CN107412739B

CN107412739B - New use of IFN-lambda in Zika virus infection

Info

Publication number: CN107412739B
Application number: CN201710675824.2A
Authority: CN
Inventors: 陈金铃; 季然; 段义农; 朱丹丹
Original assignee: Nantong University
Current assignee: Yiwu Guoxin termite control Co.,Ltd.
Priority date: 2017-08-09
Filing date: 2017-08-09
Publication date: 2020-02-07
Anticipated expiration: 2037-08-09
Also published as: CN107412739A

Abstract

The invention relates to a new application of IFN-lambda in Zika virus infection, and particularly provides an application of IFN-lambda 2 in preparing a medicine for preventing or treating Zika virus infection. Experiments prove that IFN-lambda 2 can reduce slow development of a fetal mouse caused by Zika virus and placenta damage caused by Zika virus, and IFN-lambda 2 can further verify that the Zika virus can be inhibited from replicating in the female mouse and the fetal mouse by detecting relative Zika virus loads in various organs of the female mouse and the fetal mouse through q-PCR. In addition, the invention also illustrates the mechanism of inhibiting Zika virus replication by IFN-lambda 2 through a means of cell biology. The invention provides a new way and a method for preventing or treating microcephaly caused by Zika virus infection.

Description

New use of IFN-lambda in Zika virus infection

Technical Field

The invention belongs to the technical field of biology, relates to a new application of IFN-lambda in Zika virus infection, and particularly relates to an application of IFN-lambda 2 in preparation of a medicine for preventing or treating Zika virus infection.

Background

The Zika virus, also called Zika virus, belongs to Flaviviridae, is a single-stranded positive-strand RNA virus with a diameter of 20nm, and is an insect-borne virus which is transmitted by mosquitoes. However, unlike most arboviruses, Zika virus can directly infect and/or cross the placental barrier, resulting in tissue-specific damage. This virus was first discovered in 1947 by chance through the yellow fever monitoring network in rhesus monkeys of the bush-kanka forest of lindera indica, and subsequently in 1952 in the population of lindera and tanzania. The earliest outbreak of the virus occurred in the Yabunkania island of the Micronia Islands in the Western Pacific ocean in 2007, and the larger outbreak occurred in the Fa Boriniensis Asia in the Atlantic winter in 2013-2014, which infected about 32000 people. Of the Zika virus infected individuals, about 20% exhibit mild symptoms, typical symptoms including low fever with acute onset, maculopapules, joint pain (mainly involving the small joints of the hands and feet), conjunctivitis, and other symptoms including myalgia, headache, orbital pain and weakness; symptoms sometimes occur, including abdominal pain, nausea, vomiting, ulceration of the mucous membranes and itching of the skin. Zika virus disease has been reported to cause complications of the nervous and autoimmune systems.

Infection of gestational women with Zika virus can lead to fetal dysplasia, including spontaneous abortion, intrauterine fetal development retardation, and microcephaly. Many young newborns were found in the 2015 brazil outbreak of Zika virus, born with a head circumference that was more than two standard deviations below the mean compared to matched children of the same gender and gestational age. In 2015, between 5 months and 2016 and 1 month, 4000 pregnant women infected with Zika virus were reported to have delivered microcephaly, which increased by 20 times compared with the previous microcephaly. Cranial CT and cranial ultrasound in 35 cases of microcephaly neonates suggest the presence of diffuse brain tissue calcification, mainly in the lateral ventricles, the parenchyma, and the thalamic and basilar regions. Ventricular atrophy caused by cortical and subcortical atrophy is also seen. Articular contractures appear in a small portion of infants, suggesting involvement of the peripheral and central nervous systems. The Zika virus epidemic situation is investigated and found, and more evidence indicates that the Zika virus is related to the microcephaly. Currently there is no specific treatment for Zika virus infection.

The Interferon (IFN) signaling pathway plays an important role in combating arbovirus infection. After the arbovirus invades an organism, an in vivo pattern recognition receptor recognizes the virus, downstream signal molecule signal transmission is triggered through a linker molecule VISA (also called MAVS, IPS-1 or Cardif), and the expression of various interferon activated genes (ISGs) of a related signal path is induced. ISGs interact with each other to inhibit virus replication, promote specific immune response and finally eliminate virus infection. The myxovirus resistance protein (MX 1) is considered to be the most important antiviral protein in many ISGs and can act on multiple links of virus invasion. When MX1 is mutated, MX1 loses the capacity of self-oligomerization reaction, and the capacity of inhibiting influenza virus A is lost.

IFN- λ s bind to their specific receptor complex (IL-28R α/IL-10R β), activate the Jak-Stat signaling pathway, induce expression of various ISGs, and ultimately inhibit viral replication and transmission, unlike IFN- α/β receptor and IL-10R β, which are widely expressed in many cells and tissues, IFN- λ s receptor IL-28R α is mainly expressed on the surface of epithelial cells, thus IFN- λ s plays a relatively independent and specific antiviral role in certain tissues (including respiratory tract, intestinal tract, liver, and the like), IFN- λ s mainly includes IFN- λ 1(IL-29), IFN- λ 2(IL-28A) and IFN- λ 3(IL-28B), and liver, and IFN-2 (IFN-52A) are found to be regulated by IFN- λ 1 (IFN-2), IFN- λ 2(IL-28A), IFN- λ 2 (IL-28B), IFN- λ 2-IFN- λ 2 (IFN-2) is expressed in mouse cells expressing IFN-2, IFN- α -IFN-2, IFN- α -IFN-2, IFN- α -IFN-2, IFN- α -IFN- α -2, IFN- α - β -2, which is found to inhibit the replication, and a similar to a major inhibitory effect of a murine Interferon in a murine Interferon-expressing a murine Interferon in a murine Interferon-expressing human.

The prior art has not been effectively exploited for the use of IFN-. lambda.2 in Zika virus infection, and has been the subject of long-term research in this field.

Disclosure of Invention

The invention aims to provide an application of IFN-lambda in preparing a medicament for preventing or treating Zika virus infection. Further, the IFN-lambda is IFN-lambda 2.

Another object of the present invention is to provide a composition for the prevention or treatment of Zika virus infection, the active ingredient of said composition being IFN- λ, preferably said IFN- λ has a purity of more than 95%.

Further, the composition further comprises one or more pharmaceutically acceptable carriers. Preferably, the carrier comprises pharmaceutically acceptable diluents, excipients, fillers, binders, absorption promoting agents, surfactants and synergists. Preferably, the IFN- λ is IFN- λ 2.

The invention also aims to provide the application of the composition in preparing a medicament for preventing or treating Zika virus infection.

In the specific embodiment of the invention, experiments prove that IFN-lambda 2 can reduce the retarded development of fetal mice caused by Zika virus and can reduce the damage of mouse placentas caused by Zika virus, and a q-PCR method proves that IFN-lambda 2 can obviously reduce the virus load in mother mice and fetal mice, and simultaneously IFN-lambda 2 can also effectively inhibit the replication of Zika virus in human JEG-3 cells and inhibit the proliferation of Zika virus in the supernatant of human JEG-3 cells. In a specific embodiment, Zika virus is infected into human primary amniotic cells, and the Zika virus expression is detected by an immunofluorescence technique, so that the inhibition of the Zika virus replication by promoting the expression of MX1 by IFN-lambda 2 is further explained.

The invention can provide a medicine for efficiently preventing or treating Zika virus infection, and provides a new way and a new method for treating Zika virus infection.

Drawings

FIG. 1 shows that Zika virus infected pregnant mice were treated with PBS and IFN-. lambda.2, respectively, and the size of fetal mice was measured.

FIG. 2 shows the structure of mouse placenta detected by HE staining of Zika virus infected pregnant mice treated with PBS and IFN-. lambda.2, respectively.

FIG. 3 shows Zika virus infected pregnant mice treated with PBS and IFN-. lambda.2, respectively, and the Zika viral load in each organ of the mother mice was examined using q-PCR.

FIG. 4 shows Zika virus infected pregnant mice treated with PBS and IFN-. lambda.2, respectively, and the Zika viral load in various organs of fetal mice was examined using q-PCR.

FIG. 5 shows that 6 assay fractions were treated for Zika virus infected human JEG-3 cells and Zika viral load was detected using q-PCR.

FIG. 6 shows that 6 test fractions were treated for Zika virus infected human JEG-3 cells and the Zika virus viral load in the cell culture supernatant was examined using the viral plaque assay.

FIG. 7 shows that 4 assay fractions were treated with Zika virus infected human primary amniotic cells and the expression of Zika virus and MX1 was detected by immunofluorescence.

Detailed Description

In order that the invention may be more clearly understood, it will now be further described with reference to the following examples and the accompanying drawings. The examples are for illustration only and do not limit the invention in any way. The experimental procedures for specific conditions not specified in the examples are conventional procedures and conventional conditions well known in the art, or conditions as recommended by the manufacturers of the kits and instruments.

Test materials Vero and human JEG-3 Cell lines were obtained from Thermo Fisher Scientific, mouse IFN-. lamda.2, human IFN-. lamda.2 and IFN- α 2 were obtained from Biolegend, Trizol reagent was obtained from Invitrogen, reverse transcription reagent was obtained from Bio-Rad, TaqMan Universal Master Mix and Zika Virus probes were obtained from Thermo Fisher Scientific, anti-human primers were synthesized by Sigma, rabbit MX1 antibody and fluorescent secondary antibody were obtained from Cell Signaling Technology (CST), bovine serum from Hyclone and MEM from Thermo Fisher Scientific.

Example 1 IFN-. lambda.2 was able to alleviate retardation in fetal development in mice caused by Zika Virus

IFN-lambda 2 treatment of Zika virus infected pregnant mice: pregnant mouse (IFNAR)^-/-) On day 9.5 of pregnancy (E9.5), 2. mu.g of IFN-. lambda.2 was injected, and on day 10.5 of pregnancy (E10.5), pregnant mice were infected with Zika virus. Subsequent pregnancyMice were injected daily with the same dose of IFN-. lambda.2 until day 18.5 of gestation (E18.5). Fetal mouse size was measured by hip length x occipital frontal diameter at E18.5. Samples of each organ in the mother and fetal mice were collected for subsequent experiments.

Test results: pregnant mouse (IFNAR)^-/-) Day 10.5 of pregnancy (E10.5) infection with Zika virus resulted in retarded intrauterine development in the fetal mouse. IFN-. lamda.2 (2. mu.g) was injected before Zika virus infection in pregnant mice (E9.5), and the same dose of IFN-. lamda.2 was injected daily after Zika virus infection until the end of pregnancy (E18.5). At E18.5, the length (mm) of the hip vertex and the occipital frontal diameter of the fetal rat are measured respectively as the length of the hip vertex x the occipital frontal diameter (mm)²) The size of the fetal rat is indicated. Pregnant mice were infected with Zika virus (PBS group) at E10.5 and mice were approximately 135mm in size at E18.5 foetus²When IFN-lambda 2 treatment is performed, the fetal mouse size is increased to 196mm²Left and right. As can be seen from the drawings attached to the specification in FIG. 1: compared with the PBS group, IFN-lambda 2 can obviously increase the size of the fetal mouse, and the IFN-lambda 2 can relieve the growth retardation of the fetal mouse caused by Zika virus.

Example 2 IFN-. lambda.2 was able to reduce placental damage caused by Zika Virus

HE staining: the slides were rinsed with tap water for 3 min. Washing with distilled water for 1 min. The slide was placed in a 3% TritonX-100 solution pre-cooled at 4 ℃ for 5 min. Staining with hematoxylin for 10 min. The water was rinsed for 30 s. Differentiation medium (2% ethanol hydrochloride) was treated for 20 s. Bluing with tap water for 5-10 min. Eosin staining is carried out for 30 s-2 min. 50%, 70%, 80%, 95% and absolute ethyl alcohol are subjected to gradient dehydration for 1-3 min. And carrying out transparent treatment on the xylene I, II for 1-3 min. The neutral resin was mounted and the image was taken under a microscope.

Test results: the placenta of normal mice is roughly divided into three layers: periostracum layer (De), Junction Zone (JZ), and Labyrinthic Zone (LZ). As can be seen from the drawings attached to the specification in FIG. 2: zika virus infection can damage the normal structure of the placenta, with extensive bleeding (black arrows in FIG. 2) and vacuoles (white arrows in FIG. 2) in the junction area of the placenta; IFN- λ 2 treatment significantly reduced the area of placental bleeding and the area of vacuoles compared to the PBS group. The results of HE staining indicate that IFN-. lambda.2 was able to reduce placental damage caused by Zika virus.

Example 3 inhibition of Zika Virus replication in mother and fetal mice by IFN-. lambda.2

Collection of respective organ tissues of the mother mouse described in example 1: muscle (MCS), Spleen (SPL), Brain (BRN), Heart (HRT), Kidney (KDY), Lung (LNG), lymph node (LYN), Placenta (PLA) and Liver (LIV), the relative Zika viral load in the various organs of the mother rat was determined by q-PCR.Collection of organs and tissues of fetal rat described in example 1: muscle (MCS), Brain (BRN), Heart (HRT), Kidney (KDY) and Liver (LIV), the relative Zika viral loads in the individual organs of the fetal mouse were measured by q-PCR.

Detection of Zika Virus amount: an appropriate weight of tissue was added to Trizol for lysis, RNA was extracted, and reverse transcription was performed using oligo (dT)18 to cDNA using a reverse transcription kit. Freezing and storing at-80 deg.C.

Primer sequences for amplification of Zika virus:

Forward：5’-CCGCTGCCCAACACAAG-3’；

Reverse：5’-CCACTAACGTTCTTTTGCAGACAT-3’；

the probe sequence is as follows:

5’-/56-FAM/AGCCTACCT/ZEN/TGACAAGCAATCAGACACTCAA/3I

ABkFQ/-3’。

after the 10-fold diluted Zika virus infects Vero cells, the extracted RNA is reversely transcribed into cDNA, and the cDNA is used as a template to be amplified on a fluorescence quantitative PCR instrument to establish a standard curve. Reaction conditions are as follows: pre-denaturation at 95 ℃ for 3 min; 40 cycles: 95 ℃ for 15 s; 60 ℃ for 1 min. The relative amount of Zika virus was calculated against the standard curve.

Test results: as can be seen from FIG. 3 in the drawings attached to the specification, IFN-. lambda.2-treated group was able to decrease about 10 to 100 times (Log) in each organ in the mother mouse compared to PBS group₁₀The viral load multiple is 1-2). The Zika virus load was generally reduced by more than 50-fold in the maternal muscles, spleen, brain and placenta, suggesting that IFN- λ 2 has the ability to inhibit Zika virus proliferation in the maternal host. As can be seen from the figure 4 of the drawings attached to the description, the IFN-. lambda.2-treated group exhibited a viral load on various organs of fetal mice as compared to the PBS groupAdjustment of 100-10000 times (Log)₁₀The viral load factor is 2-4). In organs such as muscles, brain, heart and the like of a fetal mouse, the Zika virus amount is reduced by more than 1000 times. These results show that: IFN-lambda 2 inhibits Zika virus replication in fetal mice, in addition to inhibiting Zika virus proliferation in mother mice.

Example 4 IFN-. lambda.2 for use in inhibiting Zika Virus replication in human JEG-3 cells and for use in inhibiting Zika Virus propagation in human JEG-3 cell culture supernatant in vitro

Zika virus infected human JEG-3 cell strain: human JEG-3 cell line was cultured in a cell culture flask, and the flask was incubated with a MEM complete medium containing 10% fetal bovine serum (containing 100. mu.g/mL of streptomycin and 100U/mL of penicillin) at 37 ℃ with 5% CO₂Cultured in a cell culture box. The culture solution is changed every other day, and when the cells reach about 80% of fusion degree, the cells are subjected to cell passage or subsequent experiments are carried out. At 2X 10⁵The test was divided into 6 groups, (1) non-Zika virus group (Media), (2) Zika virus group (Media + ZIKV) infection, (3) Zika virus and IFN-. lamda 2 co-stimulation group (IFN-. lamda.2 + ZIKV), and (4) Zika virus group (p-IFN-. lamda.2 + KV) infection after 24h pretreatment of the cells with IFN-. lamda.2, (5) Zika virus and IFN-. α 2 co-stimulation group (IFN-. α + ZIKV), and (6) Zika virus group (p-IFN-. lamda.35 + ZIKV) infection after 24h pretreatment of the cells with IFN-. α 2.

Viral plaque assay: each hole is 1 multiplied by 10⁵Inoculating Vero cells into a 6-hole plate, after the cells are fused to 90%, discarding supernatant, adding 10-fold gradient continuously diluted cell culture supernatant into a Vero cell culture system, placing the Vero cell culture system in an incubator for culturing for 1 hour, and shaking the 6-hole plate once every 15 min. After 1h, semi-solid medium was added and cultured for 72 hours. The medium was discarded, methanol and acetone were mixed at a ratio of 1:1 and fixed at-20 ℃ for 1 h. After washing the plate 3 times with PBS, Zika virus monoclonal antibody was added and incubated overnight at 4 ℃. PBS plates were washed 3 times, and 1: HRP-labeled goat anti-mouse secondary antibody at 2000 dilution, room temperatureAnd (3) incubating for 60min, washing the plate with PBS for 3 times, adding an AEC peroxidase substrate, reacting for 10min in a dark place, adding deionized water to terminate the reaction, and observing and calculating under a microscope.

Test resultsIt can be seen from the figure 5 of the attached drawings in the specification that IFN- α 2 stimulates human JEG-3 cells in vitro and can remarkably inhibit the proliferation of Zika virus in human JEG-3 cells, the Zika virus load is further reduced after the JEG-3 cells are pretreated by IFN- α 2 for 24h compared with the IFN- α 2 stimulation group, and similarly, the IFN-lambda 2 can remarkably inhibit the proliferation of Zika virus in human JEG-3 cells in vitro and the IFN-lambda 2 pretreatment can reduce the Zika virus load by about 10 times compared with the IFN-lambda 2 stimulation group, and the results show that the human JEG-3 cells pretreated by IFN-lambda 2 have stronger capacity for resisting the replication of Zika virus.

IFN- α 2 in vitro and Zika virus act on human JEG-3 cells together, after the cells are co-cultured for 48h, the cell culture supernatant is collected, and Zika virus load in the supernatant is detected by using a virus plaque test, as can be seen from figure 6 in the attached figure of the specification, IFN- α 2 has the capacity of inhibiting Zika virus proliferation in the cell culture supernatant, and after IFN- α 2 pretreatment for 24h and Zika virus infection for 48h, the Zika virus cannot be detected in the human JEG-3 cell culture supernatant by using the virus plaque test, and similarly, IFN-lambda 2 can reduce the virus amount in the cell culture supernatant by more than 10 times, and after IFN-lambda 2 pretreatment, the Zika virus cannot be detected in the human JEG-3 cell culture supernatant, the results show that IFN-lambda 2 can inhibit Zika virus replication in vitro.

Example 5 IFN-. lambda.2 inhibition of Zika Virus replication by promoting expression of MX1

Cellular immunofluorescence assay: adjusting the density of human primary amniotic cells to 2 × 10⁴And (4) inoculating the seeds into chamber, and culturing in an incubator for 24 h. Zika virus has an MOI of 2: 1 to infect human primary amniotic cells. 48h after infection, 0.5% Triton X-100 (in PBS) was used for 20min at room temperature. 5% BSA (in PBS) was blocked for 2h at room temperature. The diluted primary antibody was dropped onto a glass slide and incubated overnight in a refrigerator at 4 ℃. After 3 PBS washes, diluted fluorescent diabolo was dropped onto the slide and incubated at room temperature in the dark for 90 min. After 3 PBS washesThe test was divided into 4 groups (1) blank control group (Media), (2) negative control group (ZIKV), (3) IFN-. lambda.2 treatment group (IFN-. lambda.2 + ZIKV), and (4) IFN- α 2 treatment group (IFN-. α 2+ ZIKV).

Test results: zika virus is detected by immunofluorescence after infecting human primary amniotic cells. As can be seen from the attached figure 7 of the specification, the antigen of the Zika virus can be detected in the cytoplasm of the human primary amniotic cell (fluorescence is shown as green), meanwhile, a large amount of MX1 protein (fluorescence is shown as red) is expressed on the human primary amniotic cell, and the antigen of the Zika virus cannot coincide with MX1 protein, which indicates that the Zika virus can infect the human primary amniotic cell, but can resist the infection of the Zika virus if the cell highly expresses MX 1. The results above, in which the antigen of Zika virus was undetectable by 48h stimulation with IFN- λ 2 and MX1 was expressed by all cells, further suggested that IFN- λ 2 inhibited Zika virus replication by promoting expression of MX 1.

Claims

Use of IFN- λ 2 for the preparation of a medicament for the prevention or treatment of Zika virus infection.
2. The use according to claim 1, wherein IFN- λ 2 inhibits Zika virus replication by promoting expression of MX 1.
3. Use of a composition comprising IFN- λ 2 and one or more pharmaceutically acceptable carriers for the manufacture of a medicament for the prevention or treatment of Zika virus infection.
4. The use of claim 3, the carrier comprising a pharmaceutically acceptable diluent, excipient, filler, binder, absorption enhancer, surfactant and synergist.