CN107475269A - A kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and its application - Google Patents

A kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and its application Download PDF

Info

Publication number
CN107475269A
CN107475269A CN201710700527.9A CN201710700527A CN107475269A CN 107475269 A CN107475269 A CN 107475269A CN 201710700527 A CN201710700527 A CN 201710700527A CN 107475269 A CN107475269 A CN 107475269A
Authority
CN
China
Prior art keywords
ctaca
acyl group
candida tropicalis
coa
long
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201710700527.9A
Other languages
Chinese (zh)
Other versions
CN107475269B (en
Inventor
汪俊卿
王瑞明
修翔
苏静
杨晓慧
彭健
薛乐
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qilu University of Technology
Original Assignee
Qilu University of Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qilu University of Technology filed Critical Qilu University of Technology
Priority to CN201710700527.9A priority Critical patent/CN107475269B/en
Publication of CN107475269A publication Critical patent/CN107475269A/en
Application granted granted Critical
Publication of CN107475269B publication Critical patent/CN107475269B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/67—General methods for enhancing the expression
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/64—Fats; Fatty oils; Ester-type waxes; Higher fatty acids, i.e. having at least seven carbon atoms in an unbroken chain bound to a carboxyl group; Oxidised oils or fats
    • C12P7/6409—Fatty acids
    • C12P7/6427—Polyunsaturated fatty acids [PUFA], i.e. having two or more double bonds in their backbone

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and its application.The acyl group of the candida tropicalis-CoA thioester enzyme gene ctacA, nucleotide sequence is as shown in SEQ ID NO.1.The acyl group-CoA thioester zymoprotein CtAcA, amino acid sequence is as shown in SEQ ID NO.2.Present invention firstly discovers that acyl group-CoA thioester enzyme genes ctacA in candida tropicalis is the key gene in long-chain biatomic acid conversion process; it expresses the conversion that long-chain biatomic acid-CoA can be promoted to free long-chain biatomic acid, is laid the first stone to realize that new way synthesizes long-chain biatomic acid by raw material of grease.

Description

A kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and its application
Technical field
The present invention relates to a kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and its application, belong to genetic engineering Technical field.
Background technology
Long-chain biatomic acid generally refers to have the straight of carboxyl respectively containing more than 12 carbon atoms and α, ω position in carbochain Chain fatty race dicarboxylic acids.The product has higher industrial application value, and long-chain biatomic acid is the extraordinary nylon of synthesis, advanced musk deer The important chemical intermediate such as perfume, adhesive, PUR, medicine, agricultural chemicals.Production long-chain biatomic acid mainly has 2 both at home and abroad at present Kind method：Chemical method and fermentation method.Chemical method synthesis long-chain biatomic acid complex process, severe reaction conditions, cost is high, at present only There are a few countries such as the U.S., Germany using chemical synthesis production long-chain biatomic acid.Compared to chemical synthesis, microbe fermentation method By the features such as selectivity is strong, and raw material sources are wide, cost is low, reaction condition is gentle is reacted, just produced in substituted chemistry synthetic method Long-chain biatomic acid.Therefore numerous researchers have target diversion on the big microbial fermentation of broad based growth prospect, industrial value. Microbe fermentation method is using n-alkane as raw material, utilizes Candida tropicalis (Candida tropicalis) oxidisability Energy, the methyl at n-alkane both ends is aoxidized at normal temperatures and pressures, generate the binary acid of matrix alkane respective chain length.The current country is The industrialization of long carbochain biatomic acid is produced using alkane as fermenting substrate through realizing, 11 to 14 carbon two are prepared in bioanalysis First acid has been launched.Such as Chinese patent literature CN1570124A (application number 2004100182557), Chinese patent literature CN1844404A (application number CN200610038331X), Chinese patent literature CN101225411A (application numbers 2007101958427), Chinese patent literature CN102115769A (application number 2009102565907), Chinese patent literature CN102115768A (application number 2009102565890), Chinese patent literature CN102115766A (application numbers 2009102565871), Chinese patent literature CN102115765A (application number 2009102565867), Chinese patent literature CN102061316A (application number 2010101603101) and Chinese patent literature CN103805642A (application numbers 2012104397995) etc..
Reached its maturity in terms of the technology of Production by Microorganism Fermentation long-chain biatomic acid particularly Microbial Breeding at present, as in State's patent document CN105400796A (application number 201511003830) then discloses a kind of candida tropicalis and is positioned at peroxide Long chain fatty acids transporter gene pxa1p on compound enzyme body film, and block the synthesis of the gene to realize by genetic engineering The lifting of long-chain biatomic acid yield.Chinese patent literature CN103992959A (application number 2014101755564) passes through increase by one The CYP monooxygenase genes of individual copy improve the yield of candida tropicalis long-chain biatomic acid, Chinese patent literature CN102839133A (application number CN201110168672X) then induction mutation of bacterium breeding screen one plant of pox4 gene, fao genes and The mutant strain of CYP52A18 genes, mutant strain have very high convertibility to materials such as the alkane of different carbon chain lengths, aliphatic acid Energy.
It is still current grind however, having the bacterial strain and production method of higher long-chain biatomic acid production capacity for exploitation Study carefully focus.
The content of the invention
In view of the deficiencies of the prior art, the present invention provides a kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and It is applied.
Technical solution of the present invention is as follows：
A kind of acyl group-CoA thioester enzyme gene the ctacA, nucleotide sequence such as SEQ ID of regulation and control candida tropicalis Shown in NO.1.
The gene ctacA for regulating and controlling acyl group-CoA thioester enzymes of candida tropicalis derives from candida tropicalis, and it is expressed Conversions of the long-chain biatomic acid-CoA to free long-chain biatomic acid can be promoted.
A kind of acyl group-CoA thioester zymoprotein CtAcA, amino acid sequence is as shown in SEQ ID NO.2.
A kind of recombinant expression carrier, acyl group of the expression vector comprising just like nucleotide sequence shown in SEQ ID NO.1- CoA thioester enzyme genes ctacA.
A kind of recombinant cell, the recombinant cell include above-mentioned recombinant expression carrier or the above-mentioned acyl group-CoA thioesters of expression Enzyme gene ctacA.
Applications of the above-mentioned acyl group-CoA thioester enzyme gene ctacA in transformation candida tropicalis prepares long-chain biatomic acid.
It is as follows according to currently preferred, the application, step：
Structure acyl group-CoA thioester enzyme genes ctacA multicopy restructuring Candida or replacing promoter realizes acyl Base-CoA thioester enzyme genes ctacA overexpression.
Multicopy by building acyl group-CoA thioester enzyme genes ctacA recombinates Candida or changes promoter and realizes Acyl group-CoA thioester enzyme genes ctacA overexpression, so as to improve candida tropicalis intracellular long-chain biatomic acid- CoA is to the switching rate of free long-chain biatomic acid, and increase product long-chain biatomic acid converts and reduces in-fighting, and then it is false to improve the torrid zone The yield and yield of silk yeast long-chain biatomic acid.
Beneficial effect
Present invention firstly discovers that acyl group-CoA thioester enzyme gene ctacA in candida tropicalis turn for long-chain biatomic acid Key gene during change, it expresses the conversion that long-chain biatomic acid-CoA can be promoted to free long-chain biatomic acid, is with oil Fat is that raw material realizes that new way synthesizes long-chain biatomic acid and laid the first stone.
Brief description of the drawings
Fig. 1, candida tropicalis original bacteria and candida tropicalis mutant bacteria growth curve；
Fig. 2, candida tropicalis original bacteria and candida tropicalis mutant bacteria long-chain biatomic acid fermentation results block diagram；
Embodiment
Technical scheme is further elaborated with reference to embodiment, but institute's protection domain of the present invention is not limited to This.
Biological material source：
Plasmid pPIC9K is purchased from precious biological Co., Ltd；
Candida tropicalis (Candida tropicalis) is purchased from Chinese industrial Culture Collection (CICC)； Bacterium numbering is CICC1798；
The checking of the candida tropicalis ctacA gene functions of embodiment 1
1st, the construction method of candida tropicalis gene engineering recombinant bacterium, step are as follows：
(1) genomic DNA of candida tropicalis (Candida tropicalis) thalline is extracted, and with genomic DNA For template, enter performing PCR amplification, obtain homology arm ctacA1, length 523bp, described PCR primer sequence is as follows：
CtacA F1:GGAATTCCCACTATTTTGGCAGAGTT；
CtacA R1:CTGGCAAACTTTCTTCGTCATGATACCTGCT；
Wherein, underscore is identified as EcoR I restriction enzyme sites；
Described PCR amplification system is 50 μ l：
The μ l of 2 × HiFi-PCR master 25,10 μm of ol/L of concentration primer CtacA F12.5 μ l, 10 μm of ol/L of concentration Primer CtacA R12.5 μ l, the μ l of template 2.5, use ddH2O supplies 50 μ l；
Described PCR amplification programs are as follows：
95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 30 circulate；72 DEG C extension 10min, -20 DEG C preservation；
(2) pPIC9K plasmids are extracted, and as template, enters performing PCR amplification, obtains Kan fragments, length 1523bp, institute The PCR primer sequence stated is as follows：
Kan F2:TCTTGGGGTTGAGGCCGTTGAGCA；
Kan R2:ATTGTGTGAATTCAGTGAGTCAGTCATCAGG；
Wherein, underscore is identified as EcoR I restriction enzyme sites；
Described PCR amplification system is 50 μ l：
The μ l of 2 × HiFi-PCR master 25,10 μm of ol/L of concentration primer Kan-F22.5 μ l, 10 μm of ol/L's of concentration Primer Kan-R22.5 μ l, the μ l of template 2.5, use ddH2O supplies 50 μ l；
Described PCR amplification programs are as follows：
95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30sec, 55 DEG C of annealing 30sec, 72 DEG C of extension 3.5min, 30 circulate；72 DEG C extension 10min, -20 DEG C preservation；
(3) kan fragments made from CtacA1 fragments made from step (1) and step (2) are subjected to over-lap PCR, be made CtacA1-kan fragments, length 2046bp；The first amplification system of described over-lap PCR is 25 μ l：
The μ l of CtacA1 fragments 4；The μ l of kan fragments 4；2×HiFi-PCR master 12.5μl；ddH2O 4.5μl；
The first amplification program of described over-lap PCR is as follows：
95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30sec, 57 DEG C of annealing 30sec, 72 DEG C of extension 1.5min, 5 circulate；72 DEG C extension 2min；
The supplement amplification system of described over-lap PCR is 25 μ l：
Sense primer CtacA F12μl；Anti-sense primer Kan R22μl；2×HiFi-PCR master 12.5μl；ddH2O 8.5μl；
The supplement amplification program of described over-lap PCR is as follows：
95 DEG C of pre-degeneration 5min；94 DEG C of denaturation 30sec, 58 DEG C of annealing 30sec, 72 DEG C of extension 5min, 30 circulate；72℃ Extend 10min, -20 DEG C of preservations；
2nd, candida tropicalis competence is prepared, step is as follows：
(i) candida tropicalis (Candida tropicalis) is inoculated into the culture medium of growing microorganism containing 50ml In 250ml triangular flasks, 30 DEG C, 200rpm/min, incubator overnight culture；
The growing microorganism culture medium, every liter of component are as follows：
Glucose 2g, peptone 2g, yeast extract 1g, pH are natural；
(ii) bacterium solution being incubated overnight is applied to solid YPD culture mediums, 30 DEG C of 1~2d of culture, obtains the false silk ferment in the torrid zone Female (Candida tropicalis) single bacterium colony；Fallen on oese picking single bacterium in 50ml growing microorganism culture mediums, 30 DEG C, 200rpm/min cultivates 12h, switching, cultivates 10h；
The YPD solid mediums, every liter of component are as follows：
Glucose 2g, peptone 2g, yeast extract 1g, agar 2g, pH are natural；
(iii) 1.5ml bacterium solutions are taken into Ep pipes, 3000rpm/min, centrifuge 1min, thalline are collected, with 1.5ml precoolings Sterilized water blows and beats suspension cell；
(iv) 3000rpm/min, 1min is centrifuged, supernatant is abandoned, with the sterilized water suspension cell of 1ml precoolings；
(v) 3000rpm/min, 1min is centrifuged, supernatant is abandoned, with the sorbierite suspension cell of 1ml 1mol/L precoolings；
(vi) 3000rpm/min, 1min is centrifuged, supernatant is abandoned, with the sorbierite suspension cell of 80 μ L precoolings, that is, the torrid zone is made Candida electricity transformed competence colibacillus；The competent cell prepared is placed in into -80 DEG C to save backup.
3rd, CtacA1-kan fragments are converted into Candida tropicalis cells
(i) by the restriction enzyme EcoR I digestions of obtained CtacA1-kan fragments, digestion system is as follows, total system 40μL：
(ii) digestion products are concentrated and purified
(1) 1/10 volume 3M sodium acetates and 2.5 times of volume absolute ethyl alcohols are added, are placed in -20 DEG C of refrigerator 20min；
(2) 12000r/min, centrifugation 5min must be precipitated；
Precipitation is resuspended in the ethanol that (3) 300 μ L percents by volume are 70%；
(4) 12000r/min, 5min is centrifuged, removes ethanol, 37 DEG C of air-dried 30min；
(5) 15~18 μ L ddH are added2DNA is resuspended in O, is placed in -20 DEG C of preservations.
(iii) electricity conversion
CtacA1-kan fragment concentrations are determined using nucleic acid ultramicrospectrophotometer (BioFuture MD2000), are reached Electric conversion is carried out after the μ g/ml of concentration 500, electric conversion condition is 1500V, 5ms, then in the resuscitation fluid of the sorbierite containing 1mol/L Cultivate, take 100 μ L to be coated on the YPD solid mediums containing 1mg/mLG418 (Geneticin) after obtained cell recovery, 30 DEG C are cultivated 3 days, transformant of the screening with G418 resistances；
The resuscitation fluid is 1mol/L sorbierite；
The YPD solid mediums, every liter of component are as follows：
Glucose 2g, peptone 2g, yeast extract 1g, agar 2g, pH are natural.
4th, the culture and identification of positive restructuring bacterium
The transformant that above-mentioned screening obtains is inoculated into overnight incubation in the YPD fluid nutrient mediums of the resistance containing G418, drawn 1mL bacterium solutions, using Shanghai bioengineering Co., Ltd provide kit extract genomic DNA, using the genomic DNA of acquisition as Template, CtacA F1With Kan R2Enter performing PCR amplification for primer.Agarose gel electrophoresis proves that exogenous sequences ctacA1-kan turns Change onto genome.
The YPD fluid nutrient mediums, every liter of component are as follows：
Glucose 2g, peptone 2g, yeast extract 1g, pH are natural.
Fermented using above-mentioned candida tropicalis gene engineering recombinant bacterium and verify that knocking out ctacA gene pairs cell absorbs grease The method of the influence of speed, step are as follows：
Candida tropicalis original bacteria and above-mentioned recombinant bacterium seed liquor are inoculated in YPD fluid nutrient mediums respectively, 30 DEG C Under the conditions of cultivate 20 hours；Every two hours survey an OD600, the growth curve of candida tropicalis original bacteria and recombinant bacterium is produced, As a result it is as shown in Figure 1.
The fermentation medium component is as follows：
Peptone 20g, dusty yeast 10g, glucose 20g, water are prepared, pH 7.0.
According to Fig. 1 OD600Value understands the growth rate and candida tropicalis original bacteria of the candida tropicalis after recombinating Similar, showing the knockout of the gene does not influence the metabolism of the glucose carbon source of candida tropicalis.
The candida tropicalis ctacA genes multi-copy strains of embodiment 2 are built
On the basis of ctacA full-length genes are obtained, design specific primer clone's target gene, pass through seamless clone's skill Carrier and target gene are configured recombining reaction system by art, carry out recombining reaction.It is transformed into DH5 α competence, positive gram of screening Longzi.Extraction plasmid electricity is transferred in candida tropicalis competence after sequencing is correct.Fermentation checking increase ctacA gene copy numbers The influence of grease speed is absorbed to cell.Its technological core is to utilize homologous recombination principle, and carrier is linearized, and Insert Fragment PCR primer 5 ' end introduce linearized vector end sequence so that the least significant end of PCR primer 5 ' and 3 ' be respectively provided with The consistent sequence in the end of linearized vector two (15bp~20bp).This both ends carry the PCR primer and line of carrier end sequence Property carrier mix by a certain percentage after, under the catalysis of seamless exchange enzyme, it is only necessary to reacting 30min can be converted, complete Directed cloning, positive rate is up to more than 95%.Comprise the following steps that：
(i) genomic DNA of candida tropicalis (Candida tropicalis) thalline is extracted, and with genomic DNA For template, enter performing PCR amplification, obtain ctacA genes, length 3325bp, described PCR primer sequence is as follows：
CtacA F2:ctcactatagggagagcggccgcTTCTTCATAATAATGCTAACTT；
CtacA R2:catccggaagatctggcggccgcATTATAATAATTTGATTTTC；
Wherein, underscore is identified as Not I restriction enzyme sites；
Described PCR amplification system is 50 μ l：
2 × PhantaMaster Mix25 μ l, 10 μm of ol/L of concentration primer CtacA F22.5 μ l, 10 μm of ol/L of concentration Primer CtacA R22.5 μ l, the μ l of template 2.5, use ddH2O supplies 50 μ l；
Described PCR amplification programs are as follows：
95 DEG C of pre-degeneration 5min；95 DEG C of denaturation 15sec, 51 DEG C of annealing 15sec, 72 DEG C of extension 2min, 30 circulate；72℃ Extend 5min, -20 DEG C of preservations；
(ii) by plasmid vector restriction enzyme Not I digestions, digestion system is as follows, the μ L of total system 50：
Described carrier is the pZERO-Blunt cloning vectors with G418 resistance labels that laboratory has been built；
(iii) digestion products are purified using SanPrep pillar PCR primer purification kits post, and post purified product removes phosphoric acid Restructuring system is configured after change and carries out recombining reaction, reaction product conversion, coated plate, picking single bacterium colony is reflected using bacterium colony PCR method Determine positive clone molecule；Deliver to that Shanghai is rich to be still sequenced.
Described dephosphorylation system is as follows：
Described restructuring system is as follows：
Described PCR primer sequence is as follows：
CtacA F2:ctcactatagggagagcggccgcATAGAAGAGTTATTAAAATG；
CtacA R2:catccggaagatctggcggccgcATACCACACAGAGAGAATACAT；
(iv) after confirming that the information of sequence is correct, corresponding plasmid is extracted, electricity is transferred in candida tropicalis competence, step Suddenly as described in embodiment 1- (iii), the culture and identification of positive restructuring bacterium are as described in Example 1.
Checking increase ctacA gene copy numbers are fermented to binary acid using above-mentioned candida tropicalis gene engineering recombinant bacterium The method of yield effect, step are as follows：
Multicopy is recombinated into Candida tropicalis and candida tropicalis original bacteria and candida tropicalis gene work Journey recombinant bacterium is inoculated in YPD fluid nutrient mediums respectively, is cultivated 14 hours under the conditions of 30 DEG C；Take 10ml multicopy recombinant bacterium bacterium solutions It is inoculated into 100ml fermentation mediums with 10ml original bacterias bacterium solution and 10ml recombinant bacteriums bacterium solution, adds respectively after cultivating 12h respectively Enter 5ml greases, into the production sour phase；The sour phase is being produced, per 12h or 24h adjusts pH to 7.5, produces sour 4~5 days phases.
The fermentation medium component is as follows：
Glucose 64g/L, (NH4)2SO41g/L, yeast extract 2g/L, VB1 0.1g/L、NaCl 2g/L、KH2PO4 4g/L、 Na2HPO4·12H2O 10.08g/L, urea 2g/L, Mg2SO4·7H2O 6.15g/L, water are prepared, pH 7.0；
The yield of binary acid is measured using the method for acid base titration after fermentation ends, as a result as shown in Figure 2.
The long-chain biatomic acid (DCA) for understanding the Candida tropicalis after recombinating according to Fig. 2 long-chain biatomic acid yield produces Amount compared with candida tropicalis original bacteria compared to greatly reducing, the long-chain biatomic acid yield of multicopy restructuring Candida tropicalis compared with Candida tropicalis original bacteria, which is compared, improves 58%, and thalline does not show showing for undergrowth because of copy number increase As.It follows that the ability of yeast conversion production long-chain biatomic acid strengthens after ctacA gene copy number increases, show ctacA bases Because candida tropicalis long-chain biatomic acid converts key gene.
SEQUENCE LISTING
<110>Qilu University of Technology
<120>A kind of acyl group-CoA thioesters the enzyme gene of candida tropicalis and its application
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 1401
<212> DNA
<213> Candida tropicalis
<400> 1
atgaatcctg ctgaggctgc agatgcagca gccactattt tggcagagtt gcgagataag 60
caaatcaatc caaataaagt aacttggata gatgcattaa aagaacgtga aaaattgcgt 120
gccgagggga aaacaataga tagttttagt tatgttgatc caaagaccac agttgtcggt 180
gagaaaacac gaagtgattc attttctttc ttattattac cttttaagga cgataaatgg 240
ctttgcgacg catacataaa tgcttttgga cgacttagag tggcccaatt atttcaagat 300
cttgatgcac ttgccggtag aattgcttat agacattgtt ctcctgctga accagttaat 360
gtcacagcaa gtgtggatag agtatatatg gtgaagaaag tcgatgagat taacaactat 420
aattttgttt tagctggttc tgttacttgg actggtagat cttccatgga gatcacagtg 480
aaaggttacg catttgaaga tgctgttcct gaaatcacta acgaagaaag tttgccagca 540
gagaacgtgt ttttggctgc taatttcaca ttcgttgcaa gaaatccact tacacataaa 600
tcatttgcta taaaccgatt attacctgtc acagaaaaag attggattga ttatagaaga 660
gctgaatccc ataatgctaa aaagaagtta atggctaaga ataaaaagat acttgagcca 720
accgcagagg aatctaaatt gatctacgac atgtggaaat cctcaaaatc tttaaaaaat 780
attgatcgtc aggatgatgg aatagcattt atgaaggaca ccacaatgaa aagtaccatg 840
tttatgcaac ctcaatatag aaacagacat tcttatatga tttttggtgg ttacttatta 900
cgtcaaacat tcgagcttgc ctattgtaca gcagccacct tttcattagc cggaccaaga 960
tttgttagtt tagattcaac tacttttaaa aatccagttc ctgtcggttc agtcttaacc 1020
atggactcct ctatttctta caccgaacac gtacacgatg ggatagaaga gatagactct 1080
gattctcctt ttaatttctc tcttcctgcc actaataagt tgtccaagaa tccagaagca 1140
ttcttgtcag aacctgggac tttgattcaa gtcaaagtag atacttatat tcagcaattg 1200
gaacagtcag aaaagaagcc agccggtacc ttcatatatt ctttctacgt tccaaaggaa 1260
agtgtcagtg tggatggtaa agcttcttat tgtaccgtta tcccacagac ttactctgaa 1320
atgatgacat atgttggtgg tagaagaaga gcacaggaaa ccgctaatta tgtagaaact 1380
ttaccaagta ctaacaacta a 1401
<210> 2
<211> 466
<212> PRT
<213> Candida tropicalis
<400> 2
Met Asn Pro Ala Glu Ala Ala Asp Ala Ala Ala Thr Ile Leu Ala Glu
1 5 10 15
Leu Arg Asp Lys Gln Ile Asn Pro Asn Lys Val Thr Trp Ile Asp Ala
20 25 30
Leu Lys Glu Arg Glu Lys Leu Arg Ala Glu Gly Lys Thr Ile Asp Ser
35 40 45
Phe Ser Tyr Val Asp Pro Lys Thr Thr Val Val Gly Glu Lys Thr Arg
50 55 60
Ser Asp Ser Phe Ser Phe Leu Leu Leu Pro Phe Lys Asp Asp Lys Trp
65 70 75 80
Leu Cys Asp Ala Tyr Ile Asn Ala Phe Gly Arg Leu Arg Val Ala Gln
85 90 95
Leu Phe Gln Asp Leu Asp Ala Leu Ala Gly Arg Ile Ala Tyr Arg His
100 105 110
Cys Ser Pro Ala Glu Pro Val Asn Val Thr Ala Ser Val Asp Arg Val
115 120 125
Tyr Met Val Lys Lys Val Asp Glu Ile Asn Asn Tyr Asn Phe Val Leu
130 135 140
Ala Gly Ser Val Thr Trp Thr Gly Arg Ser Ser Met Glu Ile Thr Val
145 150 155 160
Lys Gly Tyr Ala Phe Glu Asp Ala Val Pro Glu Ile Thr Asn Glu Glu
165 170 175
Ser Leu Pro Ala Glu Asn Val Phe Leu Ala Ala Asn Phe Thr Phe Val
180 185 190
Ala Arg Asn Pro Leu Thr His Lys Ser Phe Ala Ile Asn Arg Leu Leu
195 200 205
Pro Val Thr Glu Lys Asp Trp Ile Asp Tyr Arg Arg Ala Glu Ser His
210 215 220
Asn Ala Lys Lys Lys Leu Met Ala Lys Asn Lys Lys Ile Leu Glu Pro
225 230 235 240
Thr Ala Glu Glu Ser Lys Leu Ile Tyr Asp Met Trp Lys Ser Ser Lys
245 250 255
Ser Leu Lys Asn Ile Asp Arg Gln Asp Asp Gly Ile Ala Phe Met Lys
260 265 270
Asp Thr Thr Met Lys Ser Thr Met Phe Met Gln Pro Gln Tyr Arg Asn
275 280 285
Arg His Ser Tyr Met Ile Phe Gly Gly Tyr Leu Leu Arg Gln Thr Phe
290 295 300
Glu Leu Ala Tyr Cys Thr Ala Ala Thr Phe Ser Leu Ala Gly Pro Arg
305 310 315 320
Phe Val Ser Leu Asp Ser Thr Thr Phe Lys Asn Pro Val Pro Val Gly
325 330 335
Ser Val Leu Thr Met Asp Ser Ser Ile Ser Tyr Thr Glu His Val His
340 345 350
Asp Gly Ile Glu Glu Ile Asp Ser Asp Ser Pro Phe Asn Phe Ser Leu
355 360 365
Pro Ala Thr Asn Lys Leu Ser Lys Asn Pro Glu Ala Phe Leu Ser Glu
370 375 380
Pro Gly Thr Leu Ile Gln Val Lys Val Asp Thr Tyr Ile Gln Gln Leu
385 390 395 400
Glu Gln Ser Glu Lys Lys Pro Ala Gly Thr Phe Ile Tyr Ser Phe Tyr
405 410 415
Val Pro Lys Glu Ser Val Ser Val Asp Gly Lys Ala Ser Tyr Cys Thr
420 425 430
Val Ile Pro Gln Thr Tyr Ser Glu Met Met Thr Tyr Val Gly Gly Arg
435 440 445
Arg Arg Ala Gln Glu Thr Ala Asn Tyr Val Glu Thr Leu Pro Ser Thr
450 455 460
Asn Asn
465

Claims (6)

1. a kind of acyl group of candida tropicalis-CoA thioester enzyme gene ctacA, nucleotide sequence is as shown in SEQ ID NO.1.
2. a kind of acyl group-CoA thioester zymoprotein CtAcA, amino acid sequence is as shown in SEQ ID NO.2.
3. a kind of recombinant expression carrier, the expression vector includes acyl group-CoA just like nucleotide sequence shown in SEQ ID NO.1 Thioester enzyme gene ctacA.
4. a kind of recombinant cell, the recombinant cell includes recombinant expression carrier described in claim 3 or expression claim 1 institute State acyl group-CoA thioester enzyme genes ctacA.
5. acyl group described in claim 1-CoA thioester enzyme gene ctacA are prepared in transformation candida tropicalis in long-chain biatomic acid Application.
6. application as claimed in claim 5, it is characterised in that step is as follows：
Structure acyl group-CoA thioester enzyme genes ctacA multicopy restructuring Candida or replacing promoter realizes acyl group-CoA Thioester enzyme gene ctacA overexpression.
CN201710700527.9A 2017-08-16 2017-08-16 acyl-CoA thioesterase gene of candida tropicalis and application thereof Active CN107475269B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710700527.9A CN107475269B (en) 2017-08-16 2017-08-16 acyl-CoA thioesterase gene of candida tropicalis and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710700527.9A CN107475269B (en) 2017-08-16 2017-08-16 acyl-CoA thioesterase gene of candida tropicalis and application thereof

Publications (2)

Publication Number Publication Date
CN107475269A true CN107475269A (en) 2017-12-15
CN107475269B CN107475269B (en) 2020-11-24

Family

ID=60599653

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710700527.9A Active CN107475269B (en) 2017-08-16 2017-08-16 acyl-CoA thioesterase gene of candida tropicalis and application thereof

Country Status (1)

Country Link
CN (1) CN107475269B (en)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1614004A (en) * 2004-12-07 2005-05-11 清华大学 Constructing method for candida tropicalis gene engineering recombinant bacterium
CN102839133A (en) * 2011-06-21 2012-12-26 上海凯赛生物技术研发中心有限公司 Strain producing long chain dibasic acid, and application thereof
US20140228586A1 (en) * 2011-07-06 2014-08-14 Verdezyne, Inc. Biological methods for preparing a fatty dicarboxylic acid
CN103992959A (en) * 2014-04-28 2014-08-20 中国科学院微生物研究所 Long-chain dibasic acid producing strain and preparation method and application thereof
CN105189731A (en) * 2012-12-19 2015-12-23 沃德金有限公司 Biological methods for preparing a fatty dicarboxylic acid
CN106754979A (en) * 2016-12-26 2017-05-31 齐鲁工业大学 A kind of gene of long-chain fat acid transporter of regulation and control candida tropicalis and its application

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1614004A (en) * 2004-12-07 2005-05-11 清华大学 Constructing method for candida tropicalis gene engineering recombinant bacterium
CN102839133A (en) * 2011-06-21 2012-12-26 上海凯赛生物技术研发中心有限公司 Strain producing long chain dibasic acid, and application thereof
US20140228586A1 (en) * 2011-07-06 2014-08-14 Verdezyne, Inc. Biological methods for preparing a fatty dicarboxylic acid
CN105189731A (en) * 2012-12-19 2015-12-23 沃德金有限公司 Biological methods for preparing a fatty dicarboxylic acid
CN103992959A (en) * 2014-04-28 2014-08-20 中国科学院微生物研究所 Long-chain dibasic acid producing strain and preparation method and application thereof
CN106754979A (en) * 2016-12-26 2017-05-31 齐鲁工业大学 A kind of gene of long-chain fat acid transporter of regulation and control candida tropicalis and its application

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BUTLER,G.,: "conserved hypothetical protein [Candida tropicalis MYA-3404]", 《NCBI REFERENCE SEQUENCE: XP_002551441.1》 *
BUTLER,G.,ET AL: "conserved hypothetical protein [Candida tropicalis MYA-3404]", 《GENBANK: EER30743.1》 *

Also Published As

Publication number Publication date
CN107475269B (en) 2020-11-24

Similar Documents

Publication Publication Date Title
CN110106206B (en) Corynebacterium glutamicum construction method for improving yield and stability of L-lysine
CN103305536B (en) Laccase gene and engineering bacteria and purposes
CN110951667B (en) Fenogen element high-yield strain LPB-18N and breeding and application thereof
CN107815446B (en) A kind of fermentation process in high density of recombination nitrile hydratase Recombinant organism
CN105400796A (en) Gene for adjusting and controlling production of long-chain diacid and application of gene
CN104619852A (en) L-lysine generation method by fermenting bacteria having modified aconitase gene and/or regulatory element
CN106754979A (en) A kind of gene of long-chain fat acid transporter of regulation and control candida tropicalis and its application
CN113073074B (en) Genetically engineered bacterium for efficiently synthesizing riboflavin and application thereof
CN106995794A (en) A kind of Actinobacillus succinogenes engineered strain and its construction method and purposes for improving succinic acid yield
CN111019948B (en) Fenjunsu anabolism regulation gene FenSr3 and application thereof
CN107287144A (en) A kind of Metabolically engineered bacillus subtilis bioconversion cell and preparation method and application
US20210324391A1 (en) Recombinant microorganism, preparation method therefor and application thereof in producing coenzyme q10
CN114958636B (en) Recombinant yarrowia lipolytica capable of producing punica granatum at high yield as well as construction method and application thereof
CN107475269A (en) A kind of acyl group of candida tropicalis-CoA thioesters enzyme gene and its application
Laptev et al. New recombinant strains of the yeast Yarrowia lipolytica with overexpression of the aconitate hydratase gene for the obtainment of isocitric acid from rapeseed oil
CN108034642A (en) Glucose oxidase CnGOD19 and its modified enzyme, gene and application
CN107488670A (en) A kind of gene of long-chain biatomic acid transhipment of regulation and control candida tropicalis and its application
CN109097315B (en) Genetically engineered bacterium for high-yield lipopeptide and construction method and application thereof
CN101892228B (en) Engineering bacteria with high tolerance to acrylamide and acrylonitrile for producing nitrile hydratase and application thereof
CN104962574B (en) A kind of arthrobacterium expression plasmid and application
CN110468091A (en) Microorganism and application thereof
CN114456964B (en) Recombinant yarrowia lipolytica for high yield of stigmasterol, construction method thereof, fermentation medium for producing stigmasterol and application
CN108220215B (en) GlnR protein binding site mutated ammonium-resistant nitrogen-fixing microorganism and construction method and application thereof
CN115851692A (en) Beta-caryophyllene synthase mutant, coding gene and application thereof in beta-caryophyllene synthesis
CN116640678A (en) Recombinant saccharomyces cerevisiae strain for synthesizing gibberellin 7 and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: Wang Junqing

Inventor after: Li Nan

Inventor after: Xiu Xiang

Inventor after: Wang Ruiming

Inventor after: Su Jing

Inventor after: Yang Xiaohui

Inventor after: Peng Jian

Inventor after: Xue Le

Inventor before: Wang Junqing

Inventor before: Wang Ruiming

Inventor before: Xiu Xiang

Inventor before: Su Jing

Inventor before: Yang Xiaohui

Inventor before: Peng Jian

Inventor before: Xue Le

GR01 Patent grant
GR01 Patent grant