CN107475372A - A kind of kit for CTLA 4mRNA detection of expression - Google Patents
A kind of kit for CTLA 4mRNA detection of expression Download PDFInfo
- Publication number
- CN107475372A CN107475372A CN201710603540.2A CN201710603540A CN107475372A CN 107475372 A CN107475372 A CN 107475372A CN 201710603540 A CN201710603540 A CN 201710603540A CN 107475372 A CN107475372 A CN 107475372A
- Authority
- CN
- China
- Prior art keywords
- ctla
- detection
- values
- curve
- rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of kit for the mRNA detection of expression of CTLA 4, it is characterised in that including specific reverse transcription primer, Q PCR specific primers and probe；The specific reverse transcription primer includes following sequence：The reverse transcriptions of CTLA 4：5’CCCAGGTAGTATGGCGGTGG3’；GADPH reverse transcriptions：5’ATACGACCAAATCCGTTGACT3’；The following sequence of Q PCR specific primers：CTLA‑4F:5’ATCCAAGGACTGAGGGCCAT3’；CTLA‑4R:5’ATCTGGGTTCCGTTGCCTATG3’；GAPDHF:5’CTCTGCTCCTCCTGTTCGAC3’；GAPDHR:5’ATGGTGTCTGAGCGATGTGG3’.Quantitative molecular is identified using specific probe, there is high accuracy, the advantages of specificity is good, and false positive is low；Safety simple to operate, detection is cheap, can be with large-scale promotion；Detection speed is fast, and detection process takes around 2 hours and can completed.
Description
Technical field
To be related to biological technical field the present invention relates to one kind, more particularly to it is a kind of for CTLA-4 mRNA detection of expression
Kit.
Background technology
Targeting immunization therapy target be find can with activating immune system and can killing tumor cell related drugs.Its
Committed step is to find principal causative protein or the expressed antigen on tumor cell membrane in Tumorigenesis, then
Treated for this target spot by actively or passively immunotherapy.People's cell Cytotoxic T lymphocytes related antigen 4
（Cytotoxic T lymphocyte-associated antigen 4, CTLA-4）Mab treatment tumour i.e. with
CTLA-4 is the passive immunotherapy that target spot prepares monoclonal antibody.
CTLA-4 can suppress anti tumor immune response, and previously research is found:CTLA-4 is in oophoroma and melanoma etc.
Rise is expressed in tumour.The CTLA-4 assignments of genes gene mapping with (2q33), are mainly expressed in the T cell of activation in No. 2 chromosome long arms 33
Surface, the costimulatory molecules acceptor with T cell surface（CD28）Homology with height.CTLA-4 and CD28 is immune
Globulin superfamily member, the two is combined with identical part CD86 (B7-2) and CD80 (B7-1).With CD28 function on the contrary,
CTLA-4 suppresses T cell activation after being combined with B7 molecules.CTLA-4 mechanism of action not yet illustrates completely, it is now recognized that having following
The possibility of several respects：1. competition part is played by its extracellular domain：CTLA4 has the affinity of height with B7 molecules, with
CD28 competition binding antigen presenting cells（APC）On B7 family molecules, block CD28 and B7 signal transduction pathway, prevent
CD28 molecules promote t cell activation.2. negativity adjustment effect is realized in the generation for suppressing IL-2.3. suppress T cell enters S from the G phases
Phase, so as to suppress the propagation of T cell, activation.4. CTLA-4 with PP2A and SHP2 interactions by disturbing TCR signals, simultaneously
CTLA-4 is combined with PI3K, causes AKT phosphorylations, is caused and is promoted antiapoptotic factors BAD inactivation, and raise anti-apoptosis factor Bcl-xL and
Bcl-2, critical role is played the part of in immune tolerance.Theoretical based on more than, CTLA-4 is that many diseases include exempting from for tumour
Epidemic disease treatment provides new method.Therefore CTLA-4 is considered as to suppress the antitumor immune factor of body, and development CTLA-4 resists
Body is used for the immunization therapy of tumour, is focus and the direction of current cancer target immunization therapy.
CTLA-4 is the first Co inhibitor target spot clinically developed, and has a variety of CTLA-4 antibody to be used to treat disease so far
Disease, according to its development clinically, for the ability of enhancing Host Anti-tumor Immunity reaction, most promising antibody is
Ipilimumab.Ipilimumab has been furtherd investigate in different types of tumour, such as melanoma, prostate cancer, lung cancer, transfer
Property kidney, lymthoma, cancer of pancreas and carcinoma of urinary bladder.The two extensive III clinical trial phase knots carried out for melanoma patients
Fruit shows that Ipilimumab can effectively extend the Overall survival of patient.
The method of CTLA-4 detection of expression is presently used for, is the detection on protein level mostly, cost is high, preparation method
It is cumbersome, take longer, it is difficult in general medical institutions conduct.The appearance of fluorescent quantitative PCR technique, for the invention provides one kind
Simple to operate quickly, easily standardization, testing cost are low, the method for accurately and reliably, quantitatively detecting CTLA-4 mRNA.Pass through the party
Method can be quickly detected tumor patient sample（Tumor tissues sample, blood）Middle CTLA-4 mRNA expression quantity, for clinical doctor
It is raw that tumor patient is carried out to target immunization therapy offer science reference frame.
The content of the invention
The purpose of the present invention：A kind of examination of detection CTLA-4 mrna expression amounts that can be quick, easy, sensitive, special is provided
Agent box, special CTLA-4 gene specifics probe and primer, and reference gene GADPH specific probes and primer are employed, tied
Closing fluorescent PCR detection technique can be with the expression of CTLA-4 mRNA in highly sensitive detection blood excretion body or tumor tissues；Use
The advantages of quantitative molecular is identified specific probe, has high accuracy, and specificity is good, and false positive is low；Peace simple to operate
Entirely, detection is cheap, can be with large-scale promotion；Detection speed is fast, and detection process takes around 2 hours and can completed.
To achieve these goals, the technical scheme is that：
A kind of kit for CTLA-4 mRNA detection of expression, including specific reverse transcription primer, Q-PCR specific primers
And probe；
The specific reverse transcription primer includes following sequence：
CTLA-4 reverse transcriptions：5’CCCAGGTAGTATGGCGGTGG3’
GADPH reverse transcriptions：5’ATACGACCAAATCCGTTGACT3’
The following sequence of Q-PCR specific primers：
CTLA-4F:5’ATCCAAGGACTGAGGGCCAT3’
CTLA-4R:5’ATCTGGGTTCCGTTGCCTATG3’
GAPDHF:5’CTCTGCTCCTCCTGTTCGAC3’
GAPDHR:5’ATGGTGTCTGAGCGATGTGG3’
The probe includes following sequence：
CTLA-4taqman:5’-FAM-ctctacatctgcaagg-MGB-3’
GAPDHTaqman:5’CGTCGCCAGCCGA3’
A kind of detection method for CTLA-4 mRNA detection of expression kits, this method comprise at least following steps：
Step 1：Synthetic primer, detection probe are specifically designed for CTLA-4.
For selected CTLA-4 cDNA sequences, primer and detection are designed using the primer-design softwares of primer 5.0
Probe, primer and probe sequence.
Step 2：The extraction of sample process and RNA.RNA is extracted using RNA extracts kits.
Step 3：Establish pcr amplification reaction system.
It is that cDNA is used as template through reverse transcription, with the detection of CTLA-4 kits, specific reactant by the RNA of above-mentioned acquisition
System is as follows：
The collection of fluorescence signal is set to FAM, and the collection of data is scheduled on 60 DEG C.
Step 4：Baseline Start values, End values and threshold line, result of determination are adjusted after analysis image.
After reaction terminates, instrument automatically saves result, analyzes Start values, the End values of regulation Baseline after image（Can
Voluntarily adjust, Start values can be between 3-10, and between 15-20, adjust the amplification curve of negative quality-control product makes End values
Its is straight or less than threshold line）And threshold line（Threshold values, it can manually adjust to baseline）.
The determination of Ct values and △ Ct values：User determines according to actual conditions at the flex point that each reaction tube expansion curve rises,
Obtain its Ct value.The difference of △ Ct=CTLA-4 holes FAM fluorescence Ct values and reference opening Ct values.Detection hole Ct values refer to sample
Ct values corresponding to CTLA-4 detections；Reference opening Ct values refer to Ct values corresponding to sample GAPDH.
As a result interpretation is as follows：Sample CTLA-4 has S types curve and △ ct values>When 15, CTLA-4 weak expressions；10≤△ct≤
When 15, expressed in CTLA-4；During △ ct values≤10, CTLA-4 strongly expresseds.
Described RNA samples include fresh tumor tissue or fresh pathological tissue or paraffin-embedded tissue or fresh plasma.
The described CTLA-4 samples of sampling are 1 gram or so.
Present invention employs special CTLA-4 gene specifics probe and primer, and reference gene GADPH specific probes
And primer, can be with CTLA-4 mRNA in highly sensitive detection blood excretion body or tumor tissues with reference to fluorescent PCR detection technique
Expression；Quantitative molecular is identified using specific probe, there is high accuracy, the advantages of specificity is good, and false positive is low；Behaviour
Make simple and safe, detection is cheap, can be with large-scale promotion；Detection speed is fast, and detection process takes around 2 hours and can completed.
Specific embodiment
Embodiments of the invention further explained below.
A kind of primer, probe for CTLA-4-L1 detection of expression, including CTLA-4 special primers and probe, it is described
CTLA-4 special primers are specially with probe：
CTLA-4F:5’ATCCAAGGACTGAGGGCCAT3’
CTLA-4R:5’ATCTGGGTTCCGTTGCCTATG3’
GAPDHF:5’CTCTGCTCCTCCTGTTCGAC3’
GAPDHR:5’ATGGTGTCTGAGCGATGTGG3’
A kind of detection kit for CTLA-4 detection of expression, RNA samples are extracted by described detection kit, and carried out
Reverse transcription reaction and pcr amplification reaction.
Reverse transcription PCR reaction system is as follows：
5×Transcription Buffer 5uL
dNTP(10mM) 1.25uL
Specific reverse transcription primer 200-400 nM
Ribonuclease Inhibitor (40 U/μl) 0.7uL
MLV-Transcriptase 1uL
RNA 15uL
DEPC H2O complements to 25uL
PCR amplifications reflection system is as follows：
10XPCR Buffer are diluted to 1X
dNTP 0.2mM
Template 2uL
Each primer 2 00-400 nM
Each probe 100-400 nM
Each closing probe 200-400 nM
Hot start Taq polymerase 1U
MgCL2 2-5mM
Cumulative volume 20uL.
The condition of described PCR reactions is as follows：
A kind of detection method of detection kit for CTLA-4 detection of expression, this method comprise at least following steps：
Step 1：For specific position design synthetic primer, closing probe and detection probe.
For selected CTLA-4 cDNA sequences, primer and detection are designed using the primer-design softwares of primer 5.0
Probe, primer and probe sequence（See attached list 3）.
Step 2：The extraction of sample process and RNA.RNA is extracted using RNA extracts kits.
Step 3：Establish pcr amplification reaction system.
Using the genomic DNA of above-mentioned acquisition as template, detected with CTLA-4 detection of expression kit, specific reaction system
It is as follows：
10XPCR Buffer are diluted to 1X
dNTP 0.2mM
Template 2uL
Each primer 2 00-400 nM
Each probe 100-400 nM
Each closing probe 200-400 nM
Hot start Taq polymerase 1U
MgCL2 2-5mM
Cumulative volume 20uL；
Real-time PCR reactions condition is as follows：
The collection of fluorescence signal is set to FAM, and the collection of data is scheduled on 60 DEG C.
Step 4：Baseline Start values, End values and threshold line, result of determination are adjusted after analysis image.
After reaction terminates, instrument automatically saves result, analyzes Start values, the End values of regulation Baseline after image（Can
Voluntarily adjust, Start values can be between 3-10, and between 15-20, adjust the amplification curve of negative quality-control product makes End values
Its is straight or less than threshold line）And threshold line（Threshold values, it can manually adjust to baseline）.
The determination of Ct values and △ Ct values：User determines according to actual conditions at the flex point that each reaction tube expansion curve rises,
Obtain its Ct value.The difference of △ Ct=CTLA-4 holes FAM fluorescence Ct values and reference opening Ct values.CTLA-4Ct values refer to sample
Ct values corresponding to CTLA-4 detection holes；Reference opening Ct values refer to Ct values corresponding to sample GAPDH.
As a result interpretation is as follows：As a result interpretation is as follows：Sample CTLA-4 has S types curve and △ ct values>When 15, CTLA-4 is weak
Expression；During 10≤△ ct≤15, expressed in CTLA-4；During △ ct values≤10, CTLA-4 strongly expresseds.
Described RNA samples include fresh tumor tissue or fresh pathological tissue or paraffin-embedded tissue.
The described RNA samples of sampling are 1 gram or so.
Embodiment 1
Apply to system detection plasmid of the present invention, experiment plasmid template（Gene containing CTLA-4）, detected using above-mentioned fluorescent PCR
The method of CTLA-4 gene expressions is as follows：
（1）The processing and extraction of plasmid：
The extraction of plasmid uses TIANGEN（HighPure Plasmid kid, DP116）Plasmid extraction kit carried
Take, specific operating procedure of extracting is by kit explanation operation.Carried DNA is dissolved in Tris-HCl (10mM, pH 8.0), through ultraviolet
Spectrophotometer Detection and Extraction quality, determines its concentration, then adjusts DNA concentration with Tris-HCl (10mM, pH 8.0) solution
To 20ng/ul as dilution mother liquor.
According to formula CCopy concentrations=（CMass concentrationX6.02X1023）/MWDNAIt is 10 to dilute wild plasmid6Individual copy number/microlitre.
（2）Establish pcr amplification reaction system：
By above-mentioned gained cDNA templates, the template as real-time fluorescent PCR amplification, enter performing PCR amplification according to following amplification system
10×PCR Buffer
It is diluted to 1 ×
dNTP 0.2mM
Template 2uL
Each primer 2 00-400 nM
Each probe 100-400 nM
Hot start Taq polymerase 1U
MgCL2 2-5mM
Cumulative volume 20uL.
Real-time PCR reactions condition is as follows：
The collection of fluorescence signal is set to FAM, and the collection of data is scheduled on 60 DEG C.
After experiment terminates, analyzed, judged according to the following steps：
1st, no template control is run（NTC）When, FAM signals rise without curve, illustrate the pollution-free presence of experiment, can continue to analyze
Experimental conditions.
2nd, positive quality control product analysis is run, Ct value≤30.0 of all positive quality controls, illustrates that experimental system is normal, Ke Yiji
Continuous analysis experimental result；Its Ct value may also can be set and be fluctuated due to the different threshold values of different instruments.
3rd, the Ct values for running GAPDH calculate, and in FAM passages, if Ct value≤42.0, can continue to analyze；If Ct values>
42.0, then illustrate that sample rna degraded is serious, being not suitable for experiment needs.
4th, the definition and requirement of effective amplification curve：Typical amplification curve has three kinds of typical periods, early stage background amplification
Phase, Metaphase index amplification phase（Rise）The plateau risen with evening, curve global shape are S-type.Effective amplification curve at least needs
Background amplification phase early stage and Metaphase index amplification, curve, can calculated curve Ct values in normal S types amplification trend；Remaining curve
It is considered as invalid curve, not calculates.
5th, Ct calculating is run in FAM passages, according to the Ct values in each site and whether there is amplification curve, judges corresponding position
Point situation, concrete outcome judge as follows：Sample CTLA-4 has S types curve and △ ct values>When 15, CTLA-4 weak expressions；10≤△
During ct≤15, expressed in CTLA-4；During △ ct values≤10, CTLA-4 strongly expresseds.
Sensitivity analysis：The sample DNA for taking CTLA-4 gene plasmids concentration after quantitative to be 1000 copies, carries out 10
Dilute, 3 concentration are detected respectively again then, the fluorescent PCR that 5 μ L DNA. results show the present invention is added per secondary response
The high sensitivity of method, 10 copy DNA genes can detect.
Replica test：Each reaction be separately added into DNA 1000 copy, 100 copies, be repeated 10 times carry out fluorescence
PCR is expanded, and 10 Ct values differ less than 0.5 circulation.
Testing result shows that detection architecture of the invention can accurately detect plasmid CTLA-4 gene expressions, the spirit of detection
Sensitivity can reach 5-10 copies.
Embodiment 2：
Clinical sample is detected with the present invention, detection 120 gives me the patients with lung cancer paraffin-embedded tissue sample of company's detection.Its
Middle male 50, women 50, average age are 53 years old, the median age 50 years old, utilize special primer of the present invention and fluorescence probe
The gene expression that PCR system detects the CTLA-4 of 100 clinical samples is as follows：
(1) sample process and RNA extraction
A. about 1 × 1 cm2 each lung cancer sample slice is taken（About 4-5 pieces section altogether）It is placed in centrifuge tube（Provide for oneself）In, add 1 ml
Dimethylbenzene, lid is covered tightly, be vortexed concussion 10 seconds.
B.12,000 rpm（~13,400 × g）Centrifugation 2 minutes, careful inhale abandon supernatant, be careful not to suction abandon it is heavy.
C. 1ml absolute ethyl alcohols are added, the concussion that is vortexed mixes.12,000 rpm are centrifuged 2 minutes, are abandoned supernatant, are careful not to inhale
Abandon precipitation.
D. open lid, room temperature or be up to 37 °C and be incubated 10 minutes, until being remained without ethanol.
E. 150 μ l Buffer PKD are added, precipitation is resuspended；10 μ l Proteinase K are added, the concussion that is vortexed mixes.
F.56 DEG C incubation 15 minutes, until sample is completely dissolved.80 DEG C are incubated 15 minutes.Of short duration centrifugation, makes on tube wall
Solution is collected into ttom of pipe.
G. 320 μ l Buffer RBC are added, the concussion that is vortexed thoroughly mixes.
H. solution resulting in step g is all added to and has been charged into collecting pipe（Collection Tube 2 ml）'s
Filter column（DNA Remover Column）In.10,000 rpm are centrifuged 1 minute, collect filtrate.
I. in the filtrate that step h is obtained, 720 μ l absolute ethyl alcohols are added, the concussion that is vortexed thoroughly mixes.
J. the solution of gained in step i is all added to and has been charged into collecting pipe（Collection Tube 2 ml）Suction
Attached column（Spin Column RS）In.10,000 rpm are centrifuged 1 minute, outwell the waste liquid in collecting pipe, adsorption column is relay
Reclaim in collector.
K. 500 μ l Buffer RW2 are added into adsorption column, 10,000rpm centrifugations 1 minute, are outwelled useless in collecting pipe
Liquid, adsorption column is placed back in collecting pipe.
L.12,000 rpm is centrifuged 2 minutes, outwells waste liquid in collecting pipe.Adsorption column is placed in room temperature several minutes thoroughly to dry.
M. by adsorption column be placed in one it is new without RNase centrifuge tubes（Collection Tube 1.5 ml）In, to absorption
The middle part of post vacantly adds 20-50 μ l RNase-Free Water, and room temperature is placed 2-5 minutes, 10,000 rpm centrifugations 1
Minute, RNA solution is collected, prepares subsequent experimental.
(2) pcr amplification reaction system is established
It will put on and state RNA and be dissolved in 0.1%DEPC water, extract quality through UV spectrophotometer measuring, determine its concentration
OD260/OD280 is 1.9-2.1, and reads its content.The template for taking 0.1~5 μ g RNA A to be synthesized as its c DNA, using health
CDNA is synthesized for the RNA Reverse Transcriptase kits in century, cDNA synthetic systems are as follows：
5×RT buffer 4µL
Primer final concentration 200nM
dNTP 1mM
super RT 200U
RNA 6µL
DEPC water is mended to 20 μ L.
Reverse transcription is carried out as follows using above-mentioned reverse transcription system.
(a) the μ L of 13 μ L, super RT reverse transcriptases of reverse transcription reaction mixed liquor 1 are taken, are added in sterile centrifugation tube, are mixed.
(b) μ L, the RNA total amounts of testing sample RNA 6 are added in 0.1~5 μ g ranges to 20 μ L.
（c）42 °C of 1 hours of insulation
(d) 85 °C insulation 5 minutes after cooled on ice, obtain cDNA templates
By above-mentioned gained cDNA templates, the template as real-time fluorescent PCR amplification, enter performing PCR amplification according to following amplification system：
10XPCR Buffer are diluted to 1X
Template 2uL
Each primer 2 00-400 nM
Each probe 100-400 nM
Each closing probe 200-400 nM
Hot start Taq polymerase 1U
dNTP 0.5mM
MgCL2 2-5mM
Cumulative volume 20uL
Real-time PCR reactions condition is as follows：
The collection of fluorescence signal is set to FAM, and the collection of data is scheduled on 60 DEG C.
After experiment terminates, analyzed, judged according to the following steps：
1st, no template control is run（NTC）When, FAM signals rise without curve, illustrate the pollution-free presence of experiment, can continue to analyze
Experimental conditions.
2nd, positive quality control product analysis is run, Ct value≤30.0 of all positive quality controls, illustrates that experimental system is normal, Ke Yiji
Continuous analysis experimental result；Its Ct value may also can be set and be fluctuated due to the different threshold values of different instruments.
3rd, the Ct values for running GAPDH calculate, and in FAM passages, if Ct value≤42.0, can continue to analyze；If Ct values>
42.0, then illustrate that sample rna degraded is serious, being not suitable for experiment needs.
4th, the definition and requirement of effective amplification curve：Typical amplification curve has three kinds of typical periods, early stage background amplification
Phase, Metaphase index amplification phase（Rise）The plateau risen with evening, curve global shape are S-type.Effective amplification curve at least needs
Background amplification phase early stage and Metaphase index amplification, curve, can calculated curve Ct values in normal S types amplification trend；Remaining curve
It is considered as invalid curve, not calculates.
5th, Ct calculating is run in FAM passages, according to the Ct values in each site and whether there is amplification curve, judges corresponding position
Point situation, concrete outcome result of determination are：
As a result interpretation is as follows：Sample CTLA-4 has S types curve and △ ct values>When 15, CTLA-4 weak expressions；10≤△ct≤15
When, express in CTLA-4；During △ ct values≤10, CTLA-4 strongly expresseds.
Testing result, which shows to detect, the high expression of 4 CTLA-4 in 100 lung cancer samples, high expression rate is 4%.
In summary, present invention employs CTLA-4 specific probes and primer, CTLA-4 in tumor tissues can be detected
MRNA expressions；The innovative method using RT-PCR, compares with house-keeping gene GAPDH, is calculated by 2- △ △ CT
Method, CTLA-4 relative expression levels are obtained, improve its sensitivity；CTLA-4 expression can be detected in blood；Operation
Simply, detection is cheap, can be with large-scale promotion；Detection speed is fast, and detection process takes around 2 hours and can completed.
The preferred embodiments of the present invention are the foregoing is only, are not intended to limit the scope of the invention, every utilization
The equivalent structure transformation that present specification is made, or directly or indirectly with the technology neck for being attached to other Related products
Domain, it is included within the scope of the present invention.
Claims (5)
1. a kind of kit for CTLA-4 mRNA detection of expression, it is characterised in that including specific reverse transcription primer, Q-
PCR specific primers and probe；
The specific reverse transcription primer includes following sequence：
CTLA-4 reverse transcriptions：5’CCCAGGTAGTATGGCGGTGG3’
GADPH reverse transcriptions：5’ATACGACCAAATCCGTTGACT3’
The following sequence of Q-PCR specific primers：
CTLA-4F:5’ATCCAAGGACTGAGGGCCAT3’
CTLA-4R:5’ATCTGGGTTCCGTTGCCTATG3’
GAPDHF:5’CTCTGCTCCTCCTGTTCGAC3’
GAPDHR:5’ATGGTGTCTGAGCGATGTGG3’
The probe includes following sequence：
CTLA-4taqman:5’-FAM-ctctacatctgcaagg-MGB-3’
GAPDHTaqman:5’CGTCGCCAGCCGA3’。
2. a kind of detection method for CTLA-4 mRNA detection of expression kits, it is characterised in that this method comprises at least such as
Lower step：
Step 1：Synthetic primer, detection probe are specifically designed for CTLA-4；
For selected CTLA-4 cDNA sequences, design primer using the primer-design softwares of primer 5.0 and detection is visited
Pin, primer and probe sequence；
Step 2：The extraction of RNA sample process and RNA, RNA is extracted using RNA extracts kits；
Step 3：Establish pcr amplification reaction system；
It is that cDNA is used as template through reverse transcription, with the detection of CTLA-4 kits, the collection of fluorescence signal by the RNA of above-mentioned acquisition
It is set to FAM, the collection of data is scheduled on 60 DEG C；
Step 4：Baseline Start values, End values and threshold line, result of determination are adjusted after analysis image.
3. according to a kind of detection method for CTLA-4 mRNA detection of expression kits of claim 2, it is characterised in that institute
Step 4 is stated to be analyzed, judged according to the following steps：
1st, no template control is run（NTC）When, FAM signals rise without curve, illustrate the pollution-free presence of experiment, can continue to analyze
Experimental conditions；
2nd, positive quality control product analysis is run, Ct value≤30.0 of all positive quality controls, illustrates that experimental system is normal, can continue point
Analyse experimental result；Its Ct value may also can be set and be fluctuated due to the different threshold values of different instruments；
3rd, the Ct values for running GAPDH calculate, and in FAM passages, if Ct value≤42.0, can continue to analyze；If Ct values>
42.0, then illustrate that sample rna degraded is serious, being not suitable for experiment needs；
4th, the definition and requirement of effective amplification curve：Typical amplification curve has three kinds of typical periods, background amplification phase early stage, in
Phase index expands the phase（Rise）The plateau risen with evening, curve global shape is S-type, and effective amplification curve at least needs early stage to carry on the back
Scape expands phase and Metaphase index amplification, and curve, can calculated curve Ct values in normal S types amplification trend；Remaining curve is considered as nothing
Curve is imitated, is not calculated；
5th, Ct calculating is run in FAM passages, according to the Ct values in each site and whether there is amplification curve, judges corresponding site feelings
Condition, concrete outcome result of determination are：
As a result interpretation is as follows：Sample CTLA-4 has S types curve and △ ct values>When 15, CTLA-4 weak expressions；10≤△ct≤15
When, express in CTLA-4；During △ ct values≤10, CTLA-4 strongly expresseds.
4. according to a kind of detection method for CTLA-4 mRNA detection of expression kits of claim 2, it is characterised in that institute
The RNA samples stated include fresh tumor tissue or fresh pathological tissue or paraffin-embedded tissue or fresh plasma.
5. according to a kind of detection method for CTLA-4 mRNA detection of expression kits of claim 2, it is characterised in that institute
RNA samples are stated as 1 gram or so.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710603540.2A CN107475372A (en) | 2017-07-23 | 2017-07-23 | A kind of kit for CTLA 4mRNA detection of expression |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710603540.2A CN107475372A (en) | 2017-07-23 | 2017-07-23 | A kind of kit for CTLA 4mRNA detection of expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107475372A true CN107475372A (en) | 2017-12-15 |
Family
ID=60596305
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710603540.2A Pending CN107475372A (en) | 2017-07-23 | 2017-07-23 | A kind of kit for CTLA 4mRNA detection of expression |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107475372A (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290120A (en) * | 2013-05-24 | 2013-09-11 | 厦门艾德生物医药科技有限公司 | Probe, primer and kit for detecting ALK (anaplastic lymphoma kinase) gene expression |
| CN105400873A (en) * | 2015-11-24 | 2016-03-16 | 武汉海吉力生物科技有限公司 | Primer, probe and kit for fluorescently and quantitatively detecting TOP2A gene expression through PCR method |
-
2017
- 2017-07-23 CN CN201710603540.2A patent/CN107475372A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103290120A (en) * | 2013-05-24 | 2013-09-11 | 厦门艾德生物医药科技有限公司 | Probe, primer and kit for detecting ALK (anaplastic lymphoma kinase) gene expression |
| CN105400873A (en) * | 2015-11-24 | 2016-03-16 | 武汉海吉力生物科技有限公司 | Primer, probe and kit for fluorescently and quantitatively detecting TOP2A gene expression through PCR method |
Non-Patent Citations (3)
| Title |
|---|
| MING GU ET AL: "Identification of CTLA-4 isoforms produced by alternative splicing and their association with myasthenia gravis", 《CLIN IMMUNOL》 * |
| X-B WANG ET AL: "Expression of CTLA-4 by human monocytes", 《SCAND J IMMUNOL》 * |
| 遇奇 等: "猪LFA-1和CTLA-4实时荧光定量PCR检测方法的建立", 《中国农学通报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104726570B (en) | The kit of lncRNA NEAT1 and its application in liver cancer serum diagnosis in a kind of detection serum | |
| CN105002182B (en) | Applications of the LncRNA GAS5 in diagnosis of glaucoma reagent is prepared | |
| CN107663533A (en) | A kind of lung cancer EGFR L858R and 19Del ddPCR detection methods and application | |
| CN107460239A (en) | A kind of kit for the detection of PD L1 expressions | |
| CN107400710A (en) | A kind of kit for the exon skipping deletion mutation of MET genes 14 | |
| CN101608240B (en) | Primers and probes for detecting human EGFR gene mutations as well as use method thereof | |
| CN107058528A (en) | A kind of ddPCR inspection optimizations method in lung cancer EGFR T790M sites and application | |
| CN104004840B (en) | Test kit for early screening Yu diagnosis of prostate cancer | |
| CN106987631A (en) | A kind of immune group sequencing technologies for the adjoint diagnosis of PD 1/PD L1 blocking treatments | |
| CN107177683B (en) | Bladder cancer screening and detecting kit | |
| CN104830989A (en) | Detection kit for fusion mutation of ROS1 and various genes | |
| CN109576370A (en) | Biomarker and detection kit for Diagnosis of Bladder and recurrence monitoring | |
| CN101855348A (en) | Gene associated with liver cancer, and method for determination of the risk of acquiring liver cancer | |
| CN108315410B (en) | DNA methylation marker, primer and its application of one group of assessment early abortion risk | |
| CN107619865A (en) | A kind of target spot and application for predicting Patients With Small Cell Carcinoma of The Lung to chemotherapy drug susceptibility | |
| CN107338305A (en) | A kind of kit for the detection of the expressions of PD 1 | |
| CN106148497A (en) | BRAF gene mutation detection kit and application thereof | |
| CN104962654B (en) | Applications of the lncRNA-MALAT1 in preparing proliferative vitreoretinopathy diagnostic reagent | |
| CN107475372A (en) | A kind of kit for CTLA 4mRNA detection of expression | |
| CN105296661A (en) | Kit for diagnosing tuberculosis by detecting free nucleic acid and application of kit | |
| CN110257514A (en) | A kind of new cancer of the esophagus blood miRNA marker and its application | |
| CN105177147A (en) | Plasma marker, primer pair and kit for diagnosis of vascular calcification and application | |
| CN109679945A (en) | It is a kind of for improving the settling agent of dissociative DNA recovery rate in plasma sample | |
| CN108531607A (en) | Diagnosis marker-C16orf74 the genes of clear cell carcinoma of kidney | |
| CN107475376A (en) | Predict label and kit of the ED-SCLC to chemotherapy drug susceptibility |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171215 |