The use of the TTL mutant of a lipase with improved thermostability, as claimed in claim 1, TTL-Arg59Ser/Gly60Glu/Ser61Asn/Ile62Val for hydrolyzing oil or fat in vitro.

5. Use of the TTL mutant gene for lipase with increased thermostability according to claim 2 in food processing, feed processing or detergent preparation.