CN107475388B

CN107475388B - Application of nasopharyngeal carcinoma related miRNA as biomarker and nasopharyngeal carcinoma detection kit

Info

Publication number: CN107475388B
Application number: CN201710724979.0A
Authority: CN
Inventors: 李炯; 何箫梦; 刘林泉; 丁浩
Original assignee: SHENZHEN EMPEROR ELECTRONIC TECHNOLOGY CO LTD
Current assignee: SHENZHEN EMPEROR ELECTRONIC TECHNOLOGY CO LTD
Priority date: 2017-08-22
Filing date: 2017-08-22
Publication date: 2020-05-19
Anticipated expiration: 2037-08-22
Also published as: CN107475388A

Abstract

The invention discloses an application of nasopharyngeal carcinoma related miRNA as a biomarker and a nasopharyngeal carcinoma detection kit. The expression levels of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are high and low, and have close correlation with nasopharyngeal carcinoma, so that the expression levels can be used as a nasopharyngeal carcinoma biomarker to be applied to preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device. The nasopharyngeal carcinoma detection reagent developed based on the biomarker can be applied to early detection of nasopharyngeal carcinoma, and has high detection sensitivity and high specificity.

Description

Application of nasopharyngeal carcinoma related miRNA as biomarker and nasopharyngeal carcinoma detection kit

Technical Field

The invention relates to the technical field of biological detection, in particular to application of a nasopharyngeal carcinoma related miRNA as a biomarker and a nasopharyngeal carcinoma detection kit.

Background

Nasopharyngeal carcinoma (NPC) refers to a malignant tumor that occurs in the top and lateral walls of the nasopharyngeal cavity, with the incidence of the first malignancy of the ear, nose and throat. The world health organization surveys and reports that 80% of nasopharyngeal carcinoma patients are in China all over the world. The incidence of nasopharyngeal carcinoma is higher in south China, such as Guangdong, Guangxi and Hunan provinces. Because nasopharyngeal carcinoma is insidious and has a strong tendency to metastasize, approximately 75% of patients reach advanced stages with regional lymph node and/or distant metastasis. Generally, comprehensive treatment mainly based on radiotherapy is very effective on early nasopharyngeal carcinoma, and recurrence or metastasis after treatment is extremely poor in prognosis, so that the treatment failure and the survival rate reduction of the nasopharyngeal carcinoma are main reasons. Therefore, screening tumor markers of nasopharyngeal carcinoma strives for early detection, reasonable treatment, prognosis prediction and recurrence monitoring, and has great significance for clinical diagnosis and treatment of nasopharyngeal carcinoma.

It has been found that the onset of nasopharyngeal carcinoma is closely related to Epstein-Barr Virus (EBV) infection, genetic factors, and environmental factors. In view of correlation between nasopharyngeal carcinoma and EBV infection, the existing peripheral blood markers of nasopharyngeal carcinoma are mainly designed around EB virus, such as EB virus capsid antigen antibody VCA-IgA, early antibody EA-IgA and EBV-DNA, but the sensitivity and specificity are not high, the EBV positive rate in nasopharyngeal carcinoma patients is only about 60%, more false positives and false negatives exist, and the clinical requirement is far from being met. Human Leukocyte Antigen (HLA) is considered as the genetic factor most significantly related to the onset of nasopharyngeal carcinoma, and the correlation between HLA and nasopharyngeal carcinoma is detected in the research of nasopharyngeal carcinoma candidate genes and the research of whole genome correlation, but the HLA cannot be applied to clinic at present due to the limitations of technology, cost and the like. The screening of other nasopharyngeal carcinoma related proteins and coding gene markers thereof is stopped at the experimental theoretical stage, and no practical specific nasopharyngeal carcinoma marker exists at present.

With the progress of research, researchers find that non-coding genes are closely related to the occurrence and development of tumors besides tumor-related proteins and coding genes thereof. In particular to a highly conserved non-coding single-stranded small-molecule RNA (microRNA, miRNA), which is usually matched and complementarily combined with the 3' end of the target gene mRNA completely or partially to cause the target mRNA to degrade or inhibit the translation of the target mRNA so as to regulate the expression of the target gene. miRNA plays a role in regulating and controlling the expression of important functional genes in various physiological processes including development, proliferation, differentiation apoptosis, stress response and the like. The research finds that the miRNA with abnormal expression is detected in almost all tumor tissues, and more researches prove that the miRNA is almost involved in each step of tumorigenesis and development and plays an important role beyond imagination in the tumor pathogenesis. The specific miRNA can reflect the tissue source of the tumor, carry out molecular typing on the tumor, can be used for predicting prognosis and judging treatment sensitivity, and even directly participate in the treatment of the tumor. If abnormal expression miRNA in nasopharyngeal carcinoma can be screened out as a biomarker and a corresponding auxiliary diagnosis kit is developed, the early diagnosis, the prediction and the treatment, the recurrence monitoring and the like of nasopharyngeal carcinoma in China can be powerfully promoted, and the method has important clinical application value.

However, since the research of nasopharyngeal carcinoma mirnas began later, the research of circulating mirnas was more rarely reported. The detection reagent developed based on the traditional nasopharyngeal carcinoma marker has the following defects: the early detection of nasopharyngeal carcinoma is difficult, a large amount of biomarkers need to be detected simultaneously to obtain preliminary judgment, and the detection sensitivity and specificity are low.

Disclosure of Invention

Based on this, there is a need for a nasopharyngeal carcinoma detection kit which can be used for early detection and has higher sensitivity and higher specificity in detection.

In addition, the application of the nasopharyngeal carcinoma related miRNA as a biomarker is also provided.

At least one of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 is used as a biomarker for preparing a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

In one embodiment, the nasopharyngeal carcinoma is early nasopharyngeal carcinoma.

In one embodiment, the biomarker is derived from blood.

A nasopharyngeal carcinoma detection kit comprising a detector specifically bound to a biomarker selected from at least one of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198.

In one embodiment, the detector that specifically binds to a biomarker comprises a primer capable of amplifying the biomarker or a probe capable of detecting the biomarker.

In one embodiment, the detector that specifically binds to the biomarker comprises a biomarker PCR amplification forward primer and a biomarker PCR amplification reverse primer;

the biomarker PCR amplification forward primer comprises at least one of a first forward primer, a second forward primer and a third forward primer, wherein the first forward primer is designed for cDNA obtained after the reverse transcription of hsa-miR-1909-3p, the second forward primer is designed for cDNA obtained after the reverse transcription of hsa-miR-3135a, and the third forward primer is designed for cDNA obtained after the reverse transcription of hsa-miR-198.

In one embodiment, the base sequence of the first forward primer is shown as SEQ ID No. 1; and/or the presence of a catalyst in the reaction mixture,

the base sequence of the second forward primer is shown as SEQ ID No. 2; and/or the presence of a catalyst in the reaction mixture,

the base sequence of the third forward primer is shown as SEQ ID No. 3; and/or the presence of a catalyst in the reaction mixture,

the biomarker PCR amplification reverse primer is a universal reverse amplification primer, and the base sequence of the biomarker PCR amplification reverse primer is shown as SEQ ID No. 4.

in one embodiment, the kit further comprises a reagent capable of detecting an internal reference gene, wherein the internal reference gene is selected from at least one of U6, GAPDH and β -actin.

In one embodiment, the kit further comprises an RNA extraction reagent, a tailing reagent and an RNA reverse transcription reagent;

the RNA extraction reagent is used for extracting RNA in a sample to be detected;

the A tail adding reagent is used for adding A base at one end of the extracted RNA;

the RNA reverse transcription reagent is used for reverse transcribing the RNA added with the A tail into cDNA.

In one embodiment, the RNA reverse transcription reagent comprises an RNA reverse transcription primer, and the base sequence of the RNA reverse transcription primer is shown as SEQ ID No. 5.

Hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 belong to miRNAs. The inventor carries out a great deal of research and study on the aspect of biomarkers of nasopharyngeal carcinoma and unexpectedly discovers that the expression levels of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 in patients with nasopharyngeal carcinoma and healthy people are remarkably different. The expression levels of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are high and low, and have close correlation with nasopharyngeal carcinoma, so that the expression levels can be used as a nasopharyngeal carcinoma biomarker to be applied to preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device. The nasopharyngeal carcinoma detection reagent developed based on the biomarker can be applied to early detection of nasopharyngeal carcinoma, only at least one miRNA of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 needs to be detected, and the detection reagent is simple and convenient to operate, small in workload, high in detection sensitivity and high in specificity.

Drawings

FIG. 1 is a graph showing the plasma expression level of the biomarker hsa-miR-1909-3p in patients with nasopharyngeal carcinoma and healthy persons in one test;

FIG. 2 is a graph showing the plasma expression level of the biomarker hsa-miR-3135a in nasopharyngeal carcinoma patients and healthy persons in one test;

FIG. 3 is a graph showing the plasma expression level of the biomarker hsa-miR-198 in nasopharyngeal carcinoma patients and healthy persons in one test;

FIG. 4 is a ROC graph showing the sensitivity and specificity of detection using the nasopharyngeal carcinoma detection kit of example 1 to distinguish between healthy persons and nasopharyngeal carcinoma patients;

FIG. 5 is a ROC plot showing the sensitivity and specificity of detection using the nasopharyngeal carcinoma detection kit of example 2 to distinguish between healthy persons and nasopharyngeal carcinoma patients;

FIG. 6 is a ROC plot showing the sensitivity and specificity of detection using the nasopharyngeal carcinoma detection kit of example 3 to distinguish between healthy and nasopharyngeal carcinoma patients;

FIG. 7 is a ROC graph showing the sensitivity and specificity of detection using the nasopharyngeal carcinoma detection kit of example 4 to distinguish between healthy persons and nasopharyngeal carcinoma patients.

Detailed Description

The invention is further explained below mainly with reference to the drawings and the embodiments.

In one embodiment, at least one of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 is used as a biomarker in preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

In particular, biomarkers refer to biochemical markers that can mark changes or changes that may occur in the structure or function of systems, organs, tissues and cells.

Specifically, hsa-miR-1909-3p is one of human-derived miR-1909 family members, and is derived from the 3' end of hsa-miR-1909. At present, few reports about hsa-miR-1909-3p exist, and the research unexpectedly discovers that the expression quantity of hsa-miR-1909-3p in nasopharyngeal carcinoma patients and healthy people has a significant difference. The experimental result shows that the expression quantity of hsa-miR-1909-3p is reduced by 7.25 times compared with that of a healthy person. Therefore, the hsa-miR-1909-3p can be used as a biomarker for detecting nasopharyngeal carcinoma, and a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device is developed and formed based on the hsa-miR-1909-3p as a biomarker.

Specifically, hsa-miR-3135a is one of miR-3135a family members of human origin. The current report on hsa-miR-3135a is mainly related to myocardial infarction diseases. The study unexpectedly found that the expression level of hsa-miR-3135a in nasopharyngeal carcinoma patients and healthy people has significant difference. The experimental result shows that the expression quantity of hsa-miR-3135a is reduced by 4.32 times compared with that of a healthy person. Therefore, hsa-miR-3135a can be used as a biomarker for detecting nasopharyngeal carcinoma, and hsa-miR-3135a is used as a biomarker to develop and form a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

Specifically, hsa-miR-198 is one of the human-derived miR-198 family members. Few reports about miR-198 exist at present. The study unexpectedly found that the expression level of hsa-miR-198 in nasopharyngeal carcinoma patients and healthy people has significant difference. The experimental result shows that the expression quantity of hsa-miR-198 is reduced by 2.46 times compared with that of a healthy person. Therefore, hsa-miR-198 can be used as a biomarker for detecting nasopharyngeal carcinoma, and a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device is developed and formed based on hsa-miR-198 as a biomarker.

Three miRNAs, namely hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198, can be detected in patients with early nasopharyngeal carcinoma, and the expression level of the three miRNAs is different from that of healthy people. Therefore, hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 can be used as detection biomarkers of early nasopharyngeal carcinoma, and can be used for early diagnosis, treatment prediction or recurrence monitoring of nasopharyngeal carcinoma.

Furthermore, hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 can stably exist in various body fluids such as serum and plasma, and belong to circulating miRNA. The miRNA in blood circulation such as serum and blood plasma can still stably exist without degradation after long-term storage and repeated freeze thawing, and the content or the level of the biomarker in the detected object can be accurately reflected by taking hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 as the biomarker of nasopharyngeal darcinoma.

In one embodiment, hsa-miR-1909-3p is used as a biomarker for preparing a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

In another embodiment, hsa-miR-3135a is used as a biomarker in preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

In another embodiment, hsa-miR-198 is used as a biomarker in preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

In another embodiment, any two or three of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are used as biomarkers for preparing a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.

Preferably, three kinds of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are used as biomarkers to be applied to preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device, and the sensitivity and specificity of detection are improved through multiple combinations.

In one embodiment, the biomarkers hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are from blood. Further, the biomarkers hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are derived from treated blood, such as plasma or serum. The miRNA in the blood circulation of serum and plasma can still stably exist without degradation after long-term storage and repeated freeze thawing, thereby accurately reflecting the content or level of the biomarker in the detected object.

The inventor conducts a great deal of research and study on the aspect of biomarkers of nasopharyngeal carcinoma and unexpectedly discovers that the expression amounts of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 in patients with nasopharyngeal carcinoma and healthy people are remarkably different. The expression levels of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are high and low, and have close correlation with nasopharyngeal carcinoma, so that the expression levels can be used as a nasopharyngeal carcinoma biomarker to be applied to preparation of a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device. Although the existence form and physiological function of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 in the circulation are unknown, it is presumed that miRNA in the circulation are mainly secreted and released into the blood by cells, exist in the form of exosomes (exosomes) or protein complexes, and transmit biological information between cells. Compared with the traditional specific protein molecular marking method, the method for detecting the nasopharyngeal carcinoma by taking hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 as the biomarkers for detecting the nasopharyngeal carcinoma is more effective.

The nasopharyngeal carcinoma detection kit of one embodiment comprises a detector specifically bound to a biomarker selected from at least one of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198.

For details, see the description above for hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198.

In one embodiment, the detector that specifically binds to the biomarker is a primer capable of amplifying the biomarker or a probe capable of detecting the biomarker. And quantitatively or qualitatively determining the content of the biomarkers hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 by amplifying the primers of the biomarkers or detecting the probes of the biomarkers.

In one embodiment, the nasopharyngeal carcinoma detection kit comprises a detection object specifically combined with the biomarker, an RNA extraction reagent, an A-tailed reagent, an RNA reverse transcription reagent and a reagent for detecting an internal reference gene.

Specifically, the RNA extraction reagent is used for extracting RNA in a sample to be detected.

Specifically, the A-tailed reagent is used to add A bases to one end of the extracted RNA. Preferably, more than 12A bases, for example 12 to 20, are added to one end of the extracted RNA by adding an A-tailed reagent.

Specifically, the RNA reverse transcription reagent is used for reverse transcription of RNA after the addition of an A tail into cDNA. The RNA added with the A tail is reversely transcribed into cDNA for detection, which is beneficial to improving the detection sensitivity.

Specifically, the RNA reverse transcription reagent comprises an RNA reverse transcription primer which is a universal RT-PCR primer and can specifically carry out reverse transcription on RNA added with an A tail into cDNA.

In one embodiment, the RNA reverse transcription primer comprises a fragment designed for conserved regions and a fragment and degenerate bases designed for the a-tail. The degenerate bases are designed at the tail end to facilitate the binding of primers to the amplified fragments.

Further, the base sequence of the RNA reverse transcription primer is shown as SEQ ID No. 5. Degenerate base V represents base A or base C or base G, and degenerate base N represents base A or base C or base G or base T.

In one embodiment the detector that specifically binds to the biomarker comprises a biomarker PCR amplification forward primer, a biomarker PCR amplification reverse primer. The biomarker PCR amplification forward primer includes at least one of a first forward primer, a second forward primer, and a third forward primer. The first forward primer is designed aiming at cDNA obtained after reverse transcription of hsa-miR-1909-3 p. And designing a second forward primer aiming at cDNA obtained after reverse transcription of hsa-miR-3135 a. And designing a third forward primer aiming at cDNA obtained after reverse transcription of hsa-miR-198. And amplifying hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 in the sample to be detected by using the forward primer amplified by the biomarker PCR and the reverse primer amplified by the biomarker PCR, and calculating to obtain the content of hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 in the sample to be detected.

Specifically, the base sequence of the first forward primer is shown as SEQ ID No. 1.

Specifically, the base sequence of the second forward primer is shown as SEQ ID No. 2.

Specifically, the base sequence of the third forward primer is shown as SEQ ID No. 3.

Specifically, the reverse primer for the PCR amplification of the biomarker is a universal reverse amplification primer, and the base sequence of the reverse primer for the PCR amplification of the biomarker is shown as SEQ ID No. 4.

And specifically designing forward primers aiming at hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 respectively, so as to specifically amplify corresponding target fragments, and calculating to obtain the contents of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 in a sample to be detected.

In one embodiment, the reagents for detecting the reference gene comprise a reference gene reverse transcription primer and a reference gene PCR amplification forward primer and a reference gene PCR amplification reverse primer. The content of the internal reference genes is detected by a reagent for detecting the internal reference genes, and the contents of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are calculated on the basis of the content, so that the detection accuracy is improved.

specifically, the reference gene is at least one selected from U6, GAPDH and β -actin.

In one embodiment, the internal reference gene is U6, and the base sequence of the U6 reverse transcription primer is shown as SEQ ID No. 6. The base sequence of the forward primer for PCR amplification of U6 is shown in SEQ ID No. 7. The base sequence of the reverse primer of the PCR amplification of U6 is shown in SEQ ID No. 8.

According to the nasopharyngeal carcinoma detection kit, RNA in a sample to be detected is extracted through an RNA extraction reagent, an A base is added to one end of the extracted RNA through adding an A tail reagent, and the RNA added with the A tail is subjected to reverse transcription into cDNA through an RNA reverse transcription reagent. The content of the biomarkers hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 is then detected by means of a designed detector which specifically binds to the biomarkers. The detection kit can be applied to the detection of early nasopharyngeal carcinoma, and has high detection sensitivity and specificity.

Of course, it is understood that in the detection kit of other embodiments, when the RNA in the detection sample has been extracted and A-tailed to be reverse-transcribed into cDNA, the RNA extraction reagent, the A-tailed reagent, and the RNA reverse transcription reagent may be omitted. When the same sample has been determined and the content of the internal reference is determined, the reagent for detecting the internal reference gene may be omitted.

The method for using the nasopharyngeal carcinoma detection kit according to one embodiment includes the following steps S110 to S140.

S110, extracting RNA in the sample to be detected through an RNA extraction reagent.

Specifically, the sample to be tested is, for example, plasma, and total RNA in the plasma is extracted by an RNA extraction reagent.

S120, adding A base to one end of the RNA extracted in S110 by adding A tail reagent.

Specifically, 12 or more A bases, for example, 12 to 20 bases are added to one end of the extracted RNA.

S130, reverse transcribing the RNA added with the A tail into cDNA by an RNA reverse transcription reagent.

Specifically, the RNA reverse transcription primer is a universal reverse transcription primer, and the base sequence of the RNA reverse transcription primer is shown as SEQ ID No. 5.

Specifically, the method also comprises the step of carrying out reverse transcription on the RNA added with the A tail into reference gene cDNA by using a reference gene reverse transcription primer under the same conditions.

Specifically, the internal reference gene reverse transcription primer is a U6 reverse transcription primer, and the base sequence of the U6 reverse transcription primer is shown as SEQ ID No. 6.

S140, detecting the content of hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 by a detector specifically combined with the biomarker.

Specifically, the detection objects specifically binding to the biomarkers comprise a biomarker PCR amplification forward primer and a biomarker PCR amplification reverse primer. The PCR amplification forward primer includes at least one of a first forward primer, a second forward primer and a third forward primer. The first forward primer is designed aiming at cDNA obtained after reverse transcription of hsa-miR-1909-3 p. And designing a second forward primer aiming at cDNA obtained after reverse transcription of hsa-miR-3135 a. And designing a third forward primer aiming at cDNA obtained after reverse transcription of hsa-miR-198. The base sequence of the first forward primer is shown as SEQ ID No. 1. The base sequence of the second forward primer is shown in SEQ ID No. 2. The base sequence of the third forward primer is shown in SEQ ID No. 3. The biomarker PCR amplification reverse primer is a universal reverse amplification primer, and the base sequence of the biomarker PCR amplification reverse primer is shown as SEQ ID No. 4.

Specifically, the content of the biomarkers hsa-miR-1909-3p, hsa-miR-3135a or hsa-miR-198 is detected through a fluorescent quantitative PCR reaction. The PCR amplification system is 5 mu L of PCR buffer solution, 1 mu L of forward primer of 0.5 mu M, 1 mu L of universal reverse primer of PCR amplification of 0.5 mu M, 1 mu L of template cDNA, and increasing RNase-freewater to 10 mu L. When the forward primer is the first forward primer, the PCR detection obtains the Ct value (cycle number) of the amplified hsa-miR-1909-3 p. And when the forward primer is a second forward primer, performing PCR detection to obtain a Ct value of the amplified hsa-miR-3135 a. And when the forward primer is a third forward primer, performing PCR detection to obtain a Ct value of the amplified hsa-miR-198.

Specifically, the method also comprises the step of detecting the content of the internal reference gene by using an internal reference gene PCR amplification forward primer and an internal reference gene PCR amplification reverse primer under the same condition.

Specifically, the internal reference gene PCR amplification system is 5 muL of PCR buffer solution, 1 muL of 0.5 muM internal reference gene PCR amplification forward primer, 1 muL of 0.5 muM internal reference gene PCR amplification reverse primer, 1 muL of internal reference gene cDNA, and increasing RNase-freewater to 10 muL. And (5) carrying out PCR detection to obtain the Ct value of the amplified reference gene.

And subtracting the Ct value of the amplified reference gene from the Ct value of the obtained amplified hsa-miR-1909-3p, the Ct value of the amplified hsa-miR-3135a and the Ct value of the amplified hsa-miR-198 to obtain a difference value (delta Ct value) of the Ct values. Preliminarily diagnosing whether the sample from which the sample to be detected is from a nasopharyngeal carcinoma patient or is at risk of suffering from the nasopharyngeal carcinoma.

The nasopharyngeal carcinoma detection reagent prepared by taking hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 as the nasopharyngeal carcinoma biomarker can be applied to the early detection of nasopharyngeal carcinoma, has high detection sensitivity and specificity, and has quick and objective detection results, thereby having great application prospects in the fields of nasopharyngeal carcinoma clinical diagnosis and nasopharyngeal carcinoma prevention and detection.

The following is a detailed description of the embodiments.

In the following examples, unless otherwise specified, the experimental procedures without specifying the specific conditions are usually carried out according to conventional conditions, for example, the conditions described in the molecular cloning's Experimental guidelines [ M ] (Beijing: scientific Press, 1992) by Sammbruke, EF Friech, T Mannich, et al (translated by Kindong goose, Rimeng maple, et al) or the procedures recommended by the manufacturers of the kits. The reagents used in the examples are all commercially available.

Not specifically stated, the RNA extraction reagent used in the examples was the miRNeasy Serum/Plasma Kit (#217184, available from Qiagen, Hilden, Germany). The tailed reagent was Poly (A) labeling Kit (# AM1350, available from Ambion, Austin, TX). The first forward primer, the second forward primer, the third forward primer, the biomarker PCR amplification reverse primer, the RNA reverse transcription primer, the U6 reverse transcription primer, the U6 PCR amplification forward primer and the U6 PCR amplification reverse primer are obtained by means of gene synthesis. The base sequence of the first forward primer is shown as SEQ ID No. 1. The base sequence of the second forward primer is shown in SEQ ID No. 2. The base sequence of the third forward primer is shown in SEQ ID No. 3. The base sequence of the reverse primer of the biomarker PCR amplification is shown as SEQ ID No. 4. The base sequence of the RNA reverse transcription primer is shown as SEQ ID No. 5. The base sequence of the U6 reverse transcription primer is shown in SEQ ID No. 6. The base sequence of the forward primer for PCR amplification of U6 is shown in SEQ ID No. 7. The base sequence of the reverse primer of the PCR amplification of U6 is shown in SEQ ID No. 8.

Example 1

A nasopharyngeal carcinoma detection kit comprises an RNA extraction reagent, an A-tail adding reagent, a first forward primer, a biomarker PCR amplification reverse primer, an RNA reverse transcription primer, a U6 reverse transcription primer, a U6 PCR amplification forward primer and a U6 PCR amplification reverse primer. The nasopharyngeal carcinoma detection kit can detect the expression quantity of a nasopharyngeal carcinoma biomarker hsa-miR-1909-3 p.

Example 2

A nasopharyngeal carcinoma detection kit comprises an RNA extraction reagent, a tailing reagent, a second forward primer, a biomarker PCR amplification reverse primer, an RNA reverse transcription primer, a U6 reverse transcription primer, a U6 PCR amplification forward primer and a U6 PCR amplification reverse primer. The nasopharyngeal darcinoma detection kit can detect the expression quantity of a nasopharyngeal darcinoma biomarker hsa-miR-3135 a.

Example 3

A nasopharyngeal carcinoma detection kit comprises an RNA extraction reagent, a tailing reagent, a third forward primer, a biomarker PCR amplification reverse primer, an RNA reverse transcription primer, a U6 reverse transcription primer, a U6 PCR amplification forward primer and a U6 PCR amplification reverse primer. The nasopharyngeal carcinoma detection kit can detect the expression quantity of a nasopharyngeal carcinoma biomarker hsa-miR-198.

Example 4

A nasopharyngeal carcinoma detection kit comprises an RNA extraction reagent, an A-tailed reagent, a first forward primer, a second forward primer, a third forward primer, a biomarker PCR amplification reverse primer, an RNA reverse transcription primer, a U6 reverse transcription primer, a U6 PCR amplification forward primer and a U6 PCR amplification reverse primer. The nasopharyngeal darcinoma detection kit can detect the expression quantity of nasopharyngeal darcinoma biomarkers hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198.

Test example 1

(1) Plasma samples of 19 nasopharyngeal carcinoma patients and 8 healthy people were collected from Nanjing tumor Hospital and stored at-80 ℃.

(2) Plasma free RNA was extracted from early nasopharyngeal carcinoma patients and healthy persons using the miRNeasy Serum/Plasma Kit (#217184, Qiagen, Hilden, Germany) according to the manual procedures. The miRNA is subjected to Poly (A) tail addition by using Poly (A) labeling Kit (# AM1350, Ambion, Austin, TX) according to the operating manual, and 12A bases are added to the miRNA in the embodiment.

(3) The cDNA was obtained by Reverse transcription of the miRNA with poly (A) using M-MuLV Reverse Transcriptase (# E6300S, NEB, Hitchin, UK) and a universal RNA Reverse transcription primer according to the manual. Under the same conditions, the miRNA with poly (A) is subjected to Reverse transcription by using M-MuLV Reverse Transcriptase (# E6300S, NEB, Hitchin, UK) and U6 Reverse transcription primers according to an operation manual to obtain the cDNA of the internal reference gene U6. The base sequence of the universal reverse transcription primer is as follows: GCGAGCACAGAATTAATACGACTCACTATAGGTTTTTTTTTTTTVN (shown in SEQ ID No. 5). The base sequence of the reverse transcription primer of the reference gene U6 is as follows: GGAACGCTTCACGAATTTG (shown in SEQ ID No. 6).

(4) Quantitative PCR SsoFast Using real-time fluorescence^TM

Quantitative analysis of miRNA was performed by Supermix (BIO-RAD, Hercules, Calif.).

The Ct value of the amplified reference gene U6 is detected by real-time fluorescent quantitative PCR, and the quantitative reaction system is shown in the following table 1.

Table 1: PCR reaction system for detecting reference gene U6

Wherein the base sequence of the forward primer for PCR amplification of U6 is as follows: ATTGGAACGATACAGAGAAGATT (shown in SEQ ID No. 7)

The base sequence of the reverse primer of the PCR amplification of U6 was: GGAACGCTTCACGAATTTG (shown in SEQ ID No. 8).

Reaction conditions are as follows: 2min at 95 ℃; denaturation 95 ℃ for 20s, annealing/extension 58 ℃ for 40s, for 40 cycles. Through detection, Ct of the reference gene U6 in a sample extracted from a healthy person and a sample extracted from an early nasopharyngeal carcinoma patient is 12-13, the average Ct is 12.45, and the difference between the Ct and the Ct is not obvious.

And continuously detecting Ct values of the amplified biomarkers hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 by adopting real-time fluorescent quantitative PCR (polymerase chain reaction), wherein a quantitative reaction system is shown in the following table 2.

Table 2: PCR reaction system for detecting biomarkers

Wherein the base sequence of the first forward primer (the quantitative forward primer of hsa-miR-1909-3 p) is as follows: CGCAGGGGCCGGGTGCTCACCG (shown in SEQ ID No. 1).

The base sequence of the second forward primer (the quantitative forward primer of hsa-miR-3135 a) is as follows: TGCCTAGGCTGAGACTGCAGTG (shown in SEQ ID No. 2).

The base sequence of the third forward primer (the quantitative forward primer of hsa-miR-198) is as follows: GGTCCAGAGGGGAGATAGGTTC (shown in SEQ ID No. 3).

The base sequence of the reverse primer (quantitative universal reverse primer) for PCR amplification of the marker is as follows: GCGAGCACAGAATTAATACGAC (shown in SEQ ID No. 4).

Reaction conditions are as follows: 2min at 95 ℃; denaturation 95 ℃ for 20s, annealing/extension 58 ℃ for 40s, for 40 cycles. Ct values of amplified hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 are obtained respectively. And the Ct value for each sample is subtracted from the internal reference mean Ct value. The scatter diagrams of the distributions are shown in FIGS. 1 to 3. The results show that compared with the plasma of healthy people, the total expression level of hsa-miR-1909-3P of patients with nasopharyngeal carcinoma is respectively reduced by 7.25 times (P <0.05), the total expression level of hsa-miR-3135a is respectively reduced by 4.32 times (P <0.05), the total expression level of hsa-miR-198 is respectively reduced by 2.46 times (P <0.05), and the three biomarkers of hsa-miR-1909-3P, hsa-miR-3135a and hsa-miR-198 have obvious difference in the healthy people and patients with nasopharyngeal carcinoma.

Test example two

Plasma samples of 19 nasopharyngeal carcinoma patients and 8 healthy people were collected as test samples in Nanjing tumor Hospital, and each test sample was repeated at least 3 times. The kits of example 1(hsa-miR-1909-3p as a label), example 2(hsa-miR-3135a as a label), example 3(hsa-miR-198 as a label) and example 4(hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 simultaneously as labels) were tested as described above for test one. The results are shown in table 3 below.

Table 3: test results of nasopharyngeal carcinoma patients and healthy people

The results show that the detection kit of the embodiment 1-4 can be used for detecting and distinguishing nasopharyngeal carcinoma patient detection samples and healthy person detection samples with high specificity.

Further, the kit of example 1(hsa-miR-1909-3p as a marker for nasopharyngeal carcinoma) was used to detect data for distinguishing healthy persons from patients with nasopharyngeal carcinoma, and ROC analysis was performed using MedCalc software, and the ROC curve was shown in FIG. 4. The AUC is 0.954 as seen in the figure, with 95% confidence intervals of 0.797-0.998. The result shows that the sensitivity and the specificity of detecting and distinguishing healthy people from nasopharyngeal carcinoma by using hsa-miR-1909-3p as a marker of the nasopharyngeal carcinoma are higher.

The kit of example 2(hsa-miR-3135a as a nasopharyngeal carcinoma marker) was used to detect data for distinguishing healthy persons from nasopharyngeal carcinoma patients, and ROC analysis was performed using MedCalc software to obtain a ROC curve as shown in FIG. 5. The AUC is seen to be 0.921 with 95% confidence intervals of 0.750-0.989. The result shows that the sensitivity and the specificity of detecting and distinguishing healthy people from nasopharyngeal carcinoma by taking hsa-miR-3135a as a nasopharyngeal carcinoma marker are higher.

The kit of example 3(hsa-miR-198 as a marker of nasopharyngeal carcinoma) was used to detect data for distinguishing healthy persons from patients with nasopharyngeal carcinoma, and ROC analysis was performed using MedCalc software to obtain a ROC curve as shown in FIG. 6. From the figure, it is seen that AUC is 0.789 with 95% confidence intervals of 0.590-0.921. The result shows that the sensitivity and the specificity of detecting and distinguishing healthy people from nasopharyngeal carcinoma by taking hsa-miR-198 as a marker of the nasopharyngeal carcinoma are higher.

The detection data for distinguishing healthy persons from nasopharyngeal carcinoma patients were detected using the kit of example 4(hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 were used simultaneously as markers for nasopharyngeal carcinoma), and ROC analysis was performed using MedCalc software, and the ROC curve was obtained as shown in FIG. 7. The AUC is 0.987, with 95% confidence intervals of 0.849-1. The results show that the combination of hsa-miR-1909-3p, hsa-miR-3135a and hsa-miR-198 is simultaneously used as a marker for detecting nasopharyngeal carcinoma to distinguish healthy people from nasopharyngeal carcinoma, the AUC is 0.987, the 95% confidence interval is 0.849-1, and the sensitivity and the specificity are very good.

Specific data are shown in table 4 below.

Table 4: the result of the detection

Reagent kit	Sensitivity (%)	Specificity (%)	AUC	95% confidence interval
					Example 1	100	87.5	0.954	0.797～0.998
Example 2	78.95	100	0.921	0.750～0.989
					Example 3	47.37	100	0.789	0.590～0.921
Example 4	89.47	100	0.987	0.849～1

The above-mentioned embodiments only express one or several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Shenzhen Shenpu electronics technology Limited

Application of <120> nasopharyngeal carcinoma related miRNA as biomarker and nasopharyngeal carcinoma detection kit

<160>8

<170>SIPOSequenceListing 1.0

<210>1

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

cgcaggggcc gggtgctcac cg 22

<210>2

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgcctaggct gagactgcag tg 22

<210>3

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggtccagagg ggagataggt tc 22

<210>4

<211>22

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gcgagcacag aattaatacg ac 22

<210>5

<211>46

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcgagcacag aattaatacg actcactata ggtttttttt ttttvn 46

<210>6

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

ggaacgcttc acgaatttg 19

<210>7

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

attggaacga tacagagaag att 23

<210>8

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ggaacgcttc acgaatttg 19

Claims

At least one of hsa-miR-1909-3p and hsa-miR-198 is used as a biomarker for preparing a nasopharyngeal carcinoma detection reagent, a nasopharyngeal carcinoma detection kit or a nasopharyngeal carcinoma detection device.
2. The use of claim 1, wherein the nasopharyngeal carcinoma is early nasopharyngeal carcinoma.
3. The use of claim 1, wherein the biomarker is from blood.
4. The use of claim 1, wherein the nasopharyngeal cancer detection reagent comprises a detector that specifically binds to a biomarker that is hsa-miR-1909-3 p; or the biomarker is hsa-miR-198; or the biomarkers are hsa-miR-1909-3p and hsa-miR-198; or the biomarkers are hsa-miR-1909-3p and hsa-miR-3135 a; or the biomarkers are hsa-miR-198 and hsa-miR-3135a or the biomarkers are hsa-miR-198, hsa-miR-1909-3p and hsa-miR-3135 a.
5. The use according to claim 4, wherein the detector that specifically binds to a biomarker comprises a primer capable of amplifying the biomarker or a probe capable of detecting the biomarker.
6. The use of claim 4, wherein the detector that specifically binds to the biomarker comprises a biomarker PCR amplification forward primer and a biomarker PCR amplification reverse primer;

the biomarker PCR amplification forward primer comprises at least one of a first forward primer, a second forward primer and a third forward primer, wherein the first forward primer is designed for cDNA obtained after the reverse transcription of hsa-miR-1909-3p, the second forward primer is designed for cDNA obtained after the reverse transcription of hsa-miR-3135a, and the third forward primer is designed for cDNA obtained after the reverse transcription of hsa-miR-198.
7. The use of claim 6, wherein the base sequence of the first forward primer is as shown in SEQ ID No. 1; and/or the presence of a catalyst in the reaction mixture,

the base sequence of the second forward primer is shown as SEQ ID No. 2; and/or the presence of a catalyst in the reaction mixture,

the base sequence of the third forward primer is shown as SEQ ID No. 3; and/or the presence of a catalyst in the reaction mixture,

the biomarker PCR amplification reverse primer is a universal reverse amplification primer, and the base sequence of the biomarker PCR amplification reverse primer is shown as SEQ ID No. 4.
8. the use of claim 4, further comprising a reagent capable of detecting an internal reference gene selected from at least one of U6, GAPDH, β -actin.
9. The use of claim 4, further comprising an RNA extraction reagent, a tailing reagent and an RNA reverse transcription reagent;

the RNA extraction reagent is used for extracting RNA in a sample to be detected;

the A tail adding reagent is used for adding A base at one end of the extracted RNA;

the RNA reverse transcription reagent is used for reverse transcribing the RNA added with the A tail into cDNA.
10. The use of claim 9, wherein the RNA reverse transcription reagent comprises an RNA reverse transcription primer, and the base sequence of the RNA reverse transcription primer is shown as SEQ ID No. 5.