A kind of kit for detecting lung cancer
Technical field
The present invention relates to medical sciences, more particularly relate to a kind of kit for detecting lung cancer.
Background technology
Lung cancer is that morbidity and mortality growth is most fast, to one of population health and the maximum malignant tumour of life threat.
The morbidity and mortality of many countries all report lung cancer obviously increase in the past 50 years, and male lung cancer morbidity and mortality are equal
First of all malignant tumours is accounted for, women incidence accounts for second, and the death rate accounts for second.The cause of disease of lung cancer is still endless so far
It is complete clear.According to the pathological analysis of the World Health Organization (WHO), lung cancer is divided into four kinds of major tissue types:Small Cell Lung Cancer
And non-small cell lung cancer, the latter can also further be divided into adenocarcinoma of lung, dermoid cancer and large cell carcinoma.Maxicell lung cancer
A kind of actually variation of adenocarcinoma of lung, histologically its both not no feature of squamous carcinoma, also without gland cancer or Small Cell Lung Cancer
Feature, belong to a kind of undifferentiated type lung cancer.Maxicell lung cancer morbidity rate is not high, accounts for the 2%~8% of whole lung cancer.Maxicell
Lung cancer often betides leaf on lung, mostly peripheral, and volume is larger, clear border, leaflet, rare cavity.Its grade malignancy is high, controls
Therapeutic effect is poor, prognosis mala.So if can timely be diagnosed to be maxicell lung cancer in morbidity early stage will greatly improve patient
Therapeutic effect, and existing common detection methods effectively can not go out maxicell lung cancer in early detection, therefore urgent
It needs to provide a kind of method of early diagnosis maxicell lung cancer.
Invention content
The object of the present invention is to provide a kind of for detecting the kit of lung cancer, specifically a kind of detection maxicell lung
The kit of cancer.
The technical solution of the present invention is to provide a kind of kit for detecting lung cancer, and it includes specific detections
The reagent of miRNA-6070.
Preferably, the reagent includes reverse transcription primer, forward primer, reverse primer, and the reverse transcription primer sequence is such as
SEQ ID NO:Shown in 1, the sequence such as SEQ ID NO of the forward primer:Shown in 2, the sequence such as SEQ of the reverse primer
ID NO:Shown in 3.
Another technical solution of the present invention is to provide SEQ ID NO:1-3 is in the kit for being used to prepare detection lung cancer
Purposes.
Inventor in the cytologic experiments of early period, by the method for the aobvious expression of difference find the expression quantity of miRNA-6070 with
Maxicell lung cancer is closely related, and the high expression of miRNA-6070 implies the generation of maxicell lung cancer, in order to further confirm this
Conclusion, inventor further demonstrate the correlation further through the experiment of clinical sample statistics.
The kit of the present invention can effectively detect maxicell lung cancer, and the kit can fast implement determining for miRNA
Amount detection, to achieve the purpose that quickly and effectively to detect maxicell lung cancer.
Description of the drawings
The amplification curve of Fig. 1 primers
Maxicell lung cancer is compared with the expression of peripheral blood miRNA-6070 between Normal group in Fig. 2 clinical samples
Figure
Specific implementation mode
Embodiment below facilitates a better understanding of the present invention, but does not limit the present invention.Experiment in following embodiments
Method is unless otherwise specified conventional method.
Embodiment 1
Sample collection and ethics statement
It collects 60 maxicell lung cancer and 30 normal population blood, all samples is all from the first attached doctor of University Of Suzhou
The second affiliated hospital of institute and University Of Suzhou, sample acquisition time are in September, 2015 in June, 2017.The collection of above-mentioned sample is equal
Pass through University Of Suzhou's the first affiliated hospital Institutional Review Board and the second affiliated hospital of University Of Suzhou Institutional Review Board
Approval, all subjects endorsed informed consent form.
The patient in above large cell lung cancer serum specimen source by aspiration biopsy or operation obtained cytology or
The pathological pathological diagnosis of person, patient is before blood sampling without any radiotherapy or the treatment of chemotherapy.
1. the extraction of serum miRNA
1) 500 μ l TRIzol, vortex oscillation 30s are added in 200 μ l serum and are stored at room temperature 5min.
2) plus 200 μ l chloroforms, violent reverse mixing 45s are stored at room temperature 5min.
3) supernatant, is carefully moved to new 1.5ml centrifuge tubes by centrifugation 30min (13000rpm, 4 DEG C).
4) plus in isometric isopropanol to supernatant, mixing is overturned, sets -20 DEG C of standing 30min.
5) centrifugation 30min (13000rpm, 4 DEG C) precipitates total serum IgE.
6) it inhales and abandons supernatant, precipitation is washed 1 time with 75% ethyl alcohol of volume fraction 1ml.
7) centrifugation 5min (7500rpm, 4 DEG C) precipitates RNA.
8) exhaust ethyl alcohol, is placed at room temperature for and dries, and 50 μ l DEPC water are added, fully dissolve.
9) agarose gel electrophoresis detects RNA, the intact no degradations of RNA.
2.miRNA reverse transcriptions
The first chain cDNA is synthesized using the quick reverse transcription reagent box of Tiangeng company FastQuant RT Kit
1) template ribonucleic acid is thawed on ice;5×gDNA Buffer、FQ-RT Primer Mix、10×Fast RT
Buffer, it is immediately placed on ice after thaw at RT, defrosting without RNA water.
2) the removal system of according to the form below genomic DNA prepares mixed liquor, thorough mixing.Brief centrifugation is placed in 42 DEG C, incubates
Educate 3min.It is subsequently placed in and places on ice.
The removal system of genomic DNA
Constituent |
Usage amount |
5×gDNA Buffer |
2μl |
Total RNA |
1μl |
Without RNA enzyme water |
7μl |
3) according to the form below reverse transcription reaction system prepares mixed liquor.
Reverse transcription reaction system:
Reverse transcription primer sequence is in upper table:CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTCCAGGG
(SEQ ID NO:1)。
Reverse transcription U6, reverse transcription primer RT-U6 are simultaneously:CGCTTCACGAATTTGCGTGTCAT(SEQ ID NO:
4)。
4) it by the mixed liquor in reverse transcription reaction, is added in the reaction solution of genome removal step, mixes well.
5) 42 DEG C, it is incubated 15min.
6) it 95 DEG C, is incubated 3min and is put on ice later, obtain cDNA.
3 fluorescence quantitative PCR detection stomach of embodiment prints the expression of suede cell cancer group and control group miRNA
1) quantitative fluorescent PCR
Kit uses the FastFire qPCR PreMix (SYBR Green) of Tiangeng company.First, melt
FastFire qPCR PreMix, template, primer and without RNA enzyme water, and all reagents are dissolved at room temperature and thorough mixing.
Next configuration quantitative fluorescent PCR system.
Quantitative fluorescent PCR system
3 parallel reactions are arranged in each sample of miRNA detection of expression, using snRNA U6 as internal reference.
Forward primer sequence is in upper table:ACACTCCAGCTGGGCCGGTTCCAGTCC(SEQ ID NO:2).
Reverse primer sequences are in upper table:TGGTGTCGTGGAGTCG(SEQ ID NO:3).
Simultaneously using U6 as internal reference, forward primer:GCTTCGGCAGCACATATACTAAAAT(SEQ ID NO:5);
Reverse primer:CGCTTCACGAATTTGCGTGTCAT(SEQ ID NO:6).
Quantitative fluorescent PCR program:
The amplification curve of primer is shown in Fig. 1.
2) statistical analysis
It is analyzed using 22.0 softwares of SPSS.It is examined using t between statistical analysis method group, p<There is statistics when 0.05
Learn meaning.By analyzing the expression of peripheral blood miRNA-6070 between large cell lung cancer and Normal group, it is found that lung is big
The expression of miRNA-6070 is apparently higher than normal structure in cell cancer, is specifically shown in attached drawing 2.
Above-mentioned clinical trial shows effectively detect lung maxicell by detecting the expression of miRNA-6070
Cancer.
Sequence table
<110>The Suzhou bio tech ltd Li Hao
<120>A kind of kit for detecting lung cancer
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 44
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 1
ctcaactggt gtcgtggagt cggcaattca gttgagctcc aggg 44
<210> 2
<211> 27
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 2
acactccagc tgggccggtt ccagtcc 27
<210> 3
<211> 16
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 3
tggtgtcgtg gagtcg 16
<210> 4
<211> 23
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 4
cgcttcacga atttgcgtgt cat 23
<210> 5
<211> 25
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 5
gcttcggcag cacatatact aaaat 25
<210> 6
<211> 23
<212> DNA
<213>Artificial sequence (2 Ambystoma laterale x Ambystoma jeffersonianum)
<400> 6
cgcttcacga atttgcgtgt cat 23