CN107475409A - A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity - Google Patents
A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity Download PDFInfo
- Publication number
- CN107475409A CN107475409A CN201710846139.1A CN201710846139A CN107475409A CN 107475409 A CN107475409 A CN 107475409A CN 201710846139 A CN201710846139 A CN 201710846139A CN 107475409 A CN107475409 A CN 107475409A
- Authority
- CN
- China
- Prior art keywords
- sample
- nucleic acid
- fluid sample
- detecting sensitivity
- pretreating method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity, belong to nucleic acid detection technique field, its first liquid taking sample, the organic molecule reagent and inorganic salts of various combination are added into sample, enrichment processing is carried out to the nucleic acid in sample, then carries out magnetic bead nucleic acid extraction.The sample pretreating method can effectively be enriched with trace dna present in detection sample, so as to lift the sensitivity of detection, reduce the probability of occurrence of false negative.
Description
Technical field
The invention belongs to nucleic acid detection technique field, more particularly to one kind can improve fluid sample nucleic acid detecting sensitivity
Sample pretreating method.
Background technology
Detection of nucleic acids uses widely in clinical and scientific research, and a core technology portion in accurate medical treatment at present
Point.In reality, many nucleic acids in samples contents are very limited, if detection sensitivity is inadequate, it is easy to false negative (leakage occur
Examine), high detection sensitivity is extremely important.And the important ring for improving detection sensitivity is sample nucleic extraction, if in sample
Nucleic acid is fully enriched with, and the nucleic acid amount of extraction substantially increases, and the sensitivity of the sample detection just improves.Pillar nucleic acid in the past
Extraction is common method.What application was wider at present is magnetic bead nucleic acid extraction method, and in general paramagnetic particle method is than pillar nucleic acid extraction
Method nucleic acid yield is substantially high, but is at most also simply higher by several times.More numbers are may differ by without associated nucleic acid content in same sample
Magnitude.Therefore, paramagnetic particle method still has the problem of sensitivity, can still fail to pinpoint a disease in diagnosis.Particularly medically newest tumour liquid is lived
Inspection technology and the detection of blood body fluid pathogen nucleic acid, environment and the detection of food associated nucleic acid, due to corresponding to nucleic acid content in sample
May be extremely low, high-sensitivity detection, which just seems, to be highly desirable.
The content of the invention
The present invention provides a kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity, its first liquid taking
Sample, the organic molecule reagent and inorganic salts of various combination are added into sample, enrichment processing is carried out to the nucleic acid in sample, then
Carry out magnetic bead nucleic acid extraction.The sample pretreating method can effectively be enriched with trace dna present in detection sample, so as to be lifted
The sensitivity of detection, reduce the probability of occurrence of false negative.
The present invention is achieved the goal by technical scheme in detailed below：
A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity, it comprises the following steps：
Step S10 extracts nucleic acid：Fluid sample is taken, vector nucleic acid is added into sample, is mixed, then TRIZol examinations are added to it
Agent, whirlpool mix 1min, are centrifuged under the conditions of 4 DEG C, supernatant is taken after centrifugation；
Step S20 precipitate nucleic acids：Organic molecular agents and inorganic salts are added in the aqueous phase supernatant obtained to step S10, are often added
Entering a kind of reagent, concussion is mixed once, and sample is carried out low-temperature treatment by organic molecule reagent and inorganic salts after adding, then
Centrifuged under the conditions of 4 DEG C, taking precipitate after centrifugation；Described organic molecule reagent be one kind in glycogen, gelatin and ethanol or
Multiple combinations；Described inorganic salts reagent is one or two kinds of in sodium chloride or sodium acetate；
Precipitation is resuspended in step S30：The sediment obtained without step S10 and step S20 sample to step S20 is taken to carry out
Again suspend；
Step S40 extracts nucleic acid：Nucleic acid in sample is extracted using conventional paramagnetic particle method.
Wherein, low-temperature treatment is that sample is placed in minus 80 DEG C of environment to handle in described step S20 precipitate nucleic acids
10min-12h。
Wherein, the volume of the fluid sample used in described step S10 extractions nucleic acid is 0.5-10.0 ml；Made
The final concentration of 0.5-5.0ng/ul of vector nucleic acid.
Wherein, the final concentration of the organic molecule reagent used in described step S20 precipitate nucleic acids is as follows：Glycogen
0.05-1.0ug/ul, gelatin 0.01-0.5%, ethanol 40-75%；The final concentration of used inorganic salts reagent is as follows：Chlorination
Sodium 1-5M, sodium acetate 1-5M.
A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity is improving fluid sample detection of nucleic acids
Application in the detection kit or detection platform of sensitivity.
The device have the advantages that：Organic molecule, such as vector nucleic acid, glycogen, gelatin, ethanol, and inorganic salts, such as chlorine
Change sodium and sodium acetate, can be with the nucleic acid in precipitating liquid sample, trace dna present in enriched sample；General nucleic acid extraction examination
Fixed extraction 0.2-0.5ml sample of agent box, the present invention are enriched with Related Nucleic Acid Molecules from large volume fluid sample, finally made
Sample nucleic extracted amount or sample nucleic detection sensitivity improve more than 3-10 times than not handling sample.
Embodiment
With reference to specific embodiment, the invention will be further described.
Step S10 extracts nucleic acid：Patient's 1ml fresh serum is taken, is put into new 2.0ml EP pipes, 30ul is added to the pipe
Vector nucleic acid, final concentration of 2ng/ul, after whirlpool mixes, then 1ml TRIZol reagents are added into it, fully acutely whirlpool mixes
Even 1min, it is careful to take out aqueous phase supernatant with 12000rpm centrifugation 5min under the conditions of 4 DEG C；
Step S20 precipitate nucleic acids：100ul 1% gelatin, 50ul 20mg/ is sequentially added in the supernatant obtained to step S10
Ml glycogen, 125ul 2M NaCl and 1ml precooling absolute ethyl alcohols, a kind of reagent is often added, concussion mixes once, mentioned reagent
After the completion of addition, sample is placed in -80 DEG C of refrigerators and handles 30min, then with 12000rpm centrifugation under the conditions of 4 DEG C
5min, taking precipitate after centrifugation；
Precipitation is resuspended in step S30：Take what 0.2ml was obtained without step S10 and step S20 blood serum sample to step S20
Sediment is suspended again, then is carried out violent whirlpool and mixed 1min；
Step S40 extracts nucleic acid：Nucleic acid in sample is extracted using conventional paramagnetic particle method.
Sample by method provided by the invention processing and the sample without method provided by the invention processing are carried out
Expand pathogen target gene fragment, the reagent such as following table of use：
The PCR amplifing reagents species of table 1 and use scale
Sense primer：TGGACTTCTCTCAATTTTCT
Anti-sense primer：TGACAGACTTTCCAATCAAT
Control group sets as follows：
A) positive control：To have detected the sample DNA of the positive as template；
B) negative control is 1.：Without template, substituted with water；
C) negative control is 2.：Primer free, substituted with water.
The amplification condition of use such as following table：
The PCR amplification condition tables of table 2
The sample P CR products progress electrophoresis detection completed will be expanded, takes 10 μ l PCR primers, add 100bp DNA Marker,
Use 1.5% agarose gel electrophoresis, voltage 130V, electrophoresis time 30 minutes.
As a result it is do not carry out pretreated group band more than 10 times to show pretreated group amplified band density.QPCR is to two
The final nucleic acid extractive specific objective gene quantification analysis of group also confirms that its specific objective gene quantification differs more than 10 times.
Embodiment described above only expresses one embodiment of the present invention, and its description is more specific and detailed, but simultaneously
Therefore the limitation to the scope of the claims of the present invention can not be interpreted as.It should be pointed out that for one of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the guarantor of the present invention
Protect scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Claims (5)
1. a kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity, it is characterised in that it includes following step
Suddenly：
Step S10 extracts nucleic acid：Fluid sample is taken, vector nucleic acid is added into sample, is mixed, then TRIZol examinations are added to it
Agent, whirlpool mix 1min, are centrifuged under the conditions of 4 DEG C, supernatant is taken after centrifugation；
Step S20 precipitate nucleic acids：Organic molecular agents and inorganic salts are added in the aqueous phase supernatant obtained to step S10, are often added
Entering a kind of reagent, concussion is mixed once, and sample is carried out low-temperature treatment by organic molecule reagent and inorganic salts after adding, then
Centrifuged under the conditions of 4 DEG C, taking precipitate after centrifugation；Described organic molecule reagent be one kind in glycogen, gelatin and ethanol or
Multiple combinations；Described inorganic salts reagent is one or two kinds of in sodium chloride or sodium acetate；
Precipitation is resuspended in step S30：The sediment obtained without step S10 and step S20 sample to step S20 is taken to carry out
Again suspend；
Step S40 extracts nucleic acid：Nucleic acid in sample is extracted using conventional paramagnetic particle method.
2. a kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity according to claim 1, it is special
Sign is that low-temperature treatment is that sample is placed in minus 80 DEG C of environment to handle 10min-12h in described step S20 precipitate nucleic acids.
3. a kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity according to claim 1, it is special
Sign is that the volume of the fluid sample used in described step S10 extraction nucleic acid is 0.5-10.0 ml；Used load
The final concentration of 0.5-5.0 ng/ul of body nucleic acid.
4. a kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity according to claim 1, it is special
Sign is that the final concentration of the organic molecule reagent used in described step S20 precipitate nucleic acids is as follows：Glycogen 0.05-1.0
Ug/ul, gelatin 0.01-0.5%, ethanol 40-75%；The final concentration of used inorganic salts reagent is as follows：Sodium chloride 1-5 M,
Sodium acetate 1-5 M.
5. a kind of sample pretreating method of raising fluid sample nucleic acid detecting sensitivity as described in claim 1-4 is any exists
Improve the application in the detection kit or detection platform of fluid sample nucleic acid detecting sensitivity.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710846139.1A CN107475409A (en) | 2017-09-19 | 2017-09-19 | A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710846139.1A CN107475409A (en) | 2017-09-19 | 2017-09-19 | A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107475409A true CN107475409A (en) | 2017-12-15 |
Family
ID=60585463
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710846139.1A Pending CN107475409A (en) | 2017-09-19 | 2017-09-19 | A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107475409A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5928872A (en) * | 1997-05-12 | 1999-07-27 | Lin; Shi-Lung | Subtractive hybridization with covalently binding homology |
| CN101864414A (en) * | 2010-07-12 | 2010-10-20 | 大连海洋大学 | Extraction method of apostichopus japonicus body-wall total RNA |
| CN102229925A (en) * | 2011-05-13 | 2011-11-02 | 薛昱 | Enhanced magnetic-bead-based nucleic acid extraction method |
-
2017
- 2017-09-19 CN CN201710846139.1A patent/CN107475409A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5928872A (en) * | 1997-05-12 | 1999-07-27 | Lin; Shi-Lung | Subtractive hybridization with covalently binding homology |
| CN101864414A (en) * | 2010-07-12 | 2010-10-20 | 大连海洋大学 | Extraction method of apostichopus japonicus body-wall total RNA |
| CN102229925A (en) * | 2011-05-13 | 2011-11-02 | 薛昱 | Enhanced magnetic-bead-based nucleic acid extraction method |
Non-Patent Citations (2)
| Title |
|---|
| MARIA BEATRIZ MONTEIRO等: "Optimization of total RNA isolation from human urinary sediment", 《CLINICA CHIMICA ACTA》 * |
| 杜祥等: "《恶性肿瘤生物样本库标准操作流程》", 30 September 2016, 复旦大学出版社 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chryssanthou et al. | Detection of Candida albicans DNA in serum by polymerase chain reaction | |
| Williamson et al. | Diagnosis of invasive aspergillosis in bone marrow transplant recipients by polymerase chain reaction | |
| CN105695631B (en) | Human immunodeficiency virus, hepatitis type B virus, Hepatitis C Virus Quick joint inspection kit and its preparation and application | |
| CN105734044A (en) | Rinsing liquid for nucleic acid extraction purification | |
| Matheson et al. | Molecular confirmation of Schistosoma and family relationship in two ancient Egyptian mummies | |
| CN104181297B (en) | A kind of ELISA kit detecting sheep Pseudorabies virus antibody | |
| CN105524986B (en) | A kind of LAMP detection method of quick detection Asia candidatus liberobacter asiaticum | |
| CN110964842B (en) | Sample processing reagent for detecting mycobacterium tuberculosis nucleic acid, kit and mycobacterium tuberculosis nucleic acid amplification method | |
| CN103710464B (en) | HCV (Hepatitis c virus) genotype detection kit | |
| Xu et al. | Different loci and mRNA copy number of the increased serum survival gene of Escherichia coli | |
| Çetiner et al. | Performance comparison of new generation HCV core antigen test versus HCV RNA test in management of hepatitis C virus infection | |
| CN107475409A (en) | A kind of sample pretreating method for improving fluid sample nucleic acid detecting sensitivity | |
| CN102337356B (en) | Swine getah virus reverse transcription-polymerase chain reaction (RT-PCR) detection kit and application thereof | |
| CN108841819B (en) | For extracting the kit and method of dissociative DNA | |
| CN109771410A (en) | Alkannic acid is preparing the purposes in anti-hepatic-B virus medicine | |
| Badrawy et al. | Anti-HBc and HBV-DNA detection in blood donors negative for hepatitis B virus surface antigen | |
| CN105463131A (en) | Human bocavirus LAMP (loop-mediated isothermal amplification) detection kit | |
| CN107574263A (en) | A kind of kit and method for the type of PCR quick detections pig circular ring virus 3 | |
| CN101760518A (en) | Method for extracting live bacteria RNA in Mycobacterium tuberculosis and detection kit thereof | |
| CN108203738A (en) | A kind of kit for being used to detect 1 type of human T-cell lymphotropic virus | |
| CN112195176B (en) | Method for separating and purifying nucleic acid solid from biological material | |
| Chen et al. | Development of polyclonal antibodies-based serological methods for detection of the Rehmannia mosaic virus in field plants | |
| CN103937907B (en) | Plasmodium falci parum nano magnetic separation real-time fluorescence quantitative PCR (polymerase chain reaction) detection kit and nucleotide sequence | |
| CN105986040A (en) | Kit for HCV virus genotyping detection and SNP locus detection of IL28B, use method and application thereof | |
| Gu et al. | Intelligent diagnostic system for Cryptococcus: Switch-controllable nanocatcher and CNN-based artificial intelligence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171215 |