CN107475393B - Method for detecting peanut allergen by using locked nucleic acid molecular beacon and application - Google Patents

Abstract

The invention belongs to the technical field of molecular biology, and discloses a method for detecting peanut allergen by using a locked nucleic acid molecular beacon and application thereof, wherein the method comprises three main steps of DNA extraction, digital PCR and result analysis, wherein the sequence of an upstream primer is shown as SEQ ID NO.1, and the sequence of a downstream primer is shown as SEQ ID NO. 2; the sequence of the probe is shown in SEQ ID NO. 3. Compared with other common peanut allergen detection methods, the detection method provided by the invention can ensure that the sensitivity and specificity of detection are not changed after the peanuts are processed into mature foods, has the characteristic of low detection limit, can be used for making a corresponding positive result aiming at samples as low as 1 ng/mu g (or 1 ng/mu l) in a DNA sample, and has the detection result accuracy reaching 100%.

Description

Method for detecting peanut allergen by using locked nucleic acid molecular beacon and application

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a method for detecting peanut allergen by using a locked nucleic acid molecular beacon and application thereof.

Background

Locked Nucleic Acid (LNA), as a novel nucleic acid derivative, has the advantages of high affinity, good thermal stability, strong enzyme cutting resistance, no toxicity in vivo and the like, and can be synthesized by a solid phase method like a common DNA primer, so that the LNA is widely applied to multiple fields of antisense therapy, Single Nucleotide Polymorphism (SNP) detection and the like.

Digital PCR is a breakthrough quantitative analysis technique for nucleic acid, and has attracted attention and rapidly developed in recent years. The technology is that a nucleic acid template is diluted, a sample is divided into dozens to tens of thousands of parts, then the parts are distributed into a large number of independent reaction units, only one template molecule in each reaction unit is subjected to PCR amplification reaction, and after the amplification is finished, the fluorescence signal in each reaction chamber is subjected to statistical analysis to quantify the DNA copy number. The digital PCR technology has the following advantages compared with quantitative PCR (qPCR) technology: (1) the sensitivity is high. The dPCR essentially changes a traditional PCR reaction into tens of thousands of PCR reactions, target sequences in the tens of thousands of reaction units are respectively and independently detected, and the detection sensitivity is greatly improved. (2) The accuracy is high. In the dPCR, the target sequence difference with extremely small variation can be accurately detected by calculating the proportion and the number of positive reaction units in tens of thousands of reaction units. (3) The tolerance is high. In the first reaction system distribution process of the dPCR technology, PCR reaction inhibitors and background sequences can be uniformly distributed to each reaction unit, but target sequences do not exist in most reaction units, and are relatively enriched in some reaction units, so that the interference of the inhibitors and the background sequences in the reaction units on the reaction is remarkably reduced. In addition, dPCR does not depend on Ct value, and only judges positive/negative two states when the result of each reaction unit is judged, the influence of amplification efficiency on the two states is greatly reduced, and the tolerance capability on inhibitors and background sequences is also greatly improved. (4) Absolute quantification. PCR can directly calculate the copy number of a target sequence, and accurate absolute quantitative detection can be carried out without depending on a standard curve and a Ct value.

Food safety is a global concern, and food allergy is one of the research directions for food safety. Food allergy refers to that some proteins in food enter human body and are used as invasion pathogens by the immune system in the body to generate immune reaction, which causes adverse effects on human body, and the proteins in food, which correspond to specific people to generate immune reaction or anaphylactic reaction, are food allergens. Peanut is one of the important plant protein sources of human beings at present, and can be used as the raw and auxiliary materials of various foods. With the globalization of food consumption and circulation, the sensitization of peanuts has become an important food safety problem and is widely concerned by various countries. Food allergy slightly affects daily life of people, and is possibly life-threatening seriously, but no effective treatment means exists for food allergy at present, and food allergy can be avoided only by prevention, so that the development of a detection technology of food allergen is very important, and the development of a rapid and effective method for detecting allergen is an effective means for reducing the generation of allergen reaction of consumers.

In the prior art, enzyme-linked immunosorbent assay (ELISA) adopts monoclonal or polyclonal antibody technology to detect allergen, is one of the most common methods for peanut allergen, and appears in the 70 th 20 th century at the earliest, and has the advantages of high specificity, strong sensitivity, simplicity, rapidness and no need of expensive instruments and equipment. In general, the detection limit of ELISA is between 0.1 and 1 mg/kg. At present, the detection method for peanut allergen includes double antibody sandwich ELISA and competitive ELISA. The double-antibody sandwich detection food has the peanut content of 0.2-1.2mg/kg, the recovery rate of 86-127 percent and the time of 30min, and can quickly detect peanut allergens. The ELISA method has high sensitivity, strong specificity, rapidness and low cost, so the ELISA method is widely applied to allergen detection, is particularly suitable for detecting a small amount of allergens in food, but has limitation, and the detected protein can be changed in the food processing process to cause the appearance of false negative of the ELISA method. Therefore, for the ELISA method, scholars need to further consider the change of allergen property during the food processing process to overcome the adverse effect on the detection result.

Blotting refers to a method in which a sample is transferred to a solid support and then detected by a corresponding probe reaction. The blotting method for peanut protein detection mainly includes dot blotting and immunoblotting, and usually combines the two methods, and makes them implement joint detection and mutual identification. The method adopts polyacrylamide gel electrophoresis, namely SDS-PAGE, wherein a detected object is protein, a probe is an antibody, a labeled secondary antibody is used for developing color, the protein to be detected is separated by SDS-PAGE electrophoresis by a blotting method, and is transferred to a solid phase carrier, the protein or polypeptide on the solid phase carrier is used as an antigen, and is subjected to immunoreaction with a corresponding antibody, and then is subjected to reaction with a second antibody labeled by enzyme or isotope, and the protein component expressed by a specific target gene separated by electrophoresis is detected by substrate color development or autoradiography. Respectively using dot blot and immunoblotting methods to semi-quantitatively and quantitatively detect commercially available peanut allergens and perform comparative analysis, using the dot blot to estimate the amount of peanut protein, using the immunoblotting to further determine specific peanut protein, wherein the reaction intensity of the raw peanut is 3-4 times that of the roasted peanut when the dot blot is used for detecting the raw peanut and the roasted peanut. The method has the advantages that: high resolution, strong specificity and high sensitivity. However, the steps are complicated, the detection time is long, specific primary antibodies and specific secondary antibodies are needed, and the cost is high.

In conclusion, the prior art has the technical problems that the false negative of the ELISA method occurs because the detected protein may be changed in the food processing process; the blotting method has the disadvantages of complicated steps, long detection time, special primary antibody and specific secondary antibody, and high cost. Therefore, it is necessary to establish a method for rapidly detecting peanut allergens with high sensitivity and good specificity.

Disclosure of Invention

The method for detecting the peanut allergen by using the locked nucleic acid molecular beacon and the application thereof provided by the invention have the advantages of high sensitivity, good specificity and capability of quickly detecting the peanut allergen.

The first object of the invention is to provide a method for detecting peanut allergen by using locked nucleic acid molecular beacons, which comprises the following steps:

s1, DNA extraction of sample to be tested

S2, digital PCR

The reaction system added on the chip of the digital PCR is as follows: 1 uL template DNA, 1 uL upstream primer, 1 uL downstream primer, 1 uL probe, 10 uL 2 XTAQA Master Mix, ddH₂Supplementing O to 20 μ L, and mixing;

wherein, the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2; the sequence of the probe is shown as SEQ ID NO. 3;

s3, analysis of results

If the positive result of the digital PCR is a blue positive hole of the fluorescent probe signal detected on the chip, the sample to be detected contains peanut allergen.

Preferably, in the method for detecting peanut allergens by using the locked nucleic acid molecular beacon, the concentration of the upstream primer and the concentration of the downstream primer are both 500nmol/L, and the concentration of the probe is 200 nmol/L.

Preferably, in the method for detecting peanut allergens by using the locked nucleic acid molecular beacon, the amplification procedure of the digital PCR is pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 1min, and 40 cycles; the droplets were cured at 98 ℃ for 10 min.

The second purpose of the invention is to provide the application of the method for detecting the peanut allergen by using the locked nucleic acid molecular beacon in the detection of the peanut allergen Arah 1.

Compared with the prior art, the invention provides a method for detecting peanut allergen by using locked nucleic acid molecular beacons and application thereof, and the method has the following beneficial effects:

compared with other common peanut allergen detection methods, the detection method provided by the invention can ensure that the sensitivity and specificity of detection are not changed after the peanuts are processed into mature foods, has the characteristic of low detection limit, can be used for making a corresponding positive result aiming at samples as low as 1 ng/mu g (or 1 ng/mu l) in a DNA sample, and has the detection result accuracy reaching 100%. The accuracy (the recovery rate is 86-127%) is obviously improved compared with that of an ELISA method, and the deep-processed peanut product can be detected, and the required material is only 5-10 mg; compared with the blotting method, the method has the advantages that the number of operation steps is obviously reduced, a plurality of samples can be detected within 2h, the time consumption is short, and specific primary antibodies and secondary antibodies are not needed.

In addition, the digital PCR used in the present invention is a recent quantitative technique, and nucleic acid quantification by counting based on a single-molecule PCR method is an absolute quantitative method. The method mainly adopts a micro-fluidic or micro-droplet method in the current analytical chemistry hot research field to disperse a large amount of diluted nucleic acid solution into micro-reactors or micro-droplets of a chip, wherein the number of nucleic acid templates in each reactor is less than or equal to 1. Thus, after PCR cycling, a reactor with a nucleic acid molecule template will give a fluorescent signal, and a reactor without a template will have no fluorescent signal. Based on the relative proportions and the volume of the reactor, the nucleic acid concentration of the original solution can be deduced. The method is an absolute quantitative detection means, and is not available in other common methods such as ELISA and blotting.

Drawings

FIG. 1 shows the positive results of the digital PCR chip;

FIG. 2 is a fluorescence distribution diagram of a positive result of digital PCR;

FIG. 3 shows the negative control results of the digital PCR chip;

FIG. 4 is a fluorescence distribution diagram of a chip negative control for digital PCR.

Detailed Description

The invention is described in detail below with reference to the figures and the specific embodiments, but the invention should not be construed as being limited thereto. The experimental methods in the following examples are conventional methods unless otherwise specified, and materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The invention provides a method for detecting peanut allergen by using a locked nucleic acid molecular beacon, which comprises three main steps of DNA extraction, digital PCR and result analysis, and specifically comprises the following steps:

s1, DNA extraction of sample to be tested

In the experiment, an Ezup column type plant genome DNA extraction kit is used for extracting DNA in 3 peanut samples (raw peanuts, cooked peanuts and peanut biscuits), and the specific experimental method is as follows:

(1) before DNA extraction, the water bath is required to be adjusted to 65 ℃, so that time can be saved in experiments better;

(2) checking the reagents in the kit, adjusting the reagents according to requirements after the reagents are confirmed to be correct, preparing 24ml of isopropanol and 45ml of absolute ethyl alcohol, and mixing the isopropanol and the absolute ethyl alcohol with PW Solution and Washing Solution respectively for later use;

(3) cleaning a mortar, cutting 60-120mg of peanut samples (raw peanuts, cooked peanuts and peanut biscuits) respectively by using a knife, grinding by using the mortar until the peanut samples become powder, adding 600 mu l of Buffer PCB after confirming that no larger particles exist, transferring the mixture into a clean 1.5ml centrifuge tube, wherein the Buffer PCB is mainly used for cracking plant tissues and providing a good environment for DNA extraction;

(4) turning the centrifuge tube 4-5 times to achieve the effect of mixing thoroughly, placing into 65 deg.C water bath for 25min, and shaking uniformly once in about 5min during heating process to heat more thoroughly;

(5) adding chloroform with the same volume as the mixture, wherein the volume is about 600 mu l, turning for 4-5 times to achieve the effect of fully and uniformly mixing, setting the rotating speed on a high-speed refrigerated centrifuge to be 12000rpm for 5min, and observing that the solution has two layers of coagulates and two layers of solutions after the centrifugation is finished, wherein the middle precipitate is denatured protein, sucking the upper clear liquid into a clean centrifuge tube with 1.5ml, and particularly paying attention to the fact that the middle denatured protein part cannot be sucked when the supernatant is extracted;

(6) adding a Buffer BD with the same volume as the collected supernatant, wherein the Buffer BD can effectively increase the binding activity of the adsorption column to nucleic acid. Turning for 4-5 times to mix thoroughly, adding anhydrous ethanol with the same volume as the collected supernatant, turning for 4-5 times to mix thoroughly, transferring the mixed liquid to an adsorption column, standing for 2min, centrifuging at 10000rpm for 1min, discarding the waste liquid in the collection tube after centrifugation, and paying attention to the fact that the waste liquid needs to be poured out as clean as possible to avoid pollution to the centrifuge;

(7) adding 500 μ l PW Solution, placing the adsorption column back into the collection tube, performing centrifugation at 10000rpm for 1min, and discarding the waste liquid in the collection tube;

(8) adding 500 μ l Washing Solution, performing centrifugation at 10000rpm for 1min, and discarding the waste liquid in the collecting pipe;

(9) centrifuging the adsorption column again at 12000rpm for 2min, taking out the adsorption column, discarding waste liquid, standing for 2min to volatilize residual ethanol as much as possible;

(10) taking out the adsorption column from the collecting tube, putting the adsorption column into a clean centrifugal tube, adding 50 mu l of TE Buffer, wherein the TE Buffer can effectively wash off other impurities except the nucleic acid in the elution column, improving the extraction rate of the DNA, standing for 3min to ensure that the solution is completely immersed into the adsorption column, centrifuging for 2min at 12000rpm, and completely covering when the cover of the adsorption column needs to be checked during centrifugation;

(11) discarding the adsorption column after the centrifugation is finished, obtaining target DNA in a centrifugal tube, and performing DNA extraction on each sample for four times to obtain 12 DNA samples for subsequent experiments;

(12) and detecting the concentration and purity of the extracted DNA sample by using an ultramicro spectrophotometer, and storing the qualified sample in a refrigerator at 4 ℃ for later use. And (3) repeating the steps (1) to (11) to extract the unqualified sample until a qualified sample is obtained.

(13) General PCR validation

Arah1 in peanut allergen protein is most likely to cause anaphylaxis, so the target DNA primer is selected from Arah1 fragment to determine whether the target sample contains peanut allergen.

Logging in a national bioinformatics center of America, using a gene database to inquire the gene sequence of Arah1, then using BLAST to compare, selecting a proper segment, using Primer design software to design a Primer suitable for amplification. The primer and probe sequences are shown in Table 1, and the information of the fragments to be amplified is shown in Table 2. The reaction system of the general PCR is shown in Table 3, wherein the sequences of the forward primer and the reverse primer are shown in Table 1, and the reaction conditions of the general PCR are shown in Table 4. And after ordinary PCR, carrying out 2% agarose electrophoresis and 100V electrophoresis for 1h to detect and recover PCR products, if a 125bp band can be observed in the agarose electrophoresis, indicating that the gene fragment corresponding to the peanut allergen Arah1 in the sample is a qualified product, and using the sample template DNA for carrying out digital PCR.

TABLE 1 primer and Probe sequences

The underlined nucleotides of the probe sequences in Table 1 are locked nucleic acid modified nucleotides.

TABLE 2 fragments to be amplified

The nucleotide sequence of the fragment to be amplified is shown as SEQ ID NO.4 and is:

5’-AGACTGGAGACAACCAAGAGAAGATTGGAGGCGACC

AAATAAGGCCCGAAGGAAGAGAAGGAGAACAAGAGTGGGGAACACCAGGTAGCCAT GTGAGGGAAGAAA-3’。

wherein, underlined sequence in SEQ ID NO.4 is a primer binding region, and sequence within the rectangular frame is a probe binding region.

TABLE 3 general PCR reaction System

TABLE 4 conventional PCR reaction amplification procedure

S2, digital PCR

The digital PCR reaction system is shown in Table 5, wherein the sequences of the upstream primer, the downstream primer and the probe are shown in Table 1, the concentrations of the upstream primer and the downstream primer are both 500nmol/L, and the concentration of the probe is 200 nmol/L. The amplification program of the digital PCR is pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 1min, and 40 cycles; the droplets were cured at 98 ℃ for 10 min.

TABLE 5 digital PCR reaction System

The digital PCR instrument (QuantStaudio) of applied biosystems of America is adopted^TM3D) Digital PCR was performed, as follows:

(1) preparing a DNA template, diluting the DNA sample extracted in S1 above: diluting the raw peanut sample by 30 times to obtain a sample with the concentration of 6.8 ng/mu l, and then diluting by 5 times to obtain a sample with the final concentration of about 1.36 ng/mu l, wherein the sample is numbered 1A; diluting the cooked peanut sample by 10 times to obtain a sample with the concentration of 11.47 ng/mu l, and then diluting by 10 times to obtain a sample with the final concentration of 1.147 ng/mu l, wherein the sample is numbered 1B; firstly diluting the peanut biscuit by 10 times to obtain a sample with the concentration of 5.26 ng/mu l, and then diluting the peanut biscuit by 5 times to obtain a sample with the final concentration of 1.052 ng/mu l, wherein the number is 1C;

(2) preparing a silicon chip required by digital PCR, loading the sample by using an automatic chip loading system, placing the sample on a loading system base, fixing a scraping blade on a mechanical arm of the loading system, placing a chip cover, adding the sample to the digital PCR loading scraping blade by using a liquid-moving gun, and starting the system. The reaction system added to the digital PCR chip is shown in Table 5.

S3, analysis of results

And taking out the sealed chip, putting the chip on a thermal cycler with double parallel plate modules, amplifying the chip, obtaining a result through a fluorescence signal, and analyzing the result.

If the positive result of the digital PCR is a blue positive pore of a fluorescent probe signal detected on the chip, the result is shown in figure 1, the sample to be detected contains peanut allergen Arah1, figure 2 is the fluorescence distribution of the positive result, wherein the yellow fluorescent pores are distributed below the sample to be detected, and the blue fluorescent pores are distributed above the sample to be detected; as shown in FIG. 3, FIG. 4 is the fluorescence distribution of the negative control, and only yellow fluorescence holes are distributed.

The detection method disclosed by the invention is used for detecting the allergen Arah1 in 100 raw peanut samples, 100 cooked peanut samples and 100 peanut biscuit (peanut biscuits made by taking peanuts as main additives) samples respectively, and the results show that compared with other common peanut allergen detection methods, the detection method disclosed by the invention can be used for detecting the allergen Arah1 without changing the sensitivity and specificity of detection after the peanuts are processed into cooked foods and has the characteristic of low detection limit, and corresponding positive results can be obtained for samples as low as 1 ng/mu g (or 1 ng/mu l) in a DNA sample, and the accuracy of the detection results reaches 100%. The accuracy is obviously improved compared with the ELISA method (the recovery rate is 86-127%); compared with the blotting method, the method has the advantages of obviously reduced operation steps, short time consumption and no need of specific primary antibody and secondary antibody.

It should be noted that the preferred embodiments of the present invention have been described for the purpose of preventing redundancy, but that additional variations and modifications to these embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<120> method for detecting peanut allergen by using locked nucleic acid molecular beacon and application

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> Artificial sequence

<400>1

agactggaga caaccaagag aag 23

<210>2

<211>22

<212>DNA

<213> Artificial sequence

<400>2

tttcttccct cacatggcta cc 22

<210>3

<211>20

<212>DNA

<213> Artificial sequence

<400>3

aagtcatcag cagccacgga 20

<210>4

<211>125

<212>DNA

<213> peanut

<400>4

agactggaga caaccaagag aagattggag gcgaccaagt catcagcagc cacggaaaat 60

aaggcccgaa ggaagagaag gagaacaaga gtggggaaca ccaggtagcc atgtgaggga 120

agaaa 125

Claims (2)

1. A method for detecting peanut allergens by using a locked nucleic acid molecular beacon is characterized by comprising the following steps:

s1, DNA extraction of sample to be tested

S2, digital PCR

The reaction system added on the chip of the digital PCR is as follows: 1 muL template DNA, 1 muL upstream primer, 1 muL downstream primer, 0.5 muL probe, 10 muL 2 XTaq Master Mix, ddH₂Supplementing and mixing the mixture by 20 mu L of O; the concentration of the upstream primer and the concentration of the downstream primer are both 500nmol/L, and the concentration of the probe is 200 nmol/L;

the amplification program of the digital PCR is pre-denaturation at 95 ℃ for 10 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 1min, and 40 cycles; curing the microdroplets for 10min at 98 ℃;

wherein, the sequence of the upstream primer is shown as SEQ ID NO.1, and the sequence of the downstream primer is shown as SEQ ID NO. 2; the sequence of the probe is shown as SEQ ID NO. 3;

s3, analysis of results

If the positive result of the digital PCR is a blue positive hole of the fluorescent probe signal detected on the chip, the sample to be detected contains peanut allergen.

2. The method for detecting peanut allergen by using locked nucleic acid molecular beacons according to claim 1, wherein the method is applied to detection of peanut allergen Arah 1.

Images