CN107447032A - A kind of probe, primer and kit for detecting inborn gene - Google Patents
A kind of probe, primer and kit for detecting inborn gene Download PDFInfo
- Publication number
- CN107447032A CN107447032A CN201710839183.XA CN201710839183A CN107447032A CN 107447032 A CN107447032 A CN 107447032A CN 201710839183 A CN201710839183 A CN 201710839183A CN 107447032 A CN107447032 A CN 107447032A
- Authority
- CN
- China
- Prior art keywords
- genes
- probe
- primer
- foxp2
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 239000000523 sample Substances 0.000 title claims abstract description 92
- 108090000623 proteins and genes Proteins 0.000 title claims abstract description 32
- 108020002739 Catechol O-methyltransferase Proteins 0.000 claims abstract description 36
- 230000035772 mutation Effects 0.000 claims abstract description 36
- 101001059881 Homo sapiens Forkhead box protein P2 Proteins 0.000 claims abstract description 31
- 238000013461 design Methods 0.000 claims abstract description 10
- 238000006243 chemical reaction Methods 0.000 claims description 46
- 230000003321 amplification Effects 0.000 claims description 16
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 16
- 230000000295 complement effect Effects 0.000 claims description 12
- 102100028115 Forkhead box protein P2 Human genes 0.000 claims description 8
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 claims description 2
- 238000012408 PCR amplification Methods 0.000 claims description 2
- 108010006785 Taq Polymerase Proteins 0.000 claims description 2
- 238000001514 detection method Methods 0.000 abstract description 37
- 238000000034 method Methods 0.000 abstract description 21
- 108020004414 DNA Proteins 0.000 abstract description 9
- 230000035945 sensitivity Effects 0.000 abstract description 9
- 210000004369 blood Anatomy 0.000 abstract description 3
- 239000008280 blood Substances 0.000 abstract description 3
- 210000001124 body fluid Anatomy 0.000 abstract description 3
- 239000010839 body fluid Substances 0.000 abstract description 3
- 230000008014 freezing Effects 0.000 abstract description 3
- 238000007710 freezing Methods 0.000 abstract description 3
- 210000002381 plasma Anatomy 0.000 abstract description 2
- 239000013612 plasmid Substances 0.000 description 55
- 239000000243 solution Substances 0.000 description 13
- 238000010353 genetic engineering Methods 0.000 description 12
- 102100040999 Catechol O-methyltransferase Human genes 0.000 description 11
- 238000004458 analytical method Methods 0.000 description 11
- 238000012163 sequencing technique Methods 0.000 description 11
- 238000012360 testing method Methods 0.000 description 11
- 239000007984 Tris EDTA buffer Substances 0.000 description 10
- 239000012154 double-distilled water Substances 0.000 description 10
- 238000002474 experimental method Methods 0.000 description 10
- PEDCQBHIVMGVHV-UHFFFAOYSA-N Glycerine Chemical compound OCC(O)CO PEDCQBHIVMGVHV-UHFFFAOYSA-N 0.000 description 9
- 230000015572 biosynthetic process Effects 0.000 description 7
- 238000010790 dilution Methods 0.000 description 7
- 239000012895 dilution Substances 0.000 description 7
- 238000005516 engineering process Methods 0.000 description 7
- 206010064571 Gene mutation Diseases 0.000 description 6
- 239000003471 mutagenic agent Substances 0.000 description 6
- 238000003786 synthesis reaction Methods 0.000 description 6
- 238000012937 correction Methods 0.000 description 5
- 238000005259 measurement Methods 0.000 description 5
- 238000003753 real-time PCR Methods 0.000 description 5
- 230000004044 response Effects 0.000 description 5
- 101150106671 COMT gene Proteins 0.000 description 4
- 238000010791 quenching Methods 0.000 description 4
- 230000000171 quenching effect Effects 0.000 description 4
- 108090000790 Enzymes Proteins 0.000 description 3
- 102000004190 Enzymes Human genes 0.000 description 3
- 230000000869 mutational effect Effects 0.000 description 3
- 101150075185 Foxp2 gene Proteins 0.000 description 2
- 239000007853 buffer solution Substances 0.000 description 2
- YCIMNLLNPGFGHC-UHFFFAOYSA-N catechol Chemical compound OC1=CC=CC=C1O YCIMNLLNPGFGHC-UHFFFAOYSA-N 0.000 description 2
- 230000002068 genetic effect Effects 0.000 description 2
- 235000011187 glycerol Nutrition 0.000 description 2
- 238000007689 inspection Methods 0.000 description 2
- 239000007788 liquid Substances 0.000 description 2
- 206010003805 Autism Diseases 0.000 description 1
- 208000020706 Autistic disease Diseases 0.000 description 1
- 108020004705 Codon Proteins 0.000 description 1
- 206010010356 Congenital anomaly Diseases 0.000 description 1
- 238000002965 ELISA Methods 0.000 description 1
- 230000002159 abnormal effect Effects 0.000 description 1
- 230000000118 anti-neoplastic effect Effects 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 210000004556 brain Anatomy 0.000 description 1
- 150000003943 catecholamines Chemical class 0.000 description 1
- 210000000349 chromosome Anatomy 0.000 description 1
- 230000004087 circulation Effects 0.000 description 1
- 230000002950 deficient Effects 0.000 description 1
- 230000003111 delayed effect Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 239000003814 drug Substances 0.000 description 1
- 235000013399 edible fruits Nutrition 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 239000000284 extract Substances 0.000 description 1
- 238000011010 flushing procedure Methods 0.000 description 1
- 230000009395 genetic defect Effects 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 230000002503 metabolic effect Effects 0.000 description 1
- 230000036651 mood Effects 0.000 description 1
- 230000001459 mortal effect Effects 0.000 description 1
- 210000002442 prefrontal cortex Anatomy 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 230000000384 rearing effect Effects 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 235000015170 shellfish Nutrition 0.000 description 1
- 230000006641 stabilisation Effects 0.000 description 1
- 238000011105 stabilization Methods 0.000 description 1
- 238000007671 third-generation sequencing Methods 0.000 description 1
- 230000001988 toxicity Effects 0.000 description 1
- 231100000419 toxicity Toxicity 0.000 description 1
- 238000012549 training Methods 0.000 description 1
- 238000000870 ultraviolet spectroscopy Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A kind of probe, primer and kit for detecting inborn gene.It is used to detect the probe of logic and intelligent gene and language intelligence gene in inborn gene, primer and kit the invention discloses a kind of.The present invention designs probe and primer for the rs1456031 sites of FOXP2 genes, establishes real-time fluorescence PCR system, can detect rs4680, rs1456031 mutant form for the rs4680 sites design probe and primer of COMT genes；Detection sensitivity of the present invention is high, and the mutation of 100 500 copies can detect；The present invention can directly use the human gene group DNA from the source such as swab, fresh and freezing whole blood, blood plasma and body fluid, and simple to operate, detection is cheap, and clinical application range is wide；Present invention detection high specificity, detection speed is fast, and detection process only needs to complete for 80 minutes.
Description
Technical field
The present invention relates to technical field of molecular biology, and in particular to for detect in inborn gene logic and intelligent gene and
Probe, primer and the kit of language intelligence gene.
Background technology
Talent is exactly natural gift, is the growth characteristic just being had been provided with before growth.Possesses day in some things or field
The raw ability being good at innately holds thought（Great enthusiasm）, it is also possible to have, and allow its same experience even without
Grown up in the case of experience with the speed higher than other people, and have its singularity, particularity.If this people has
Growing potential and possibility in his performance in life, then he just possesses the inborn device of this aspect
Amount.
Each child is a cherub, and just wing is concealed when descending to the mortal world, has been melted into their talent, institute
It is special with each child, all capable wait is exploited, but parents can not all be the Bole with insight, often
The talent of child is can't see, various trainings have to be reported in the case where child's schoolwork burden is very heavy, and to child in being entangled with
Class is instructed, to score a lucky hit, child's potential is excited, does not know that things turn out contrary to one's wishes but, even more aggravated the burden of child.
The child of oneself is adapted to what is learned, and which field can violate difficulty to this many parent with emphasis culture in:If "
There is any method to detect all right.”
Biological educational circles finds several genes for being related to IQ formation at present.Wherein important has COMT genes and foxp2 genes.
The PROTEIN C OMT of COMT gene codes be primarily present with brain, it can interference body solve problem center -- most prefrontal cortex
Activity.COMT is the main metabolic enzyme of degraded catecholamine, and internal catechol can be made to lose bioactivity or toxicity.If production
Raw gene mutation, then it can reduce thinking elasticity.And Foxp2 genes（Forkhead box p2）That is jaw frame P2 genes, it is control
The gene of language ability development.In the mankind, FOXP2 genes are on the 7th pair of chromosome.It is that have complicated hair many other
The animal of sound and song learning ability, such as in song bird, be also found.Therefore the gene, which is undergone mutation, can influence language ability,
It is also an autism susceptibility gene simultaneously.So that the abnormal of it causes specific congenital disfluency in the mankind.
The change of these genes will seriously affect the IQ potentiality of a people.For a children, if parent is not because
Know existing genetic defect, the IQ culture without paying special attention to child, miss the optimal time for improving IQ, will
Irretrievable loss can be caused throughout one's life to child.
IQ test at present is typically tested using psychology scaling method questionnaire.Such IQ is tested easily by mood, body
The influence of body quality, repeatability is low, with a low credibility, contingency is big.The accuracy tested is affected by the external environment larger.Due to
Requirement to measured's degree of cooperation, typically all it is unsuitable for testing child before young children, especially 5 years old.But due to
People's IQ in children sharply increases, and early education is all most important to all one's life of individual.If the people biology related to IQ
It is defective to learn hereditary capacity, early detection and takes measures more play significant role in time.
Detect method or DNA direct sequencings, chip method or dye method of inborn gene etc. at present, but direct sequencing,
Chip method, dye method sensitivity are low, and poor specificity, only 20-30%, detecting step is cumbersome, and efficiency is low, at least needs 2-3 days
Time can just go out result；And if during sample genomic dna content rareness, direct sequencing can cause substantial amounts of missing inspection and vacation
Feminine gender, so being important to the detection method of high sensitivity and high specific a kind of to realize the detection of gene mutation.The present invention carries
For a kind of easy, objectively method carries out the test of children intelligence biological heredity characteristic, there is provided weight during to rearing style child
The reference information wanted, there is very positive meaning to follow-on culture.
The content of the invention
The RS4680 that one of the technical problem to be solved in the present invention is to provide for detecting COMT genes is mutated and FOXP2 bases
The probe of the rs1456031 mutation of cause.
The RS4680 that the second technical problem to be solved by the present invention is to provide for detecting COMT genes is mutated and FOXP2 bases
The primer of the rs1456031 mutation of cause.
The RS4680 that the third technical problem to be solved by the present invention is to provide for detecting COMT genes is mutated and FOXP2 bases
The kit of the rs1456031 mutation of cause.
In order to solve the above technical problems, the present invention adopts the following technical scheme that：
In one aspect of the invention, there is provided a kind of probe for the RS4680 mutation for being used to detect COMT genes, the probe is to be directed to
The RS4680 sites design of COMT genes is detected, its sequence is：
COMTwp:Fam+CGCTGGCATGAAGGAC+MGB, as shown in SEQIDNo.3 or its complementary strand；And COMTmp: VIC+
CGCTGGCgTGAAGGAC+MGB, as shown in SEQIDNo.4 or its complementary strand；
In another aspect of this invention, there is provided a kind of primer for the RS4680 mutation for being used to detect COMT genes, the primer is pin
The RS4680 sites of COMT genes are designed, its sequence is：
COMTF:ACCCAGCGGATGGTGGAT, as shown in SEQIDNo.1；
COMTR:ACAACGGGTCAGGCATGC, as shown in SEQIDNo.2；
In another aspect of this invention, there is provided a kind of probe for being used to detect the rs1456031 sites of FOXP2 genes, its feature
It is, the probe is that the rs1456031 sites for being directed to FOXP2 genes are designed, and its sequence is：
FOXP2wp:Fam+TTGTGATTGTACGCCTACAAA+MGB, as shown in SEQIDNo.7 or its complementary strand；With
FOXP2mp:VIC+TTGTGATTGCACGCCTACAAA+MGB, as shown in SEQIDNo.8 or its complementary strand；
In another aspect of this invention, there is provided a kind of primer for being used to detect the rs1456031 site mutations of FOXP2 genes, its
It is characterised by, the primer is that the rs1456031 sites for being directed to FOXP2 genes are designed, and its sequence is：
FOXP2F:TTACATGCTTCCCTTTAGTTAATAAT, as shown in SEQIDNo.5；
FOXP2R:TCTGCTATCCTGTAATAATAAGCATAC, as shown in SEQIDNo.6；
The present invention is used for PCR primer and the spy that the rs1456031 for the RS4680 mutation and FOXP2 genes for detecting COMT genes is mutated
Pin design method, it is specially：Forward and reverse PCR universal primers are designed in gene very high homology and conservative region, in mutated site
Design corresponding fluorescence probe.
In another aspect of this invention, there is provided a kind of RS4680 mutation for being used to detect COMT genes and FOXP2 genes
The PCR amplification kits of rs1456031 mutation, it includes dNTP, Mg2+, Taq DNA polymerase, Tris-HCl systems, specificity
Primer, wild-type probe, saltant type probe, the specific primer be COMTF, COMTR as described above, FOXP2F,
FOXP2R primer pairs, the wild-type probe, saltant type probe be COMTwp, COMTmp as described above, FOXP2wp,
FOXP2mp probes.
The present invention is using the principle of TaqMan-MGB detections, and in gene very high homology and the forward and reverse PCR of conserved regions design is general draws
Thing, corresponding probe is designed in mutated site, wild-type probe can hybridize completely in wild-type template（That is the left side in Fig. 1
The amplification on side）, fluorescence signal can be detected, and in saltant type template, it can not hybridize fully, can't detect fluorescence signal.
In another aspect of this invention, there is provided application of the above-mentioned probe in inborn gene detecting kit.
In another aspect of this invention, there is provided application of the above-mentioned primer in inborn gene detecting kit.
The present invention can be used for scientific research, other technical tie-ups of clinical detection use with existing, and these technologies include：The first generation
Sequencing, second generation sequencing, third generation sequencing, genetic chip, the reverse molecule hybridization of PCR-ELISA, PCR-, PCR- genetic chips point
Analysis；The present invention be applied to mankind's talent gene detection, including but not limited to the RS4680 codon mutations of COMT genes and
The rs1456031 mutation of FOXP2 genes.
Compared with prior art, the beneficial effects of the present invention are：
（1）The present invention establishes real-time fluorescence PCR system, can detect RS4680 mutation and the FOXP2 genes of COMT genes
Rs1456031 mutant forms；
（2）Detection sensitivity is high, and the mutation of 100-500 copies can detect；
（3）The human gene group DNA from the source such as swab, fresh and freezing whole blood, blood plasma and body fluid, operation letter can directly be used
Single, detection is cheap, and clinical application range is wide；
（4）Detection speed is fast, and detection process only needs to complete for 80 minutes, and compared with direct sequencing, the present invention can be
Detection, experimental result concordance rate 100% are completed in 80 minutes, but experimental period at least saves 2-3 days；
（5）High specificity is detected, experiments verify that, with the COMT mutational sites that the primer and probe of the present invention obtains with directly surveying
The mutational site that sequence method obtains is consistent, detects high specificity.Have in the screening of antineoplastic target medicine from now on is anti-extensive
Application prospect.
Embodiment
With embodiment, the present invention is further detailed explanation below.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.
Embodiment 1
1st, the present invention is detected with genetic engineering recombinant plasmid, using rs4680 saltant types as detection object.Through genetic engineering structure
For plasmid with rs4680 mutators as detection object, plasmid pCOMTM is the plasmid with rs4680 mutation；Plasmid
PCOMTW is the plasmid with wild type rs4680 genes.These plasmids are dissolved in TE buffer solutions（10mMTris-HCl,
1mMEDTA, PH=8.0）In, through ultraviolet specrophotometer quality measurement and concentration, plasmid copy number is calculated, with TE buffer solutions ladder
Degree dilution acquisition 10000,1000,100,10 copies/ul pCOMTM and pCOMTW plasmid solutions, then react mould as PCR
Plate.
2nd, the synthesis of COMT specific primers and probe：According to people COMT gene mutation sites (rs4680), 2 are designed
Probe, 5 ' end flag F AM (green fluorescence) or VIC (yellow fluorescence), 3 ' end mark MGB quenching groups, brilliant molecule is dodged by Shanghai
Bio tech ltd synthesizes and mark.Probe sequence and mark are as follows：
COMTwp:Fam+CGCTGGCATGAAGGAC+MGB, as shown in SEQIDNo.3 or its complementary strand；And COMTmp: VIC+
CGCTGGCgTGAAGGAC+MGB, as shown in SEQIDNo.4 or its complementary strand；
PCR primer PRIMER5 programmings, rs4680 site sequence primers are as follows：
COMTF:ACCCAGCGGATGGTGGAT, as shown in SEQIDNo.1；
COMTR:ACAACGGGTCAGGCATGC, as shown in SEQIDNo.2；
Above-mentioned primer is synthesized by Shanghai Shan Jing molecular biosciences Science and Technology Ltd..
3rd, Fluorescence PCR：The present invention is detected with genetic engineering recombinant plasmid, using rs4680 saltant types as detection object.
For the plasmid with rs4680 mutators through genetic engineering structure as detection object, plasmid pCOMTM is to be dashed forward with rs4680
The plasmid of change；Plasmid pCOMTW is the plasmid with wild type rs4680.These plasmids are dissolved in TE buffer solutions（10mMTris-
HCl, 1mMEDTA, PH=8.0）In, through ultraviolet specrophotometer quality measurement and concentration, plasmid copy number is calculated, is buffered with TE
Liquid gradient dilution acquisition 10000,1000,100,10 copies/ul pCOMTM and pCOMTW plasmid solutions, then as PCR moulds
Plate carries out amplified reaction, using 2 × GoldernStarTaqMasterMix (be century purchased from health, the lTaq of μ containing 0.05U/ enzymes,
0.5mMdNTP, PCR buffer solution（Containing Mg2+And 10% glycerine) and above-mentioned primer, probe prepare 20 μ lPCR reaction systems, Mei Gemo
Plate amounts to 2 reactions, notices that each reaction takes DNA profiling amount the same, reaction system is specific as follows：
The reaction system of first reaction of pCOMTM templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| COMTF (25pmol/ul) | 1 | 0.5uM |
| COMTR (25pmol/ul) | 1 | 0.5uM |
| COMTW (25pmol/ul) | 0.5 | 0.25uM |
| pCOMTM (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
The reaction system of second reaction of pCOMTM templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| COMTF (25pmol/ul) | 1 | 0.5uM |
| COMTR (25pmol/ul) | 1 | 0.5uM |
| COMTM (25pmol/ul) | 0.5 | 0.25uM |
| pCOMTM (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
The reaction system of first reaction of pCOMTW templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| COMTF (25pmol/ul) | 1 | 0.5uM |
| COMTR (25pmol/ul) | 1 | 0.5uM |
| COMTW (25pmol/ul) | 0.5 | 0.25uM |
| pCOMTW (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
The reaction system of second reaction of pCOMTW templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| COMTF (25pmol/ul) | 1 | 0.5uM |
| COMTR (25pmol/ul) | 1 | 0.5uM |
| COMTM (25pmol/ul) | 0.5 | 0.25uM |
| pCOMTW (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
Reacted using ABI7500 line fluorescent quantitative PCR apparatus, specific response procedures set as follows：
94℃,5min; (94℃,20s;60℃,30s) x40;The detection of Fam/VIC fluorescence signals is set at 72 degree.
Analysis of test results：
Confirm non-selected correction fluorescence reference, amplification curve is analyzed.According to image adjustment Baseline after analysis
Start values, End values（User can voluntarily adjust according to actual conditions, and Start values can may be provided in 5 in 3~15, End values~
20）, Threshold values（Rn）Select at the flex point for amplification curve rise（Have just enter into increased logarithmic phase）, click on Analyze
Analyzed, then to the Ct values each reacted are recorded under Plate windows, result judgement is carried out according to criterion.Each mould
Plate has 2 reactions, that is, has 2 Ct values, Ct values<35 for the positive, 35<Ct<40 be critical value（Gray area）, no Ct values for the moon
Property.If Ct values fall in gray area, it is necessary to the experiment that tries again again, to reaffirm.In this experiment, pCOMTM templates the
One reaction, during with COMTW probes, Ct=0;When COMTM probes are used in second reaction of pCOMTM templates, Ct=32, detection knot
Fruit illustrates that this template is positive for COMT saltant types, and this is consistent with our actual template pCOMTM templates；PCOMTW templates
One reaction, during with COMTW probes, Ct=32.2;When COMTM probes are used in second reaction of pCOMTW templates, Ct=0, detection
As a result it is COMT wild-type positives to illustrate this template, and this is consistent with our actual template pCOMTW templates；
Experimental result is as follows：
During with pCOMTM templates：
| Ct values | |
| COMTW | 0 |
| COMTM | 32 |
During with pCOMTW templates：
| Ct values | |
| COMTW | 32.2 |
| COMTM | 0 |
Embodiment 2
1st, the present invention is detected with genetic engineering recombinant plasmid, using rs1456031 saltant types as detection object.Built through genetic engineering
The plasmid with rs1456031 mutators as detection object, plasmid pFOXP2M is the matter with rs1456031 mutation
Grain；Plasmid pFOXP2W is the plasmid with wild type rs1456031 genes.These plasmids are dissolved in TE buffer solutions
（10mMTris-HCl, 1mMEDTA, PH=8.0）In, through ultraviolet specrophotometer quality measurement and concentration, calculate plasmid copy
Number, obtain 10000 with the dilution of TE buffer gradients, 1000,100,10 copies/ul pFOXP2M and pFOXP2W plasmid solutions,
Then PCR reaction templates are used as.
2nd, the synthesis of FOXP2 specific primers and probe：According to people FOXP2 gene mutation sites (rs1456031), if
2 probes are counted, 5 ' end flag F AM (green fluorescence) or VIC (yellow fluorescence), 3 ' end mark MGB quenching groups, are dodged by Shanghai brilliant
Molecular biosciences Science and Technology Ltd. synthesizes and mark.Probe sequence and mark are as follows：
FOXP2wp:Fam+TTGTGATTGTACGCCTACAAA+MGB, as shown in SEQIDNo.7 or its complementary strand；With
FOXP2mp:VIC+TTGTGATTGCACGCCTACAAA+MGB, as shown in SEQIDNo.8 or its complementary strand；
PCR primer PRIMER5 programmings, rs1456031 site sequence primers are as follows：
FOXP2F:TTACATGCTTCCCTTTAGTTAATAAT, as shown in SEQIDNo.5；
FOXP2R:TCTGCTATCCTGTAATAATAAGCATAC, as shown in SEQIDNo.6；
Above-mentioned primer is synthesized by Shanghai Shan Jing molecular biosciences Science and Technology Ltd..
3rd, Fluorescence PCR：The present invention is detected with genetic engineering recombinant plasmid, using rs1456031 saltant types as detection pair
As.The plasmid with rs1456031 mutators through genetic engineering structure as detection object, plasmid pFOXP2M for
The plasmid of rs1456031 mutation；Plasmid pFOXP2W is the plasmid with wild type rs1456031.These plasmids are dissolved in TE and delayed
Fliud flushing（10mMTris-HCl, 1mMEDTA, PH=8.0）In, through ultraviolet specrophotometer quality measurement and concentration, calculate plasmid and copy
Shellfish number, obtain 10000 with the dilution of TE buffer gradients, 1000,100,10 copies/ul pFOXP2M and pFOXP2W plasmids it is molten
Liquid, amplified reaction then is carried out as pcr template, (is century purchased from health, contains using 2 × GoldernStarTaqMasterMix
0.05U/ μ lTaq enzymes, 0.5mMdNTP, PCR buffer solution（Containing Mg2+And 10% glycerine) and above-mentioned primer, that probe prepares 20 μ lPCR is anti-
System is answered, each template amounts to 2 reactions, notices that each reaction takes DNA profiling amount the same, reaction system is specifically such as
Under：
The reaction system of first reaction of pFOXP2M templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| FOXP2F (25pmol/ul) | 1 | 0.5uM |
| FOXP2R (25pmol/ul) | 1 | 0.5uM |
| FOXP2W (25pmol/ul) | 0.5 | 0.25uM |
| pFOXP2M (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
The reaction system of second reaction of pFOXP2M templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| FOXP2F (25pmol/ul) | 1 | 0.5uM |
| FOXP2R (25pmol/ul) | 1 | 0.5uM |
| FOXP2M (25pmol/ul) | 0.5 | 0.25uM |
| pFOXP2M (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
The reaction system of first reaction of pFOXP2W templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| FOXP2F (25pmol/ul) | 1 | 0.5uM |
| FOXP2R (25pmol/ul) | 1 | 0.5uM |
| FOXP2W (25pmol/ul) | 0.5 | 0.25uM |
| pFOXP2W (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
The reaction system of second reaction of pFOXP2W templates：
| Component | Volume (ul) | Ultimate density |
| 2×GoldernStarTaqMasterMix | 25 | 1 X |
| FOXP2F (25pmol/ul) | 1 | 0.5uM |
| FOXP2R (25pmol/ul) | 1 | 0.5uM |
| FOXP2M (25pmol/ul) | 0.5 | 0.25uM |
| pFOXP2W (100copies/ul) | 2 | 4copies/ul |
| ddH2O (ul) | 20.5 | - |
| Total Volume(ul) | 50 | - |
Reacted using ABI7500 line fluorescent quantitative PCR apparatus, specific response procedures set as follows：
94℃,5min; (94℃,20s;60℃,30s) x40;The detection of Fam/VIC fluorescence signals is set at 72 degree.
Analysis of test results：
Confirm non-selected correction fluorescence reference, amplification curve is analyzed.According to image adjustment Baseline after analysis
Start values, End values（User can voluntarily adjust according to actual conditions, and Start values can may be provided in 5 in 3~15, End values~
20）, Threshold values（Rn）Select at the flex point for amplification curve rise（Have just enter into increased logarithmic phase）, click on Analyze
Analyzed, then to the Ct values each reacted are recorded under Plate windows, result judgement is carried out according to criterion.Each mould
Plate has 2 reactions, that is, has 2 Ct values, Ct values<35 for the positive, 35<Ct<40 be critical value（Gray area）, no Ct values for the moon
Property.If Ct values fall in gray area, it is necessary to the experiment that tries again again, to reaffirm.In this experiment, pFOXP2M templates
First reaction, during with FOXP2W probes, Ct=0;When FOXP2M probes are used in second reaction of pFOXP2M templates, Ct=33, inspection
Survey result and illustrate that this template is positive for FOXP2 saltant types, this is consistent with our actual template pFOXP2M templates；pFOXP2W
The reaction of template first, during with FOXP2W probes, Ct=32.7;When FOXP2M probes are used in second reaction of pFOXP2W templates,
Ct=0, testing result illustrate that this template is FOXP2 wild-type positives, and this is consistent with our actual template pFOXP2W templates；
Experimental result is as follows：
During with pFOXP2M templates：
| Ct values | |
| FOXP2W | 0 |
| FOXP2M | 33 |
During with pCOMTW templates：
| Ct values | |
| FOXP2W | 32.7 |
| FOXP2M | 0 |
Embodiment 3：
1st, the sensitivity of the present invention is detected with genetic engineering recombinant plasmid, through genetic engineering structure with COMT mutators
For plasmid as detection object, plasmid pCOMTM is the plasmid with RS4680 mutation；Plasmid pCOMTW is with wild type COMT
The plasmid of gene.These plasmids are dissolved in TE buffer solutions（10mMTris-HCl, 1mMEDTA, PH=8.0）In, through ultraviolet spectrometry light
Degree meter quality measurement and concentration, calculates plasmid copy number, diluted with TE buffer solutions the pCOMTM that obtains 100 copies/ul and
PCOMTW plasmid solutions, then as PCR reaction templates.
2nd, the synthesis of COMT specific primers and probe：According to people's COMT gene mutation sites, 2 probes, 5 ' end marks are designed
FAM (green fluorescence) or VIC (yellow fluorescence), 3 ' end mark MGB quenching groups；The limited public affairs of brilliant molecular biosciences science and technology are dodged by Shanghai
Department's synthesis and mark.Probe sequence and mark are the same as embodiment 1.
3rd, Fluorescence PCR：Using 100 good copies of above-mentioned dilution/ul pCOMTM and pCOMTW plasmids as template, respectively
Take 0.5ul, 1ul, 2ul, 4ul to do to react, to detect the sensitivity of this kit.For example above-mentioned embodiment 1 of reaction system, simply add
The template entered is different with ddH2O.
Reacted using ABI7500 line fluorescent quantitative PCR apparatus, specific response procedures set as follows：
94℃,5min; (94℃,20s;60℃,30s) x40;The detection of Fam/VIC fluorescence signals is set at 72 degree
Analysis of test results：
Confirm non-selected correction fluorescence reference, amplification curve is analyzed.According to image adjustment Baseline after analysis
Start values, End values（User can voluntarily adjust according to actual conditions, and Start values can may be provided in 5 in 3~15, End values~
20）, Threshold values（Rn）Select at the flex point for amplification curve rise（Have just enter into increased logarithmic phase）, click on Analyze
Analyzed, then to the Ct values each reacted are recorded under Plate windows, result judgement is carried out according to criterion.Each mould
Plate has 2 reactions, that is, has 2 Ct values, Ct values<35 for the positive, 35<Ct<40 be critical value（Gray area）, no Ct values for the moon
Property.If Ct values fall in gray area, it is necessary to the experiment that tries again again, to reaffirm.Ct=0 of 0.5ul templates is added, greatly
In 0.5ul, there are Ct values, show the detection sensitivity of the kit between 100-500copy；
As a result it is as follows：
COMTwp probes, pCOMTW templates：
| Ct values | ||
| 0.5ul | 50copy | 0 |
| 1ul | 100copy | 33. 84 |
| 2ul | 200copy | 32.41 |
| 4ul | 400copy | 31.86 |
COMTmp probes, pCOMTM templates：
| Ct values | ||
| 0.5ul | 50copy | 0 |
| 1ul | 100copy | 33.33 |
| 2ul | 200copy | 32.13 |
| 4ul | 400copy | 31.26 |
4. the rs1456031 sites of FOXP2 genes, the implementation of sensitivity technique experiment is similar with the above method, detection sensitivity
It is and very high.
Embodiment 4
1st, the stability of the present invention is detected with genetic engineering recombinant plasmid, COMT mutators are carried through genetic engineering structure
Plasmid as detection object, plasmid pCOMTM is the plasmid with RS4680 mutation；Plasmid pCOMTW is with wild type
The plasmid of COMT genes.These plasmids are dissolved in TE buffer solutions（10mMTris-HCl, 1mMEDTA, PH=8.0）In, through ultraviolet point
Light photometric determination quality and concentration, calculate plasmid copy number, with TE buffer solutions dilute obtain 1000 copies/ul pCOMTM and
PCOMTW plasmid solutions, then as PCR reaction templates.
2nd, the synthesis of COMT specific primers and probe：According to people's COMT gene mutation sites, 2 probes, 5 ' end marks are designed
FAM (green fluorescence) or VIC (yellow fluorescence), 3 ' end mark MGB quenching groups；The limited public affairs of brilliant molecular biosciences science and technology are dodged by Shanghai
Department's synthesis and mark.Probe sequence and mark such as embodiment 2.
3rd, Fluorescence PCR：Using 1000 good copies of above-mentioned dilution/ul pCOMTM and pCOMTW plasmids as template, point
Do not take 5ul to do to react, 10 multiple holes are done in each reaction, to detect the repeatability of this kit.For example above-mentioned embodiment of reaction system
1, the template simply added is different with ddH2O.
Reacted using ABI7500 line fluorescent quantitative PCR apparatus, specific response procedures set as follows：
94℃,5min; (94℃,20s;60℃,30s) x40;The detection of Fam/VIC fluorescence signals is set at 72 degree
Analysis of test results：
Confirm non-selected correction fluorescence reference, amplification curve is analyzed.According to image adjustment Baseline after analysis
Start values, End values（User can voluntarily adjust according to actual conditions, and Start values can may be provided in 5 in 3~15, End values~
20）, Threshold values（Rn）Select at the flex point for amplification curve rise（Have just enter into increased logarithmic phase）, click on Analyze
Analyzed, then to the Ct values each reacted are recorded under Plate windows, result judgement is carried out according to criterion.Each mould
Plate has 2 reactions, that is, has 2 Ct values, Ct values<35 for the positive, 35<Ct<40 be critical value（Gray area）, no Ct values for the moon
Property.If Ct values fall in gray area, it is necessary to the experiment that tries again again, to reaffirm.Final Ct values are basically identical, and difference is not
To 0. 5 circulations, the result shows stabilization of kit, repeatability very well.
As a result it is as follows：
COMTwp probes, pCOMTW templates：
| 5ul,5000copy | Ct values |
| Parallel 1 | 28.34 |
| Parallel 2 | 28.48 |
| Parallel 3 | 28.35 |
| Parallel 4 | 28.24 |
| Parallel 5 | 28.44 |
| Parallel 6 | 28.27 |
| Parallel 7 | 28.49 |
| Parallel 8 | 28.15 |
| Parallel 9 | 28.23 |
| Parallel 10 | 28.71 |
COMTmp probes, pCOMTM templates：
| 5ul,5000copy | Ct values |
| Parallel 1 | 28.24 |
| Parallel 2 | 28.66 |
| Parallel 3 | 28.63 |
| Parallel 4 | 28.34 |
| Parallel 5 | 28.42 |
| Parallel 6 | 28.28 |
| Parallel 7 | 28.63 |
| Parallel 8 | 28.15 |
| Parallel 9 | 28.41 |
| Parallel 10 | 28.46 |
4. the rs1456031 sites of FOXP2 genes, the implementation of Detection of Stability experiment is similar with the above method, as a result and steady
It is qualitative fine.
Embodiment 5：
1st, 10 people's samples through the authenticated rs4680 sites of direct sequencing are extracted（From swab, fresh and freezing whole blood
With the source such as body fluid）, it is as follows to detect rs4680 catastrophes through direct sequencing：
| RS4680 sites | |
| Clinical sample 1 | Saltant type |
| Clinical sample 2 | Saltant type |
| Clinical sample 3 | Wild type |
| Clinical sample 4 | Wild type |
| Clinical sample 5 | Wild type |
| Clinical sample 6 | Saltant type |
| Clinical sample 7 | Wild type |
| Clinical sample 8 | Saltant type |
| Clinical sample 9 | Wild type |
| Clinical sample 10 | Saltant type |
2nd, it is as follows using specific primer and fluorescence probe detection the clinical sample step of the present invention：
（1）The acquisition of genomic DNA：Extracted according to QIAGEN poba gene group extracts kits operation instruction, the DNA matter of acquisition
Amount is qualified through UV spectrophotometer measuring, then by each sample genomic dna concentration dilution to 30ng/ul, as follow-up PCR
Template.
（2）Real-time fluorescence PCR reacts：With reference to embodiment 1,2,3
Reacted using ABI7500 line fluorescent quantitative PCR apparatus, specific response procedures set as follows：
94℃,5min; (94℃,20s;60℃,30s) x40;The detection of Fam/VIC fluorescence signals is set at 72 degree.
Analysis of test results：
Confirm non-selected correction fluorescence reference, amplification curve is analyzed.According to image adjustment Baseline after analysis
Start values, End values（User can voluntarily adjust according to actual conditions, and Start values can may be provided in 5 in 3~15, End values~
20）, Threshold values（Rn）Select at the flex point for amplification curve rise（Have just enter into increased logarithmic phase）, click on Analyze
Analyzed, then to the Ct values each reacted are recorded under Plate windows, result judgement is carried out according to criterion.Each mould
Plate has 2 reactions, that is, has 2 Ct values, Ct values<35 for the positive, 35<Ct<40 be critical value（Gray area）, no Ct values for the moon
Property.If Ct values fall in gray area, it is necessary to the experiment that tries again again, to reaffirm.
As a result it is as follows：
| RS4680W | RS4680M | |
| Clinical sample 1 | 0 | 25.42 |
| Clinical sample 2 | 0 | 27.38 |
| Clinical sample 3 | 27.77 | 0 |
| Clinical sample 4 | 25.56 | 0 |
| Clinical sample 5 | 26.93 | 0 |
| Clinical sample 6 | 0 | 24.41 |
| Clinical sample 7 | 26.74 | 0 |
| Clinical sample 8 | 0 | 25.22 |
| Clinical sample 9 | 25.46 | 0 |
| Clinical sample 10 | 0 | 25.85 |
Testing result shows：The mutation that the COMT mutational sites obtained with the primer and probe of the present invention obtain with direct sequencing
Site is consistent.Compared with direct sequencing, the present invention can complete to detect in 80 minutes, experimental result concordance rate 100%, but
Experimental period at least saves 2-3 days.
The rs1456031 sites of FOXP2 genes, the implementation of actual sample test experience is similar with the above method, as a result
Comply fully with PCR sequencing PCR.
Primer probe sequence list：
| SEQIDNo.1 | COMTF | ACCCAGCGGATGGTGGAT |
| SEQIDNo.2 | COMTR | ACAACGGGTCAGGCATGC |
| SEQIDNo.3 | COMTwp | CGCTGGCATGAAGGAC |
| SEQIDNo.4 | COMTmp | CGCTGGCgTGAAGGAC |
| SEQIDNo.5 | FOXP2F | TTACATGCTTCCCTTTAGTTAATAAT |
| SEQIDNo.6 | FOXP2R | TCTGCTATCCTGTAATAATAAGCATAC |
| SEQIDNo.7 | FOXP2wp | TTGTGATTGTACGCCTACAAA |
| SEQIDNo.8 | FOXP2mp | TTGTGATTGCACGCCTACAAA |
Claims (9)
1. the probe in the rs4680 sites for detecting COMT genes, it is characterised in that the probe is for COMT genes
The design of rs4680 sites, its sequence is：
COMTwp:Fam+CGCTGGCATGAAGGAC+MGB, as shown in SEQIDNo.3 or its complementary strand；And COMTmp: VIC+
CGCTGGCgTGAAGGAC+MGB, as shown in SEQIDNo.4 or its complementary strand；
The probe is used for the RS4680 mutation for detecting COMT genes, by analyzing amplification curve, records each reaction
Ct values, come judgement sample whether occur COMT genes RS4680 mutation.
2. the primer of the RS4680 mutation for detecting COMT genes, it is characterised in that the primer is for COMT genes
The design of RS4680 sites, its sequence is：
COMTF:ACCCAGCGGATGGTGGAT, as shown in SEQIDNo.1；
COMTR:ACAACGGGTCAGGCATGC, as shown in SEQIDNo.2；
The primer is used for the RS4680 mutation for detecting COMT genes, by analyzing amplification curve, records each reaction
Ct values, come judgement sample whether occur COMT genes RS4680 mutation.
3. the probe in the rs1456031 sites for detecting FOXP2 genes, it is characterised in that the probe is to be directed to FOXP2 genes
Rs1456031 sites design, its sequence is：
FOXP2wp:Fam+TTGTGATTGTACGCCTACAAA+MGB, as shown in SEQIDNo.7 or its complementary strand；With
FOXP2mp:VIC+TTGTGATTGCACGCCTACAAA+MGB, as shown in SEQIDNo.8 or its complementary strand；
The probe is used for the rs1456031 site mutations for detecting FOXP2 genes, by analyzing amplification curve, record
The Ct values each reacted, carry out the rs1456031 site mutations whether judgement sample occurs FOXP2 genes.
4. the primer of the rs1456031 site mutations for detecting FOXP2 genes, it is characterised in that the primer is to be directed to FOXP2
The rs1456031 sites design of gene, its sequence is：
FOXP2F:TTACATGCTTCCCTTTAGTTAATAAT, as shown in SEQIDNo.5；
FOXP2R:TCTGCTATCCTGTAATAATAAGCATAC, as shown in SEQIDNo.6；
The primer is used for the rs1456031 site mutations for detecting FOXP2 genes, by analyzing amplification curve, record
The Ct values each reacted, carry out the rs1456031 site mutations whether judgement sample occurs FOXP2 genes.
A kind of 5. PCR amplifications of the rs1456031 site mutations of RS4680 mutation for being used to detect COMT genes and FOXP2 genes
Kit, it includes dNTP, Mg2+, Taq DNA polymerase, Tris-HCl systems, specific primer, wild-type probe, saltant type
Probe, it is characterised in that：
The wild-type probe, saltant type probe are the probe as described in claim 1, claim 3.
6. the specific primer is the primer as described in claim 2, claim 4.
7. the kit is used for RS4680 mutation and the rs1456031 site mutations of FOXP2 genes for detecting COMT genes, lead to
Cross and amplification curve is analyzed, record the Ct values each reacted, carry out judgement sample the RS4680 of COMT genes whether occurs to dash forward
Become the rs1456031 site mutations with FOXP2 genes.
8. application of the probe in inborn gene detecting kit as described in claim 1, claim 3.
9. application of the primer in inborn gene detecting kit as described in claim 2, claim 4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710839183.XA CN107447032A (en) | 2017-10-30 | 2017-10-30 | A kind of probe, primer and kit for detecting inborn gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710839183.XA CN107447032A (en) | 2017-10-30 | 2017-10-30 | A kind of probe, primer and kit for detecting inborn gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107447032A true CN107447032A (en) | 2017-12-08 |
Family
ID=60496713
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710839183.XA Pending CN107447032A (en) | 2017-10-30 | 2017-10-30 | A kind of probe, primer and kit for detecting inborn gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107447032A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820545A (en) * | 2014-02-11 | 2014-05-28 | 上海鼎晶生物医药科技有限公司 | Probes, primers and kits for detecting ABCG2 gene mutations |
| CN106086179A (en) * | 2016-06-16 | 2016-11-09 | 北京东方亚美基因科技研究院有限公司 | A kind of gene tester assessing child's natural endowment ability |
| CN107058510A (en) * | 2017-03-01 | 2017-08-18 | 上海闪锦生物科技有限公司 | A kind of probe, primer and kit for being used to detect people's Brca tumor susceptibility genes |
-
2017
- 2017-10-30 CN CN201710839183.XA patent/CN107447032A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103820545A (en) * | 2014-02-11 | 2014-05-28 | 上海鼎晶生物医药科技有限公司 | Probes, primers and kits for detecting ABCG2 gene mutations |
| CN106086179A (en) * | 2016-06-16 | 2016-11-09 | 北京东方亚美基因科技研究院有限公司 | A kind of gene tester assessing child's natural endowment ability |
| CN107058510A (en) * | 2017-03-01 | 2017-08-18 | 上海闪锦生物科技有限公司 | A kind of probe, primer and kit for being used to detect people's Brca tumor susceptibility genes |
Non-Patent Citations (1)
| Title |
|---|
| 孙颖等: "COMT基因多态性rs4818与精神分裂症及迟发性运动障碍的关联性分析", 《吉林大学学报(医学版)》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110878343B (en) | Cpf1 kit for rapidly detecting genetic deafness pathogenic gene SLC26A4 mutation and detection method thereof | |
| CN108118081B (en) | Hand-free direct amplification type rapid test strip detection method and kit for SNP typing of human PAH gene | |
| CN107488711B (en) | Method for detecting genotype of point mutation and kit thereof | |
| Amin et al. | A genome-wide linkage study of individuals with high scores on NEO personality traits | |
| CN107058538B (en) | Primer composition, kit composed of primer composition and application of kit | |
| CN106367491A (en) | Kit for detecting deafness susceptibility genes | |
| CN104673891B (en) | A kind of detection method and kit of spinal muscular atrophy associated gene mutation | |
| CN103555835A (en) | Primer and probe for screening spinal muscular atrophy (SMA) genes and using method of primer and probe | |
| CN111979313A (en) | Specific primer and kit for detecting pathogenic variation of deafness gene based on multiplex PCR and high-throughput sequencing technology and application | |
| CN106636441A (en) | Probe for detecting mutation of gene ALDH2, as well as application thereof and kit | |
| CN110551812B (en) | CRISPR-Cas system for diagnosing spinal muscular atrophy and application thereof | |
| CN106498078A (en) | A kind of method of the single nucleotide polymorphism of detection sheep KITLG genes and its application | |
| CN106957904B (en) | A kind of PCR fluorescent molecular bacon probe detecting drug-induced deafness | |
| CN105648088A (en) | AD or MCI detection marker and detection method thereof | |
| CN104087672A (en) | Kit for quickly detecting number of human chromosomes 21 by multiplex real-time fluorescence quantitative PCR (polymerase chain reaction) technique | |
| CN114134239B (en) | Kit for rapidly evaluating quality of mammalian cells by PCR method and detection method thereof | |
| CN107447032A (en) | A kind of probe, primer and kit for detecting inborn gene | |
| CN108998543A (en) | A kind of SNP marker relevant to swine erythrocyte number character | |
| CN104450918B (en) | The method in detection FGF13 Exon 2 mutational site and test kit thereof | |
| CN104087671A (en) | Kit used for detecting number of human chromosomes 21 | |
| CN110305947A (en) | The detection method of chromosome long segment insertion and the long segment based on MassARRAY platform are inserted into detection method | |
| CN115927677B (en) | Detection method and application of burkholderia melioides based on specific sequence tag | |
| CN106868173A (en) | A kind of primer of TaqMan MGB sonde methods detection mankind's ADH1B gene pleiomorphisms and its application | |
| CN114277187B (en) | MNP (MNP) marker combination, primer pair combination, kit and application of MNP marker combination and primer pair combination | |
| WO2023077491A1 (en) | Mnp marker combination, primer pair combination and kit of respiratory syncytial virus and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171208 |