CN107475255B

CN107475255B - Gene vector mediated sgRNA based on CRISPR/Cas9 gene editing system and application thereof

Info

Publication number: CN107475255B
Application number: CN201710167563.3A
Authority: CN
Inventors: 段伟松; 吴小兵; 李春岩
Original assignee: BEIJING FIVEPLUS MOLECULAR MEDICINE INSTITUTE CO LTD; Beijing Ruixi Rare Disease Gene Treatment Technology Institute; Second Hospital of Hebei Medical University
Current assignee: Second Hospital of Hebei Medical University
Priority date: 2017-03-21
Filing date: 2017-03-21
Publication date: 2021-03-26
Anticipated expiration: 2037-03-21
Also published as: CN107475255A

Abstract

The invention provides a gene therapy method for treating Amyotrophic Lateral Sclerosis (ALS) in vitro and transgenic mice by directly editing a Superoxide Dismutase 1 (SOD 1) mutant gene based on a CRISPR/Cas9 gene editing system mediated by a gene vector (including but not limited to type 9 adeno-associated virus). The recombinant virus provided by the invention is biologically active and is expected to become a candidate virus for ALS gene therapy.

Description

Gene vector mediated sgRNA based on CRISPR/Cas9 gene editing system and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to an AAV9 viral vector-mediated sgRNA based on a CRISPR/Cas9 gene editing system and application thereof, and a composition, a recombinant expression vector and a gene therapy mode of the sgRNA.

Background

Amyotrophic Lateral Sclerosis (ALS) is a fatal neurodegenerative disease, one type of motor neuron disease (ALS/MND), and the most common adult-onset motor neuron disease. ALS, Alzheimer's disease and Parkinson's disease are common degenerative diseases of the nervous system, but the development speed and the nature of ALS are more serious than those of other two degenerative diseases. The patient is characterized in that the motor neurons of the spinal cord, the brain stem and the cerebral cortex are degenerately changed, and the patient shows that progressive muscle is powerless and mostly dies from respiratory failure; adult onset, median survival is only 3-5 years [1 ]. The prevalence rate is 4-6/10 ten thousand, and the incidence rate is 1-3/10 ten thousand. To date, no effective treatment has been available [2 ]. The clinical medicine for treating ALS can only delay the course of disease for months. ALS is often called "cancer which is not cancer" by neurologists. The disease is well developed in middle-aged people, namely main support people of the society and families, so that heavy burden is brought to the families, and serious harm is caused to the country and the society. By establishing effective treatment measures, the pain of the patient can be relieved, and the burden on families, countries and society can be relieved.

ALS is common in sporadic patients, accounting for about 90% of total patients and 10% of familial patients. Genetic mutations are the clear cause of ALS identification. Related virulence genes have been found in more than 50% of Familial Amyotrophic Lateral Sclerosis (FALS) patients, including: c9orf72 (24%), SOD1 (20%), TDP-43 (5%), FUS (5%), etc. Patients with Sporadic Amyotrophic Lateral Sclerosis (SALS) include: c9orf72 (4%), SOD1 (2%), TDP-43 (1%), FUS (1%), etc. [3 ]. The repair of the mutant gene by gene editing may fundamentally prevent motor neuron degeneration.

Clustered regularly interspaced short palindromic repeats-CRISPR associated protein 9(CRISPR-Cas9) system is a recently established gene editing system for DNA modification by RNA regulation that can be applied in eukaryotic cells. Compared with other editing systems, such as Zinc Finger Nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), the CRISPR-Cas9 system has the characteristics of higher editing efficiency and targeting, easy targeting, multi-site modification and the like [4,5 ]. The Cas9 nuclease mediates double-strand break of 3 bases at the upstream of the adjacent sequence (PAM sequence, NGG) in the original region of the target gene under the guidance of sgRNA, the HNH domain on Cas9 cuts a complementary single-stranded DNA with sgRNA, the Ruv C domain cuts a non-complementary single-strand, and non-homologous end joining (NHEJ) is performed through endogenous DNA repair to form insertion or deletion mutation (indel mutation) to complete gene knockout; homologous recombination Repair (HDR) is accomplished in the presence of the template strand [6-8 ].

Adeno-associated virus (AAV) vectors are becoming increasingly important as a new class of safety vectors. It is a parvovirus family member, is a non-enveloped linear single-stranded DNA virus, has a wide host range, can infect both dividing and non-dividing cells, and can mediate long-term expression of foreign genes. As an important member of viral vectors, AAV has no significant cytotoxic effects and does not elicit a cellular strong immune response as other viral vectors do; meanwhile, when the recombinant AAV is constructed, the coding sequence can be completely deleted, and only the terminal repetitive sequence of 145bp is reserved, so that the possibility of recombination and self-protein expression of the AAV is effectively reduced, and the safety is further improved. Thus, AAV is gaining increasing interest and interest as an ideal gene therapy vector [9,10 ].

Chengzu Long et al used the CRISPR-Cas9 system in Duchenne Muscular Dystrophy (DMD) transgenic mice to complete the repair of mutant genes in fertilized oocyte, and observed that the newly born mice could achieve complete restoration of phenotype by only partial cell gene repair [11 ]. Lukasz Swiech et al established a system for separate expression of AAV-Spguide and AAV-SpCas9, and through 1:1 mixed injection in mouse hippocampus, the co-transduction efficiency of the AAV-Spguide and SpCas9 was 75%, the off-target rate was 0-1.6%, and AAV-mediated expression of SpCas9 in neurons showed no toxicity to neurons. Furthermore, the authors observed that AAV-mediated modification of the Dnmt1 allele with > 60% efficiency and that the rates of modification of the Dnmt3a and Dnmt3b alleles were 42% and 17%, respectively; the expression of the Dnmt1 protein level is obviously reduced, the Dnmt3a protein is reduced by more than 50 percent, and the Dnmt3b protein is hardly detected. These results suggest that the CRISPR-Cas9 system can repair the mutated gene by non-homologous end joining to achieve therapeutic effect [12 ]. Recently, Zhang Feng et al realized sgRNA and sacAS9 to be expressed in one AAV vector, and the number of coding bases of sacAS9 is 25% less than that of spCas9, further improving the efficiency of gene editing [13,14 ].

Amyotrophic lateral sclerosis due to SOD1 gene mutation was 20% in familial ALS and 2% in sporadic ALS. The mechanism by which SOD1 mutations cause motor neuron degeneration is not known and may be associated with oxidative stress, endoplasmic reticulum stress, mitochondrial dysfunction, abnormal proteasome/autophagy pathways, nutritional disorders, activation of glial cells, and the like. However, the neurotoxicity of mutant SOD1 is an acquired toxicity, not associated with loss of function following SOD1 mutation [15 ]. Therefore, the CRISPR-Cas9 system is used for carrying out gene editing on the mutant SOD1 gene, a sequence of SOD1 is modified on the DNA level, the mutant SOD1 gene is knocked out through endogenous DNA repair, and the acquired toxicity of the mutant SOD1 is removed.

SOD1-G93A hemizygous transgenic mice are good animal models for studying neuromuscular disorders, such as ALS or Gray's disease. The transgenic mouse expresses G93A mutation of SOD1 gene with high copy number, so that paralysis of one or more limbs caused by spinal cord motor neuron damage shows phenotype similar to human ALS. Therefore, SOD1^G93AGene expression patterns can become unique signature ALS animal models.

The editing of mutant genes in mutant SOD1 transgenic mice also requires a vector system capable of targeting motor neurons. Adeno-associated virus 9 is a vector virus with low toxicity and low immunogenicity, and can be clinically used for targeting motor neurons through axonal retrograde transport [16-18 ]. In 2012, the european medicines agency approved the insertion of an active LPL gene into muscle cells by adeno-associated virus to treat lipoprotein lipase deficiency. In recent clinical experiments, it was confirmed that adeno-associated virus vectors can carry therapeutic genes and achieve therapeutic effects for curing or controlling disease progression for diseases that have no therapeutic means at present, such as hemophilia, choroideremia, etc. [19,20 ].

Therefore, in vivo editing of the mutated SOD1 gene by combining the CRISPR-Cas9 system with the AAV9 vector system targeting motor neuron transportation is a method capable of fundamentally solving motor neuron degeneration caused by SOD1 mutation.

Disclosure of Invention

In view of this, the invention provides an AAV9 viral vector-mediated sgRNA based on a CRISPR/Cas9 gene editing system, uses thereof, a composition comprising the sgRNA, a recombinant expression vector, and a gene therapy mode. The sgRNA can effectively edit a mutant SOD1 gene and repair denatured motor neurons, thereby achieving the purpose of treating ALS. The recombinant virus provided by the invention is biologically active and is expected to become a candidate virus for ALS gene therapy.

In order to achieve the above object, the present invention provides the following technical solutions:

the present invention provides a sgRNA, which is characterized by comprising:

(I) a nucleotide sequence shown as SEQ ID No. 1; or

(II) a complementary sequence of the nucleotide sequence shown as SEQ ID No. 1; or

(III) a sequence which encodes the same protein as the nucleotide sequence of (I) or (II) but which differs from the nucleotide sequence of (I) or (II) due to the degeneracy of the genetic code; or (IV), a sequence having at least 70% homology with the sequence of (I) or (II) or (III).

The invention also provides application of the sgRNA in editing the SOD1 gene.

The invention also provides a composition comprising AAV9 and SaCas9 and the sgRNA.

The invention also provides a preparation method of the composition, which comprises the following steps:

step 1: connecting nucleotide sequences encoding a protein required by AAV9 replication and encoding a SaCas9 protein and the sgRNA into a vector to construct an expression vector;

step 2: and transforming the expression vector into a host cell, expressing, and collecting an expression product to obtain the recombinant DNA.

The invention also provides a recombinant vector expression unit, which comprises:

(1) a nucleotide sequence encoding a protein required for replication of AAV 9; and/or

(2) A nucleotide sequence encoding a SaCas9 protein; and/or

(3) A DNA encoding the sgRNA of claim 1.

In some embodiments of the invention, the recombinant vector expression unit is constructed by ligating nucleotide sequences encoding a protein required for replication of AAV9 and encoding a SaCas9 protein and the sgRNA into a vector to construct an expression vector.

In some embodiments of the invention, the vector in the method of constructing the recombinant expression vector is a plasmid or a virus.

In some embodiments of the present invention, the recombinant expression vector is constructed by a method that includes viruses including but not limited to adeno-associated virus, lentivirus, adenovirus, herpes simplex virus, rabies virus and related derivatives.

The structure of the recombinant vector expression unit is an AAV9 recombinant expression vector of ITR-CMV promoter-SaCas9-BGH poly (A) signal-U6promoter-SOD1 sgRNA-ITR, which is called AAV9-SaCas9-sg1/5 for short.

The recombinant vector expression unit comprises: ITR (enhanced-associated virus 2inverted terminal repeat sequence), CMV promoter (the cytomegavirus promoter), SaCas9(Staphylococcus aureus Cas9), BGH (bostaurus growth hormone), polyA (poly A), U6promoter, SOD1 sgRNA (SOD1 small guide RNA) and ITR (enhanced-associated virus 2inverted terminal repeat sequence).

Wherein the sequence of ITR sequence (Patent WO0220748) is shown as SEQ ID No. 2; the sequence of the CMV promoter is shown as SEQ ID No. 3; the sequence of the SaCas9 is shown as SEQ ID No. 4; the sequence of BGH poly (A) signal is shown in SEQ ID No. 5; the sequence of U6promoter is shown in SEQ ID No. 6; the sequence of SOD1 sgRNA is shown in SEQ ID No. 1.

The invention also provides application of the composition and the recombinant expression vector in preparation of drugs for treating ALS.

In some embodiments of the invention, the ALS is a neurodegenerative disease.

Experiments of the invention prove that the designed SOD1 sgRNA can effectively mediate SaCas9 to carry out gene editing in vitro (figure 1). 5 sgrnas (fig. 1A) are artificially designed upstream of the G93A mutation site of SOD1 cDNA, and the SOD1G93A mutation site can be cut off by SaCas9 under the RNA band-pass according to the frameshift mutation. The cleavage efficiency of sgRNA was examined using a luciferase reporter gene system. The cDNA of SOD1 is inserted into a luciferase gene to destroy the coding, and if the cDNA of SOD1 can be cut off by Cas 9-mediated gene editing, luciferase is expressed, so that the editing efficiency of sgRNA can be determined by detecting the activity of luciferase. The luciferase reporter vector and the SacAS9-sgRNAs vector are co-transfected into 293T cells, and the detection result shows that each sgRNA has different degrees of action, and the sgRNAs 1 and the sgRNAs 5 have higher efficiency than other sgRNAs (FIG. 1B). The cell line stably expressing SOD1-GFP is transfected with the DNA of SaCas9-LacZ, SaCas9-sgRNA1 or SaCas9-sgRNA5, and the fluorescence intensity of GFP is detected by flow cytometry after 48h to determine the mediating efficiency of sgRNA for SOD1 gene editing. Compared to the control sgLacZ, the fluorescence intensity was significantly reduced after transfection of sgRNA1 or sgRNA5 of SOD1 (fig. 1C). Protein expression level of SOD1 in transfected cells is detected by western blotting, compared with sgLacZ of a control group, after sgRNA1 or sgRNA5 of SOD1 is transfected, the protein level of SOD1 is obviously reduced (figure 1D), which indicates that the sgRNA1 and sgRNA5 which are designed can effectively mediate SaCas9 to carry out gene editing on SOD1 in vitro. The sgRNA5 is carried by several different vectors such as adeno-associated virus, lentivirus, herpes simplex virus, rabies virus and nano material to enter 293T cells, and the activity of the sgRNA5 in the cells is detected, and the results show that each vector has different degrees of delivery effects, wherein the effect of the adeno-associated virus vector is the most significant (fig. 1E).

And further adopting a three-plasmid cotransfection method to pack AAV virus on the recombinant vector, purifying, concentrating, and determining the final titer by Real-time PCR. AAV type 9 viruses with better affinity for neuronal cells were selected. The neonatal SOD1G93A transgenic mice were injected with 3 × 10 injections by means of ventricular injection¹³vg/ml AAV9-SaCas9-LacZ，AAV9-SaCas9-sgRNA1, AAV9-SacAs9-sgRNA5 or AAV9-SacAs9-sgRNA1+ sgRNA5 virus, it was found that AAV9-SacAs9-sgRNA1, AAV9-SacAs9-sgRNA5 and AAV9-SacAs9-sgRNA1+ sgRNA5 group 1G93A SOD transgenic mice exhibited a significant delay in onset of expression compared to control AAV9-SacAs9-LacZ (LacZ:105 + -5.2 d (n-5), sg1:122 + -9.7 d (n-5), sg5:149 + -9 d (n-5), sg1+ sg5:125 + -6.6 d (n-5), and P + Sg5<0.05), especially the AAV9-SaCas9-sgRNA5 group (fig. 2A and 5). The survival rate of the treated transgenic mice was also significantly increased compared to the control group (LacZ:132 ± 1.1d (n ═ 5), sg1:143 ± 11.6d (n ═ 5), sg5:161 ± 6.8d (n ═ 5), sg1+ sg5:137 ± 6.2d (n ═ 5), P<0.05), especially the AAV9-SaCas9-sgRNA5 group (fig. 2B and fig. 5). AAV9-SaCas9-sgRNAs are shown to be effective in preventing motor neuron degeneration in vivo.

Mice were further tested for behavioral abilities to assess the therapeutic effect of SOD1 sgRNAs on ALS. Transgenic mice were tested for hind leg extension at day 117 and were individually tested for footprinting at day 115 and day 125. AAV9-SaCas9-LacZ control mice exhibited tremor, walking imbalance, hind leg muscle atrophy, weight loss, and expiratory dyspnea after the onset of disease, and rapidly worsened within 4 weeks. The posterior leg stretching width was significantly increased in the AAV9-SaCas9-sgRNA1 and AAV9-SaCas9-sgRNA5 group mice compared to the control group (LacZ:1.58 ± 0.99cm (n ═ 5), sg1:6.09 ± 0.75cm (n ═ 4), sg5:11.74 ± 0.75cm (n ═ 5), sg1+ sg5:4.74 ± 1.26cm (n ═ 5), and P <0.05) (fig. 3A). The longest distance between two hind limb footprints of mice in AAV9-SacAs9-LacZ, AAV9-SacAs9-sgRNA1, AAV9-SacAs9-sgRNA5 and AAV9-SacAs9-sgRNA1+ sgRNA5 groups is respectively LacZ:3.18 + -0.7 cm (n-5) on day 115, sg1:5.7 + -0.32 cm (n-4), sg5:5.98 + -0.29 cm (n-5), sg1+ sg5:4.16 + -1.22 cm (n-5), LacZ:2.1 + -1 cm (n-6865) on day 125, sg5: 5.23 + -1.2 cm (n-634), Sacg 584.6-LacZ (n-595) and AAV 593-sgRNA 1), and the AAV is particularly effective in improving the performance of mice when the mice are treated by foot prints through AAV 583-SACas 5 and AAV 593-SAS 593 and AAV 593-SAS 5 groups.

AAV9-SaCas9-sgRNA5 with the most remarkable treatment effect is selected, and the protection effect of the AAV on motor neurons is further observed by a fluorescence microscope. With Neu N and IBA1Staining of motor neurons and microglia as markers for labeling of Neu N positive motor neurons in the control group was seen to exceed 20 μm in diameter and degeneration of the cells, whereas AAV9-SaCas9-sgRNA5 group retained a significant number of normal motor neurons (LacZ:1.5 ± 0.31(N ═ 14), sg5:4.4 ± 0.28(N ═ 12); fp<0.05), there was no such change in IBA1 positive microglia (fig. 4A). After being treated by AAV9-SaCas9-sgRNA5, the atrophy condition of tibialis anterior muscle is obviously improved compared with AAV9-SaCas9-sgLacZ control group (LacZ:1242 +/-667 mu m)²(n＝605),sg5:1679±665μm²(n＝421),*P<0.05) (fig. 4B). To further verify that protection of motor neurons is caused by AAV9-SaCas9-sgRNA 5-mediated SOD1 gene knockout, staining observation was carried out on the expression levels of SaCas9 and SOD1 mutants in mouse motor neuron cells. In the AAV9-SaCas9-LacZ control group, the expression levels of the SacAs9 mutant and the SOD1 mutant are high on average, while in the AAV9-SacAs9-sgRNA5 treatment group, the expression levels of the SOD1 mutant in the SacAs9 positive cells are very low (LacZ:2722 + -210 (n-10), sg5:216 + -52 (n-17); and P-17)<0.05) (FIG. 4C), indicating that the resulting recombinant virus is biologically active and is a promising candidate for ALS gene therapy.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the in vitro gene editing analysis of SOD1 sgRNAs; fig. 1 (a): designing five target sgrnas at the G93A mutation upstream of SOD1 cDNA according to the SaCas9 design principle; FIG. 1 (B): the editing efficiency of different sgRNAs was measured with a luciferase reporter gene system and compared to LacZ-sgRNA control group (mean ± SE, n-3,. times.p < 0.05); fig. 1 (C): respectively transfecting sg-LacZ, SOD1-sgRNA1 and SOD1-sgRNA5 in 293T cells stably expressing SOD1-GFP, and detecting the expression intensity of the GFP by flow cytometry (sg-LacZ:3784 +/-678.9, sg1:3784 +/-32.1, sg5:1619 +/-489, mean +/-SE, n-3, and P < 0.05); fig. 1 (D): detecting the protein expression level of SOD1 after transfection of sg-LacZ, SOD1-sgRNA1 or SOD1-sgRNA5 in 293T cells by an immunoblotting method (sg-LacZ:0.95 +/-0.06, sg-1:0.72 +/-0.12, sg-5:0.67 +/-0.14, mean +/-SE, n is 3, and P is less than 0.05); fig. 1 (E): the editing efficiency of sgRNA5 carried by different vectors was tested using a luciferase reporter system and compared to the transfected controls (mean ± SE, n ═ 3, × P <0.05, × P <0.01, × P < 0.001).

FIG. 2 shows the therapeutic effect of SacAS9-sgRNAs in SOD1G93A transgenic mice; SOD1G93A transgenic mice 3 x 10 were administered separately by ventricular injection¹³vg/ml AAV9-SaCas9-sgLacZ, AAV9-SaCas9-sg1, AAV9-SaCas9-sg5 or AAV9-SaCas9-sg1+ sg5 virus, mouse incidence FIG. 2(A) and survival FIG. 2 (B); FIG. 3 shows the behavioral changes of SOD1G93A transgenic mice after receiving different AAV9-SaCas9-sgRNAs treatments; fig. 3 (a): after AAV9-SaCas9-sgLacZ, AAV9-SaCas9-sg1, AAV9-SaCas9-sg5 and AAV9-SaCas9-sg1+ sg5 are used for treating the transgenic mice, and hind leg extension test is carried out on the transgenic mice at 117 days; fig. 3 (B): footprinting measures the longest distance between two hind limb footprints (mean ± SE, n-4-5, P) in 115-day and 125-day old mice<0.05)；

FIG. 4 shows the protective effect of SOD1 sgRNAs on motor neurons; fig. 4 (a): after the transgenic mouse with SOD1G93A is treated by AAV9-SaCas9-sgLacZ or AAV9-SaCas9-sg5, the morphological change of Neu N positive motor neurons and IBA1 positive microglia cells is detected by an immunofluorescence method (mean plus or minus SE, N is 12-14, P is less than 0.05); fig. 4 (B): after the transgenic mouse with SOD1G93A is treated by AAV9-SaCas9-sgLacZ or AAV9-SaCas9-sg5, the shrinkage of the tibialis anterior muscle of the mouse changes (mean + -SD, n is 500, P is less than 0.05); fig. 4 (C): after double staining of the SacAS9 and the SOD1 mutant, observing the expression conditions of the SacAS9 and the SOD1 in mouse motor neurons at the end by a fluorescence confocal microscope (mean + -SE, n is 10-17, and P is less than 0.05);

FIG. 5 shows the gene copy number, sex, onset and survival of SOD1G93A transgenic mice treated with AAV9-SaCas9-sgLacZ or AAV9-SaCas9-sg 5.

Detailed Description

The invention discloses an AAV9 viral vector-mediated sgRNA based on a CRISPR/Cas9 gene editing system and application thereof, a composition containing the sgRNA, a recombinant expression vector and a gene therapy mode. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

The first objective of the invention is to provide sgrnas capable of efficiently mediating SOD1 mutant gene editing.

The different sgrnas are sgRNA1, sgRNA2, sgRNA3, sgRNA4, sgRNA5, and particularly sgRNA 5.

A second object of the invention is to provide a vector expressing a protein required for replication of AAV9 and a SaCas9 protein.

The third purpose of the invention is to provide a preparation method of an AAV9 and SacAS9 protein and SOD1 sgRNA recombinant vector expression unit, wherein the recombinant vector expression unit structure is an AAV9 recombinant expression vector of ITR-CMV promoter-SacAS9-BGH poly (A) signal-U6promoter-SOD1 sgRNA-ITR, which is called AAV9-SacAS9-sg1/5 for short.

The vector is a plasmid or a virus, and the virus includes but is not limited to adeno-associated virus, lentivirus, adenovirus, herpes simplex virus, rabies virus and related derivatives.

A fourth object of the invention is to provide a composition comprising a protein required for AAV9 replication and sgRNA of the SaCas9 protein and a designed SOD1 mutant.

In the composition, the sgRNA of the SOD1 mutant is sgRNA5, and the sequence of the sgRNA is shown in SEQ ID No. 1. The sequence of SaCas9 is shown in SEQ ID NO. 4.

A fifth object of the invention is to provide a vector, composition or virus according to any of the above for use in the treatment of ALS.

The ALS is a neurodegenerative disease.

In the invention, modern biological technologies and methods such as genetic engineering and the like are adopted to provide a recombinant AAV9 co-expression vector for coding SOD1 sgRNA5 and SaCas9, and preparation, packaging and application of the virus.

The invention provides a sgRNA and application thereof, and a composition, a recombinant expression vector and a gene therapy mode containing the sgRNA. Wherein, unless otherwise specified, the various reagents mentioned in the examples are commercially available; unless otherwise specified, specific procedures described in the examples are described in the third edition of molecular cloning, laboratory Manual.

The invention is further illustrated by the following examples:

example 1 cloning of AAV9-SaCas9-SOD1 sgRNA and viral packaging

According to the design principle of the Saca 9 PAM sequence (NNGRRT) and the optimal 21-nt length, five SOD1 sgRNAs are designed, and are respectively cut by Bsa I and cloned into an AAV-Saca 9-sgRNA vector (Addgene, px 61591). AAV-SaCas9-SOD1 sgRNAs virus is packaged by a three-plasmid cotransfection method, purified and concentrated, and the titer of the virus is determined by qPCR.

SOD1 sgRNA design and editing efficiency results:

FIG. 1(A) shows the sequence design of five SOD1 sgRNAs;

fig. 1(B) shows that five SOD1 sgrnas can mediate cleavage of SOD1 by saCas9 to different degrees, wherein sgRNA1 and sgRNA5 are the most effective;

fig. 1(E) shows that six vectors have varying degrees of delivery efficiency to sgRNA5, with the best effect with adeno-associated virus.

Example 2 detection of Gene editing efficiency of SOD1 sgRNA in flow cytometry 293T cells were transfected with SOD1-GFP plasmid, harvested after 48h, digested with 0.25% trypsin, and centrifuged to obtain a pellet. Resuspend cells to 1X 10 with media⁷The cells/ml cell suspension is used for sorting GFP positive cells by a flow cytometer (FACSAria, BD), and the SOD1-GFP stable cell strain is obtained. According to the Lipofectamine 2000 operating manual, DNAs of SacAS9-LacZ, SacAS9-sgRNA1 or SacAS9-sgRNA5 are transfected into a cell strain stably expressing SOD1-GFP, and the fluorescence intensity of GFP is detected by a flow cytometer after 48 hours to determine the mediating efficiency of the sgRNA to SOD1 gene editing. It can be seen that the fluorescence intensity was significantly reduced after transfecting sgRNA1 or sgRNA5 of SOD1, compared to the control sgLacZ.

The results of detecting the gene editing efficiency of SOD1 sgRNA by flow cytometry:

FIG. 1(C) shows that the GFP expression intensity was significantly decreased after transfection of SOD1-sgRNA1 and SOD1-sgRNA5 in 293T cells stably expressing SOD 1-GFP.

Example 3 detection of Gene editing efficiency of SOD1 sgRNA by Western Blot

Total protein in spinal cord was extracted using total protein extraction kit (Applygen Technologies inc., P1250). After the concentration was determined, 50. mu.g of protein was loaded to each sample for SDS-PAGE gel electrophoresis, transferred to PVDF membrane, blocked, incubated overnight at 4 ℃ with beta-actin antibody (1:500, Proteintetech) and hSOD1 antibody (1:1, Abcam), washed thoroughly, incubated with fluorescently labeled secondary antibody at room temperature for 1 hour, and then the corresponding band was detected using the Odyssey infrared imaging system. It can be seen that the protein expression level of SOD1 is obviously reduced after SOD1-sgRNA1 or SOD1-sgRNA5 is transfected.

sgRNA1 and sgRNA5 were able to mediate gene editing results of SaCas9 on SOD1 in vitro:

FIG. 1(D) shows that the protein expression level of SOD1 was significantly decreased after transfection of SOD1-sgRNA1 or SOD1-sgRNA5 in 293T cells.

Example 4 establishment of mouse animal model

SOD1G93A transgenic mice (B6SJL-TgN [ SOD1-G93A ]1Gur) were obtained from Jackson laboratories and were raised under conditions of alternating day and night periods of 12h, relative humidity of 60 + -10%, and temperature of 22 + -1 deg.C.

EXAMPLE 5 intracerebroventricular injection of AAV Virus

AAV was diluted to 4. mu.l of virus solution containing 0.05% trypan blue, with the junction of the herringbone and sagittal sutures being zero, 1.5mm anteriorly, 0.8-1mm lateral to the sagittal suture, an injection depth of about 3mm, the needle retained for 1 minute, and then withdrawn slowly [21 ].

Example 6 behavioral analysis of mice

The motor function of the mice was tested once a week with a rotating bar experiment, the cut-off time was 180s, three measurements were taken, and the longest time record was selected. The onset time was determined by the degree of decline in weekly rotarod performance of the mice. The footprint method is based on the continuous movement of the mouse, and the maximum value between three steps is selected for calculation.

It can be seen that SOD1G93A transgenic mice 3 x 10 were administered by ventricular injection¹³After vg/ml AAV9-SaCas9-sgLacZ, AAV9-SaCas9-sg1, AAV9-SaCas9-sg5 or AAV9-SaCas9-sg1+ sg5 viruses, the incidence of mice is obviously delayed in an sgRNA treatment group, and the motor ability is obviously improved.

The results of disease and behavioral changes of SOD1G93A transgenic mice after receiving different AAV9-SaCas9-sgRNAs treatments:

(1) SOD1G93A transgenic mice showed a significant delay in the incidence of disease in the treated group, see fig. 2 (a);

(2) the survival rate of the SOD1G93A transgenic mice in the treatment group is obviously improved, and is shown in figure 2 (B);

(3) the hind leg extension test was performed on the transgenic mice at day 117, and the hind leg extension width of the mice in the treatment group was significantly increased, as shown in fig. 3 (a);

(4) the longest distance between the hind leg footprints of the mice was measured by the footprinting method at 115 days and 125 days, and the treatment group was significantly improved, as shown in fig. 3 (B).

Example 7 muscular morphology observations

The 10 μm frozen muscle cross section was stained with HE and the staining was observed under an olympus microscope (BX53) and photographed, and the image was analyzed with DP73 software. Approximately 500 fibers of tibialis anterior were recorded and the fiber area was calculated using the software image J. It can be seen that the atrophy condition of the tibialis anterior muscle of the mice is obviously improved compared with the AAV9-SaCas9-sgLacZ control group after the treatment of the AAV9-SaCas9-sgRNA 5.

After AAV9-SaCas9-sgRNA5 treatment, the test result of the atrophy condition of the tibialis anterior muscle of the mouse is as follows:

FIG. 4(B) shows that the mouse with SOD1G93A transgene treated by AAV9-SaCas9-sg5 has obviously improved tibialis anterior atrophy status compared with AAV9-SaCas9-sgLacZ control group.

Example 8 immunofluorescence assay for the detection of motor neuron cell degeneration

Cells were washed three times with PBS containing 0.3% Triton X-100 and blocked with 10% horse serum for 30 minutes at room temperature. Primary antibodies were diluted and incubated in the corresponding ratios: IBA1(1:400, Wako, Richmond), Neu N (1:100, Millipore), hSOD1(1:200, Abcam), HA (1:300, Sigma), incubated at room temperature for 2h, washed three times, and incubated with fluorescently labeled secondary antibody at room temperature for 1 h. The staining of the cells was observed using a fluorescence confocal microscope (olympus FV 1000). It can be seen that after the treatment of AAV9-SaCas9-sgRNA5, the mouse motor neuron cell degeneration is obviously improved compared with the AAV9-SaCas9-sgLacZ control group.

After AAV9-SaCas9-sgRNA5 treatment, the mouse motor neuron cell degeneration detection result is as follows:

(1) after the transgenic mouse SOD1G93A is treated by AAV9-SaCas9-sg5, morphological degeneration conditions of Neu N positive motor neurons and IBA1 positive microglia cells are detected by an immunofluorescence method, and the degeneration condition of the motor neuron cells is obviously improved, which is shown in figure 4 (A);

(2) the SacAS9 and the SOD1 mutant are doubly stained, the expression conditions of the SacAS9 and the SOD1 in mouse motor neurons at the end are observed by a fluorescence confocal microscope, and the expression level of the SOD1 mutant in the SacAS9 positive cells is very low, which is shown in figure 4 (C).

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Reference to the literature

[1] Clinical observations of the natural course of amyotrophic lateral sclerosis, Geranium, Liaoguang, Liuming raw, Chiliying, J. Zhonghua J.2014, 94(9): 674-.

[2]Bucchia M,Ramirez A,Parente V,Simone C,Nizzardo M,Magri F,et al.Therapeutic Development in Amyotrophic Lateral Sclerosis.ClinTher.2015；37(3):668-680.

[3]Cirulli ET,Lasseigne BN,Petrovski S,Sapp PC,Dion PA,Leblond CS,et al.Exome sequencing in amyotrophic lateral sclerosis identifies risk genes and pathways.Science.2015；347(6229):1436-1441.

[4]Platt RJ,Chen S,Zhou Y,Yim MJ,Swiech L,Kempton HR,et al.CRISPR-Cas9 knockin mice for genome editing and cancer modeling.Cell.2014；159(2):440-455.

[5]Hsu PD,Lander ES,Zhang F.Development and applications of CRISPR-Cas9 for genome engineering.Cell.2014；157(6):1262-1278.

[6]Zhang F,Wen Y,Guo X.CRISPR/Cas9 for genome editing:progress,implications and challenges.Hum Mol Genet.2014；23(R1):R40-R46.

[7]Shalem O,Sanjana NE,Hartenian E,Shi X,Scott DA,Mikkelsen TS,et al.Genome-scale CRISPR-Cas9 knockout screening in human cells.Science.2014；343(6166):84-87.

[8]Ran FA,Hsu PD,Wright J,Agarwala V,Scott DA,Zhang F.Genome engineering using the CRISPR-Cas9 system.Nat Protoc.2013；8(11):2281-2308.

[9]Lu Y.Recombinant adeno-associated virus as delivery vector for gene therapy-a review.Stem Cells Dev.2004；13:133-45.

[10]Daly TM.Overview of adeno-associated viral vectors.Methods Mol Biol.2004,246:157-65.

[11]Long C,McAnally JR,Shelton JM,Mireault AA,Bassel-Duby R,Olson EN.Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA.Science.2014；345(6201):1184-1188.

[12]Swiech L,Heidenreich M,Banerjee A,Habib N,Li Y,Trombetta J,et al.In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9.Nat Biotechnol.2015；33(1):102-106.[13]Ran FA,Cong L,Yan WX,Scott DA,Gootenberg JS,Kriz AJ,et al.In vivo genome editing using Staphylococcus aureus Cas9.Nature.2015；520(7546):186-191.

[14]Platt RJ,Chen S,Zhou Y,Yim MJ,Swiech L,Kempton HR,et al.CRISPR-Cas9 knockin mice for genome editing and cancer modeling.Cell.2014；159(2):440-455.

[15]Dirren E,Aebischer J,Rochat C,Towne C,Schneider BL,Aebischer P.SOD1 silencing in motoneurons or glia rescues neuromuscular function in ALS mice.AnnClinTransl Neurol.2015；2(2):167-184.

[16]Benkhelifa-Ziyyat S,Besse A,Roda M,Duque S,Astord S,Carcenac R,et al.Intramuscular scAAV9-SMN injection mediates widespread gene delivery to the spinal cord and decreases disease severity in SMA mice.Mol Ther.2013；21(2):282-290.

[17]Duque S,Joussemet B,Riviere C,Marais T,Dubreil L,DouarAM,et al.Intravenous administration of self-complementary AAV9 enables transgene delivery to adult motor neurons.Mol Ther.2009；17(7):1187-1196.

[18]Samaranch L,Salegio EA,San SW,Kells AP,Bringas JR,Forsayeth J,et al.Strong cortical and spinal cord transduction after AAV7 and AAV9 delivery into the cerebrospinal fluid of nonhuman primates.Hum Gene Ther.2013；24(5):526-532.

[19]Maclaren RE,Groppe M,Barnard AR,Cottriall CL,Tolmachova T,Seymour L,et al.Retinal gene therapy in patients with choroideremia:initial findings from a phase 1/2 clinical trial.Lancet.2014,383(9923):1129-1137.

[20]Nathwani AC,Tuddenham EG,Rangarajan S,Rosales C,McIntosh J,Linch DC,et al.Adenovirus-associated virus vector-mediated gene transfer in hemophilia B.N Engl J Med.2011；365(25):2357-2365.

[21]Kim JY,Grunke SD,Levites Y,Golde TE,Jankowsky JL.Intracerebroventricular viral injection of the neonatal mouse brain for persistent and widespread neuronal transduction.J Vis Exp.2014 Sep 15；(91):51863.doi:10.3791/51863.

SEQ ID

No.1

5'-GGCCCACCGTGTTTTCTGGATA-3'

No.2

5'-GACGGCGCTAGGATCATCAACGAAACCCAGCATCTACACAATGTAGCTCAAGTATTCTGGTCACAGAATACAACGAAACCCAGCATCTACACAATGTAGCTCAAGATGATCCTAGCGCCGTCTT-3'

No.3

5'-CTATATAAGCAGAGCTCTCTGGCTAACTACCGGTGCCACCATGGCCCCAAAGAAGAAGCGGAAGGTCGGTATCCACGGAGTCCCAGCAGCCAAGCGGAACTACATCCTGGGCCTGGACATCGGCATCACCAGCGTGGGCTACGGCATCATCGACTACGAGACACGGGACGTGATCGATGCCGGCGTGCGGCTGTTCAAAGAGGCCAACGTGGAAAACAACGAGGGCAGGCGGAGCAAGAGAGGCGCCAGAAGGCTGAAGCGGCGGAGGCGGCATAGAATCCAGAGAGTGAAGAAGCTGCTGTTCGACTACAACCTGCTGACCGACCACAGCGAGCTGAGCGGCATCAACCCCTACGAGGCCAGAGTGAAGGGCCTGAGCCAGAAGCTGAGCGAGGAAGAGTTCTCTGCCGCCCTGCTGCACCTGGCCAAGAGAAGAGGCGTGCACAACGTGAACGAGGTGGAAGAGGACACCGGCAACGAGCTGTCCACCAAAGAGCAGATCAGCCGGAACAGCAAGGCCCTGGAAGAGAAATACGTGGCCGAACTGCAGCTGGAACGGCTGAAGAAAGACGGCGAAGTGCGGGGCAGCATCAACAGATTCAAGACCAGCGACTACGTGAAAGAAGCCAAACAGCTGCTGAAGGTGCAGAAGGCCTACCACCAGCTGGACCAGAGCTTCATCGACACCTACATCGACCTGCTGGAAACCCGGCGGACCTACTATGAGGGACCTGGCGAGGGCAGCCCCTTCGGCTGGAAGGACATCAAAGAATGGTACGAGATGCTGATGGGCCACTGCACCTACTTCCCCGAGGAACTGCGGAGCGTGAAGTACGCCTACAACGCCGACCTGTACAACGCCCTGAACGACCTGAACAATCTCGTGATCACCAGGGACGAGAACGAGAAGCTGGAATATTACGAGAAGTTCCAGATCATCGAGAACGTGTTCAAGCAGAAGAAGAAGCCCACCCTGAAGCAGATCGCCAAAGAAATCCTCGTGAACGAAGAGGATATTAAGGGCTACAGAGTGACCAGCACCGGCA-3'

No.4

5'-TGGTCTTGCTGATTCTGCCCTTGCCCTTGGCCAGATTCAGGATGTGCTTCTTGAAGGTTTCGTAGCTGATCTTGCTGTCGCTGCTGCTCAGGTACTGGAATGGGGTCCGGTTGCCCTTCTTGCTGTTTTCTTCCTGCTTCACGAGCACCTTGTTGTTGAAGCTGTTGTCGAAGGACACGCTTCTGGGGATGATGTGGTCCACCTCATAGTTGAAGGGGTTGTTCAGCAGATCTTCCAGAGGGATGGCTTCCAGGCTGTACAGGCACTTGCCTTCCTGCATGTCGTGCAGCTTGATCTTCTCGATCAGGTACTTGGCGTTCTCTTTGCCGGTGGTCCGGATGATTTCCTCGATCCGCTCGTTGGTCTGCCGGTTCCGCTTCTGCATCTCGTTGATCATTTTCTGGGCGTCCTTGGAGTTCTTCTCGCGGGCCAGCTCGATAATGATGTCGTTGGGCAGGCCGTACTTCTTGATGATGGCGTTGATCACTTTGATGCTCTGGATGAAGCTTCTCTTCACGACGGGGCTCAGGATGAAGTCGTCCACCAGGGTGGTGGGGATCTCTTTCTGCTGGGACAGGTCCACCTTCTTGGGCACCAGCTTCAGCCGGTTGAAGATAGCGATCTGGTTGTCGTTGGTGTGCCACAGCTCGTCCAGGATCAGGTTGATGGCCTTCAGGCTCAGGTTGTGGGTGCCGGTATAGCCCTTCAGATTAGAGATCTGCTCGATCTCTTCCTGGGTCAGCTCGGAGTTCAGATTGGTCAGTTCTTCCTGGATGTCCTCGCTGCTCTGGTAGATGGTCAGGATCTTGGCAATCTGATCCAGCAGCTCGGCGTTCTCAATAATCTCTTTCCGGGCGGTAATGTCCTTGATGTCGTGGTACACCTTCAGGTTGGTGAACTCGGGCTTGCCGGTGCTGGTCACTCTGTAGCCCTTAATATCCTCTTCGTTCACGAGGAT-3'

No.5

5'-GAATTCTTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAAGCGTAATCTGGAACATCGTATGGGTAGGATCCCTTTTTCTTTTTTGCCTGGCCGGCCTTTTTCGTGGCCGCCGGCCTTTTGCCCTTTTTGATGATCTGAGGGTGCTTCTTAGATTTCACTTCATACAGGTTGCCCAGAATGTCTGTGCTGTACTTCTTAATGCTCTGGGTCTTGGAGGCGATTGTCTTAATGATCCTGGGGGGCCTCTTGTCGTTCATGTTTTCCAGGTACTCGCGGTAGGTGATGTCGATCATGTTCACTTCGATCCGGTTCAGCAGGTCGTTGTTCACGCCGATCACTCTATACAGCTCGCCGTTGATCTTGATCAGATCGTTGTTGTAGAAGGAGGCGATAAACTCGGCCTGGTTGCTGATCTTCTTCAGCTTCTTAGCTTCCTCATAGCACTTGCTATTCACTTCGTAGTAGTTTTCTTTTTTGATCACATCCAGATTCTTCACGGTCACGAACTTGTACACGCCATTGTCCAGGTACACGTCGAATCTGTAGGGCTTCAGGGACAGCTTCACGACCTTGTTTCTGCTGTTGGGGTAGTCGTCGGTGATGTCCAGATGGGCGTTCAGTTTGTTGCCGTAATACTTAATCTTCTTGATCACGGGGCCGTTGTCCTTTTTGGAGTACTTGGTCAGGTAGTTCCCGGTTTCCTCGTAGTACTTGTACAGGGGATTCTTCTCGTCGCCGTACTGTTCCATAATCAGCTTCAGTTTCTGGTAGGTCTGGGGGTCGTGGTGGTACATCAGCAGCTTTTCGGGGCTCTTGTTGATCAGCTTTTTCAGCTTGTCATTGTCCTTGTCGTACAGGCCGTTCAGATTGTTCACGATCAGGGTGTTGCCCTTGTCGTCCTTCCGGGTGGAGTACAGGGTGTCGTT-3'

No.6

5'-CATATACGATACAAGGCTGTTAGAGAGATAATTGGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTAATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGAGACCACGGCAGGTCTCAGTTTTAGTACTCTGGAAACAGAATCTACTAAAACAAGGCAAAATGCCGTGTTTATCTCGTCAACTTGTTGGCGAGATTTTTGCGGCCGCAGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACNGAGGCCGGGCGACCAAAGGT-3'

Claims

1. A DNA sequence for coding sgRNA is characterized by having a nucleotide sequence shown as SEQ ID No. 1.

2. A composition comprising AAV9 and SaCas9 and a DNA sequence encoding the sgRNA of claim 1.

3. A recombinant vector expression unit encoding a SaCas9 protein mediated by an AAV9 vector, comprising:

a DNA encoding the sgRNA of claim 1.

4. The recombinant vector expression unit of claim 3, comprising:

ITR-CMV promoter-SacAS9-BGH poly (A) signal-U6promoter-SOD1 sgRNA-ITR, wherein the SOD1 sgRNA is a DNA sequence which has a sequence shown in SEQ ID No.1 and codes SOD1 sgRNA.

5. A method for constructing a recombinant expression vector comprising the recombinant vector expression unit according to claim 3 or 4, wherein the DNA encoding the RNA according to claim 1 is ligated to a vector comprising a nucleotide sequence encoding a protein required for replication of AAV9 and a nucleotide sequence encoding a SaCas9 protein to construct a recombinant expression vector.