Detection primer, amplification system and the detection kit in microsatellite instability site-BAT26 sites
Technical field
The invention belongs to biomedicine field, is related to the amplification system of microsatellite stability and detection examination in a kind of detection tumour cell
Agent box.
Background technology
Among the malignancy disease of colorectal cancer (colorectal cancer, CRC) worldwide, the incidence of disease is in
4, be a kind of common cancer, and the death rate is in the 2nd, and serious threat health and the life of the mankind.Colorectal cancer
The numerous characteristics that are shown of pathogenic process it is related to the change of some science of heredity, in order that more colorectal cancer patients obtain it is more scientific
Rational treatment, correlated inheritance index is explored to judge the prognosis of patient and chemotherapeutic efficacy, instruct the individualized treatment of patient always
It is the theme praised highly.In recent years, the relevant clinical of microsatellite instability (MSI) and basis aspect research achieve preferably
Progress, have to the relation of MSI states and CRC deeper into understanding.Such as height microsatellite instability (MSI-H)
The more low microsatellite instability of colorectal cancer patients (MSI-L) and microsatellite stable (MSS) patient have it is preferably pre-
Afterwards.
At present, detecting the method for microsatellite instability state includes MMR protein immunization groups method, fragments analysis method, HRM
Method etc..The method that above-mentioned latter two belongs to PCR-based technology, the selection of its primer be have to detection sensitivity it is of crucial importance
The factor of influence.Fragments analysis method is goldstandard method generally acknowledged at present, but this method cost is higher, and detection time is longer, and
And it must be analyzed on expensive sequenator.HRM rules have the advantages that quick, cost is low, high sensitivity,
It need to can only be analyzed on quantitative real time PCR Instrument simultaneously.But requirement of the HRM methods to design of primers is very high:Primer should
There is good specificity, require that the fragment that it is amplified is short enough again, preferable resolution capability could be obtained to its sudden change sample.
BAT26 sites are one of important sites of microsatellite instability detection, but carry out HRM method detections to it at present and grind
Study carefully seldom, only one report (Ramunas Janavicius, 2010) was once attempted using HRM methods detection colorectal cancer
The detection in two sites of BAT25, BAT26 in sample, but detection number of cases is few, lacks the clinical verification of large sample.
The content of the invention
It is an object of the invention to provide a kind of HRM method detections are carried out for microsatellite instability site-BAT26 sites
Primer/amplification system/detection kit.
Invention is achieved through the following technical solutions:
First, invention provides a kind of primer, and its sequence is selected from SEQ ID NO:1 and SEQ ID NO:2.
SEQ ID NO.1:TGCAGCAGTCAGAGCCCTTA
SEQ ID NO.2:GCTTCTTCAGTATATGTCAATGAAAACA
The invention provides a kind of kit that HRM method detections are carried out for BAT26 sites, contain such as SEQ ID NO:1、
SEQ ID NO:Primer shown in 2.
In the kit, the consumption proportion of each component is following (cumulative volume 20-25 μ L amplification system):
Component |
Dosage (μ L) |
10×Buffer |
2-2.5 |
dNTP |
2-2.5 |
EvaGreen |
1-1.25 |
SEQ ID NO:1 primer |
1-1.25 |
SEQ ID NO:2 primers |
1-1.25 |
Taq enzyme |
0.2-0.25 |
Without enzyme water |
11.8-15 |
DNA profiling |
1-5 |
Preferably, the kit also contains EvaGreen.Preferably, dNTP is also contained.Preferably, Taq enzyme is also contained.
It is highly preferred that also contain cushioning liquid.
Using above-mentioned primer/amplification system/detection kit, MSI detections can be carried out to BAT26 sites, obtained good
Sensitivity and Specificity.Specifically, can be with the following method:
1. signal collection:Above-mentioned amplification system is prepared, is separately added into 50-100ng colorectal cancer patients tumour and normal structure
DNA profiling, the amplification system containing sample is put into the quantitative real time PCR Instruments of Roche LightCycler 480 II and examined
Survey, program is as follows:95 DEG C of 10min → (95 DEG C of 20s → 58 DEG C 20s → 72 DEG C 20s) 40cycles → melting temperature (70-83 DEG C),
Collection signal frequency is 12 times/DEG C.
2. interpretation of result:The melting curve of the melting curve of tumor tissues and normal structure is contrasted, if tumor tissues is molten
Solution curve shows the melting peakss of two and the above, and the melting curve of patient's normal structure only shows a melting peakss, then
Judge that both peak types are inconsistent, represent that the patient BAT26 sites are unstable, so as to judge the patient for microsatellite instability
(MSI) type patient.Otherwise, it means that the patient BAT26 sites are stable, but the information that need to combine other sites can judge
The MSI states of patient.
As an example, detecting the unstable sample in BAT26 sites in the process of the present invention, its testing result is as shown in figure 1, tumour
The melting curve of tissue is different from the melting curve of normal structure;The stable sample in BAT26 sites is detected in the process of the present invention, its
Testing result is as shown in Fig. 2 the melting curve of tumor tissues and the melting curve of normal structure are unimodal.
The present invention passes through multiple exploration discovery, and the stability in HRM methods detection BAT26 sites is carried out using the primer of the present invention,
By compared with the MSI fragments analysis methods of Promega companies (goldstandard method) kit testing result, invention
Method sensitivity is 100%, and specificity reaches 97.67%.
Operation sequence of the present invention greatly simplifies, and the time for often detecting a sample compares fragments analysis method and shortened about 1 hour, and
HRM method costs substantially reduce and (reduce by 80%).In addition, HRM methods only need one and carried without using Genetic Analyser
The quantitative fluorescent PCR of HRM functions.
Brief description of the drawings
Fig. 1 is that the melting curve of tumor tissues shows two melting peakss, and the melting curve of corresponding normal structure only shows one
The result example of melting peakss.
Fig. 2 is the result example that tumor tissues only show a melting peakss with the melting curve for corresponding to normal structure.
Fig. 3 is that tumor tissues and the melting curve of corresponding normal structure show several melting peakss result examples.
Fig. 4 is result example of the HRM methods without amplimer.
Embodiment
Technical scheme is further illustrated below by way of specific embodiment, specific embodiment does not represent to be protected to the present invention
The limitation of scope.Some nonessential modifications and adjustment that other people are made according to theory of the present invention still fall within the protection of the present invention
Scope.
The detection method in the microsatellite instability site-BAT26 sites of embodiment 1.
1. configure following reaction system using Blend Taq Plus enzymes (Toyobo, CAT NO.BTQ-201)
Component |
Dosage (μ L) |
10×Buffer |
2.5 |
dNTP |
2.5 |
EvaGreen |
1.25 |
SEQ ID NO:1 primer |
1.25 |
SEQ ID NO:2 primers |
1.25 |
Taq enzyme |
0.25 |
Without enzyme water |
15 |
2. the DNA profiling concentration of colorectal cancer patients tumor tissues and normal structure is adjusted to 50-100ng/ul.In above-mentioned body
1ul DNA profiling is separately added into system.
Above-mentioned colorectal cancer patients tumor tissues source:Paraffin prepared by ZhongShan University attached No.6 Hospital ocal resection sample
Section.
The normal structure source of colorectal cancer patients:By ZhongShan University attached No.6 Hospital surgery excision knurl prepared by distal end normal structure
Paraffin section.
3. being vortexed after mixing, detected using the quantitative real time PCR Instruments of Roche LightCycler 480 II, program is as follows:95℃
10min → (95 DEG C of 20s → 58 DEG C 20s → 72 DEG C 20s) 40cycles → melting temperature (70-83 DEG C), collect signal frequency
For 12 times/DEG C.
4. the melting curve of the melting curve of the tumor tissues of same patient and normal structure is contrasted, interpretation sample to be measured
The stability in BAT26 sites.
The Comparative result of the different primers pair of embodiment 2.
Inventor has groped influence of multigroup primer combination to experimental result in experimentation.It is demonstrated experimentally that primer combination determines
The feasibility of method.It is to use multigroup Exemplary primers to carry out experiment acquired results (table 1) in the method for embodiment 1 below.
Table 1. gropes 6 pairs of primers combination of process use and its generation peak type, sentence read result compare
Note:This HRM detection methods, its PCR program set 40 circulations altogether.Sample amplification CT values are advisable for 18-25, if
Not within the range, then interpretation is that this PCR reaction can not expand or expanding effect is bad to sample amplification CT values, and finally having can
It can influence amount and the follow-up HRM analyses of amplified production.
The above results collection of illustrative plates exemplarily only shows a portion.Remaining collection of illustrative plates is not shown directly.
As a result show, the detection interpretation of this tumor patient commodity in use kit is that BAT26 sites are unstable, uses above-mentioned six
To primer, HRM methods of the present invention are carried out respectively and are detected.It was found that only SEQ ID NO:1、SEQ ID NO:2
Shown primer (primer pair 1 in i.e. upper list) can accurately this of interpretation patient BAT26 sites it is unstable, remaining five pairs are drawn
Thing (primer pair 2-6 in i.e. upper list) can not accurate interpretation.Although gone out by Software for Design and many be directed to BAT26 sites
Primer (primer for being not limited to above-mentioned example), however, using HRM methods detect result show, wherein most
Primer can not accurate interpretation, and SEQ ID NO:1、SEQ ID NO:2 have then highlightedly obtained accurate result.
The inventive method of embodiment 3. is compared with the testing result of fragments analysis method kit.
Sample:By 100 couple (the i.e. tumor tissues and its corresponding normal group of the materials section of ZhongShan University attached No.6 Hospital pathology department
Knit) Patients with Colorectal Cancer sample.
The inventive method:Step such as embodiment 1, the primer used for:F:TGCAGCAGTCAGAGCCCTTA
R:GCTTCTTCAGTATATGTCAATGAAAACA(SEQ ID NO:1、SEQ ID NO:2)。
Slice parsing method:From Promega MSI Analysis System (CAT NO.MD1641) kit, the examination
Agent box detected based on multiple fluorescence PCR microsatellite instability in human cell (microsatellite instability,
MSI).Its detection method is:The DNA from normal structure and tumor tissues is extracted respectively, expands 5 microsatellites not respectively
Stable site (BAT25, BAT26, NR21, NR24, MONO27), compare the hair of microsatellite locus caused by both
Cons electrophoresis collection of illustrative plates.If the difference of the Capillary Electrophoresis collection of illustrative plates and normal structure in tumor tissues, prompt MSI be present.Should
The fluorescent dye primer that kit includes can expand 7 marks, wherein including the BAT26 detection sites in invention.
Job step is with reference to product description.This method is to be referred to as goldstandard method compared with the method approved in currently available technology.
The tumor tissues of 100 colorectal cancer patients and the BAT26 sites of normal structure have carried out goldstandard method and the present invention
The detection of method, as a result compare as shown in table 2.
The inventive method of table 2. is compared with the testing result of goldstandard method
According to upper table data, the inventive method sensitivity=57/ (57+0) × 100%=100%, specificity=42/ (42+1) are calculated
× 100%=97.67%.In 100 samples, only 1 result is not consistent, and BAT26 sites are measured using the inventive method
It is unstable, it is stable for BAT26 sites using kit testing result.Estimation is due to that this sample belongs to low abundance mutation, gold
Standard law can not detect because detection sensitivity is low, and the high sensitivity of the present invention, can also be detected for the sample of low abundance mutation.
Embodiment 4. is directed to 25 outmoded samples, and the inventive method is compared with the testing result of fragments analysis method kit.
Sample:By 25 couple (i.e. tumor tissues and its corresponding normal structure) of ZhongShan University attached No.6 Hospital pathology department materials section
Patients with Colorectal Cancer sample, all samples are the paraffin-embedded tissue of storage more than 3 years.
The inventive method:Step such as embodiment 3.The BAT26 sites of 25 pairs of cancerous tissues and normal structure sample have carried out two kinds
The detection of method, as a result compare as follows:
Table 3. is directed to outmoded sample, and the inventive method is compared with the testing result of fragments analysis method kit
In 25 pairs of outmoded samples, the recall rate detected using kit is 18/25*100%=72%, and uses the inventive method
Recall rate is 24/25*100=96%.Recall rate described in this patent is higher because the primer specificity described in this patent compared with
The conditional combination of height, amplification and analysis is more excellent, therefore is directed to difficult sample (such as fragmentation or outmoded DNA, low concentration DNA)
Also it can detect, illustrate that the inventive method is low to the quality requirement of sample DNA, applicability is wide.
And in 18 sample detection results that available reagent box detection method can detect, testing result of the present invention is coincide with it
Rate is 100%.As a result prompt the inventive method accurately and reliably, and greatly improve sample detection success rate (improving 33%).
Time and Cost comparisons of the inventive method of embodiment 5. with kit detection BAT26 sites
Computational methods:Originally adjusted for thering is the 100 of testing result to treat mark using two methods in embodiment 3.Knot
Fruit is as shown in table 4.
The inventive method of table 4. is compared with the time in the detection BAT26 sites of capillary electrophoresis kit and cost
From result, the detection in microsatellite instability site-BAT26 sites is carried out using the inventive method, each sample
Detection time shortens 50% than fragments analysis method, while the testing cost of each sample reduces 80%.Use the institute of the present invention
State method to detect for microsatellite instability (MSI), detection time and cost, more preferable clinical service can be greatlyd save
Patient.