CN107400168B

CN107400168B - Chimeric antigen receptor based on CD117 and application thereof

Info

Publication number: CN107400168B
Application number: CN201710587317.3A
Authority: CN
Inventors: 桂思倩; 刘昱辰
Original assignee: Shenzhen Institute Of Immune Gene Therapy
Current assignee: Shenzhen Institute Of Immune Gene Therapy
Priority date: 2017-07-18
Filing date: 2017-07-18
Publication date: 2020-02-07
Anticipated expiration: 2037-07-18
Also published as: CN107400168A

Abstract

The invention relates to a chimeric antigen receptor based on CD117 and application thereof, in particular to a construction method of a chimeric antigen receptor T (CAR-T) cell technology based on a tumor specific target CD117 and application thereof in anti-tumor treatment, wherein the chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain, a costimulatory signaling region and a CD3 zeta signaling domain which are connected in series; wherein the antigen binding domain binds to a tumor surface antigen that is CD 117. According to the chimeric antigen receptor disclosed by the invention, through specific genetic modification of CD117 tumor surface antigen, the modified antibody can enable the antigen-antibody binding force to be stronger, mutation is not easy to occur, and compared with other chimeric antigen receptors and other tumor antigens, the chimeric antigen receptor has a better effect, the expression amount of a target point is high, so that the immune effect of CAR-T cells is enhanced, and the treatment effect of the CAR-T cells is enhanced.

Description

Chimeric antigen receptor based on CD117 and application thereof

Technical Field

The invention relates to the field of tumor cell immunotherapy, in particular to a chimeric antigen receptor based on CD117 and application thereof, and specifically relates to a construction method of a chimeric antigen receptor T (CAR-T) cell technology based on a tumor specific target CD117 and application thereof in anti-tumor therapy.

Background

With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) is one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen binding region, an extracellular hinge region, a transmembrane region, and an intracellular signaling region. Typically, the CAR comprises a Single chain fragment variable (scFv) region of an antibody or a binding domain specific for a Tumor Associated Antigen (TAA), which is coupled to the cytoplasmic domain of a T cell signaling molecule by a hinge and a transmembrane region. The most common lymphocyte activation moiety comprises a T cell costimulatory domain in tandem with a T cell effector function triggering (e.g., CD3 ζ) moiety. CAR-mediated adoptive immunotherapy allows CAR-transplanted T cells to directly recognize TAAs on target tumor cells in a non-HLA-restricted manner.

Most patients with B-cell malignancies, including B-cell acute lymphocytic leukemia (leukamia, B-ALL) and Chronic Lymphocytic Leukemia (CLL), will die as a result of their disease. One approach to treating these patients is to genetically modify T cells to target antigens expressed on tumor cells through expression of a CAR. CARs are antigen receptors designed to recognize cell surface antigens in a Human Leukocyte Antigen (HLA) independent manner. Attempts to treat these types of patients using genetically modified cells expressing CARs have met with promising success.

The CD19 molecule is a potential target for treatment of B lymphocyte lineage tumors and is also a hotspot in CAR research, and expression of CD19 is restricted to normal and malignant B cells and is a widely accepted CAR target for safety testing. Chimeric antigen receptor gene-modified T cells targeting the CD19 molecule (CD19CAR-T) have had great success in treating multiple, refractory acute B-lymphocyte leukemia, while being significantly less effective in the treatment of refractory, relapsed chronic B-lymphocyte leukemia and B-lymphocyte lineage lymphoma.

CN 104788573A discloses a chimeric antigen receptor hCD19scFv-CD8 α -CD28-CD3 zeta and the application thereof, the chimeric antigen receptor is composed of anti-human CD19 monoclonal antibody HI19a light chain and heavy chain variable region (hCD19scFv), human CD8 α hinge region, human CD28 transmembrane region and intracellular region, and human CD3 zeta intracellular region structure in series, after the CD19 in the patent is subjected to CAR-T cell transfusion once, the expression level of CD19 is reduced, and immune mechanism is easy to escape.

Therefore, it is important to prepare a chimeric antigen receptor that can solve the problems of easy mutation and reduced expression of CD 19.

Disclosure of Invention

Aiming at the situations that the targeting in the current CAR-T technology for treating the tumor is not ideal and the tumor microenvironment influences the treatment effect of the CAR-T technology, the invention provides the CD 117-based chimeric antigen receptor and the application thereof.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the present invention provides a CD 117-based chimeric antigen receptor comprising an antigen binding domain, a transmembrane domain, a costimulatory signaling region, and a CD3 zeta signaling domain in tandem;

wherein the antigen binding domain binds to a tumor surface antigen that is CD 117.

According to the invention, the antigen binding domain is combined with the tumor surface antigen CD117, and then the CD117 chimeric antigen receptor is subjected to specific human genetic code optimization modification, so that the tumor surface antigen CD117 can be specifically combined with the chimeric antigen receptor of the application, and compared with other chimeric antigen receptors and other tumor antigens, the chimeric antigen receptor has a better effect, the expression level of a target is high, and the immune effect of CAR-T cells is enhanced.

According to the invention, the amino acid sequence of the single-chain antibody (ScFv) of the CD117 chimeric antigen receptor is shown as SEQ ID NO.1, and the amino acid sequence (SEQ ID NO.1) of the single-chain antibody (ScFv) of the CD117 chimeric antigen receptor is as follows:

QVQLVQSGAAVKKPGESLKISCKGSGYRFTSYWIGWVRQMPGKGLEWMGIIYPGDSDTRYSPSFQGQVTISAGKSISTAYLQWSSLKASDTAMYYCARHGRGYNGYEGAFDIWGQGTMVTVSSGSTSGSGKPGSSEGSTKGAIQLTQSPSSLSASVGDRVTITCRASQGISSALAWYQQKPGKAPKLLIYDASSLESGVPSRFSGSGSGTDFTLTISSLQPEDFATYYCQQFNSYPLTFGGGTKVEIK。

in the invention, the amino acid of the single-chain antibody (ScFv) of the CD117 chimeric antigen receptor is specifically modified, so that the antigen-antibody binding force of the antibody expressed by the modified sequence is stronger.

According to the invention, the tumor surface antigen CD117 also comprises a single-chain antibody of a mutant of the tumor surface antigen CD117, and the amino acid sequence of the single-chain antibody of the mutant of the tumor surface antigen CD117 has more than 90% of similarity with the amino acid sequence shown in SEQ ID NO. 1.

According to the present invention, the transmembrane domain is a CD28 transmembrane domain and/or a CD8 α transmembrane domain, which may be selected or modified by amino acid substitutions in some embodiments.

According to the present invention, the co-stimulatory signaling region is any one or a combination of at least two of CD28 signaling domain, CD27 signaling domain and CD137 signaling domain, preferably a combination of CD28 signaling domain, CD137 signaling domain and CD27 signaling domain, the arrangement of the CD28 signaling domain, CD137 signaling domain and/or CD27 signaling domain can be adjusted as required by those skilled in the art, the different arrangements of CD28 signaling domain, CD137 signaling domain and CD27 signaling domain do not affect the chimeric antigen receptor, and the sequential combination of CD28-CD137-CD27 is preferably used herein.

According to the invention, the chimeric antigen receptor further comprises an inducible suicide fusion domain, the inducible suicide fusion domain comprises a caspase 9 domain, the amino acid sequence of the caspase 9 domain is shown as SEQ ID NO.4, and the amino acid sequence of the caspase 9 domain (SEQ ID NO.4) is as follows:

GSGATNFSLLKQAGDVEENPGPMGVQVETISPGDGRTFPKRGQTCVVHYTGMLEDGKKVDSSRDRNKPFKFMLGKQEVIRGWEEGVAQMSVGQRAKLTISPDYAYGATGHPGIIPPHATLVFDVELLKLEGGGGSGGGGSGAMVGALESLRGNADLAYILSMEPCGHCLIINNVNFCRESGLRTRTGSNIDCEKLRRRFSSLHFMVEVKGDLTAKKMVLALLELARQDHGALDCCVVVILSHGCQASHLQFPGAVYGTDGCPVSVEKIVNIFNGTSCPSLGGKPKLFFIQACGGEQKDHGFEVASTSPEDESPGSNPEPDATPFQEGLRTFDQLDAISSLPTPSDIFVSYSTFPGFVSWRDPKSGSWYVETLDDIFEQWAHSEDLQSLLLRVANAVSVKGIYKQMPGCFNFLRKKLFFKTSAS.

according to the invention, the inducible suicide fusion domain is concatenated with the CD3 zeta signaling domain via a 2A sequence, the 2A sequence cleaving the protein expressed by the inducible suicide fusion domain from the chimeric antigen receptor protein, thereby enabling the chimeric antigen receptor to function, and by injecting an activator, thereby enabling activation of the inducible suicide fusion domain, thereby disabling the chimeric antigen receptor.

According to the present invention, the chimeric antigen receptor further comprises a signal peptide, wherein the signal peptide is a signal peptide capable of directing the transmembrane transfer of the chimeric antigen receptor, one skilled in the art can select a signal peptide which is conventional in the art according to needs, the signal peptide can be a signal peptide of any Secretory protein gene, the signal peptide of the present invention is a secretor signal peptide, and the amino acid sequence of the secretor signal peptide is shown in SEQ ID No. 5-6.

Preferably, the secretor signal peptide is a signal peptide of the CD8a gene, the amino acid sequence of the signal peptide is shown as SEQ ID No.5, and the amino acid sequence of SEQ ID No.5 is as follows: MALPVTALLLPLALLLHAARP are provided.

Preferably, the Secretory signal peptide is a signal peptide of the GMCSFR gene, the amino acid sequence of the signal peptide is shown as SEQ ID NO.6, and the amino acid sequence of the SEQ ID NO.6 is MLLLVTSLLLCELPHPAFLLIP.

The chimeric antigen receptor of the present invention may further include a hinge region, which may be selected by those skilled in the art according to practical circumstances, and is not particularly limited herein, and the presence of the hinge region does not affect the performance of the chimeric antigen receptor of the present invention.

According to the present invention, the chimeric antigen receptor comprises a signal peptide, an antigen binding domain, a transmembrane domain, a costimulatory signaling region, a CD3 zeta signaling domain, a 2A sequence, and an inducible suicide fusion domain in tandem.

Preferably, the chimeric antigen receptor is a secretor signal peptide, a CD117 antigen binding domain, a CD8 α and/or CD28 transmembrane domain, a CD28 signaling domain, a CD137 signaling domain and a CD27 signaling domain, and the CD3 zeta signaling domain, the 2A sequence and the caspase 9 domain are connected in series and arranged as follows:

Secretory-CD117-CD28-CD137-CD27-CD3ζ-2A-iCasp9。

according to the invention, the amino acid sequence of the chimeric antigen receptor Secretory-CD117-CD28-CD137-CD27-CD3 zeta-2A-iCasp 9 is shown as SEQ ID NO.2, and the amino acid sequence (SEQ ID NO.2) of the chimeric antigen receptor is as follows:

MLLLVTSLLLCELPHPAFLLIPQVQLVQSGAAVKKPGESLKISCKGSGYRFTSYWIGWVRQMPGKGLEWMGIIYPGDSDTRYSPSFQGQVTISAGKSISTAYLQWSSLKASDTAMYYCARHGRGYNGYEGAFDIWGQGTMVTVSSGSTSGSGKPGSSEGSTKGAIQLTQSPSSLSASVGDRVTITCRASQGISSALAWYQQKPGKAPKLLIYDASSLESGVPSRFSGSGSGTDFTLTISSLQPEDFATYYCQQFNSYPLTFGGGTKVEIKAAAIEVMYPPPYLDNEKSNGTIIHVKGKHLCPSPLFPGPSKPFWVLVVVGGVLACYSLLVTVAFIIFWVRSKRSRLLHSDYMNMTPRRPGPTRKHYQPYAPPRDFAAYRSASGGGGSGGGGSQRRKYRSNKGESPVEPAEPCHYSCPREEEGSTIPIQEDYRKPEPACSPGGGGSGGGGSTSGGGGSGGGGSVVKRGRKKLLYIFKQPFMRPVQTTQEEDGCSCRFPEEEEGGCELGGGGSGGGGSGGGGSRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRTSGSGATNFSLLKQAGDVEENPGPMGVQVETISPGDGRTFPKRGQTCVVHYTGMLEDGKKVDSSRDRNKPFKFMLGKQEVIRGWEEGVAQMSVGQRAKLTISPDYAYGATGHPGIIPPHATLVFDVELLKLEGGGGSGGGGSGAMVGALESLRGNADLAYILSMEPCGHCLIINNVNFCRESGLRTRTGSNIDCEKLRRRFSSLHFMVEVKGDLTAKKMVLALLELARQDHGALDCCVVVILSHGCQASHLQFPGAVYGTDGCPVSVEKIVNIFNGTSCPSLGGKPKLFFIQACGGEQKDHGFEVASTSPEDESPGSNPEPDATPFQEGLRTFDQLDAISSLPTPSDIFVSYSTFPGFVSWRDPKSGSWYVETLDDIFEQWAHSEDLQSLLLRVANAVSVKGIYKQMPGCFNFLRKKLFFKTSAS.

according to the invention, the nucleotide sequence of the chimeric antigen receptor Secretory-CD117-CD28-CD137-CD27-CD3 zeta-2A-iCasp 9 is shown as SEQ ID NO.3, and the nucleotide sequence (SEQ ID NO.3) of the chimeric antigen receptor is as follows:

ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCCAGGTGCAGCTGGTGCAGAGCGGCGCCGCCGTGAAGAAGCCCGGCGAGAGCCTGAAGATCAGCTGCAAGGGCAGCGGCTACAGATTCACCAGCTACTGGATCGGCTGGGTGAGACAGATGCCCGGCAAGGGCCTGGAGTGGATGGGCATCATCTACCCCGGCGACAGCGACACCAGATACAGCCCCAGCTTCCAGGGCCAGGTGACCATCAGCGCCGGCAAGAGCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCAGCGACACCGCCATGTACTACTGCGCCAGACACGGCAGAGGCTACAACGGCTACGAGGGCGCCTTCGACATCTGGGGCCAGGGCACCATGGTGACCGTGAGCAGCGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAGGGCGCCATCCAGCTGACCCAGAGCCCCAGCAGCCTGAGCGCCAGCGTGGGCGACAGAGTGACCATCACCTGCAGAGCCAGCCAGGGCATCAGCAGCGCCCTGGCCTGGTACCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACGACGCCAGCAGCCTGGAGAGCGGCGTGCCCAGCAGATTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCAGCAGTTCAACAGCTACCCCCTGACCTTCGGCGGCGGCACCAAGGTGGAGATCAAGGCCGCCGCCATCGAGGTGATGTACCCCCCCCCCTACCTGGACAACGAGAAGAGCAACGGCACCATCATCCACGTGAAGGGCAAGCACCTGTGCCCCAGCCCCCTGTTCCCCGGCCCCAGCAAGCCCTTCTGGGTGCTGGTGGTGGTGGGCGGCGTGCTGGCCTGCTACAGCCTGCTGGTGACCGTGGCCTTCATCATCTTCTGGGTGAGAAGCAAGAGAAGCAGACTGCTGCACAGCGACTACATGAACATGACCCCCAGAAGACCCGGCCCCACCAGAAAGCACTACCAGCCCTACGCCCCCCCCAGAGACTTCGCCGCCTACAGAAGCGCCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCCAGAGAAGAAAGTACAGAAGCAACAAGGGCGAGAGCCCCGTGGAGCCCGCCGAGCCCTGCCACTACAGCTGCCCCAGAGAGGAGGAGGGCAGCACCATCCCCATCCAGGAGGACTACAGAAAGCCCGAGCCCGCCTGCAGCCCCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCACCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGTGGTGAAGAGAGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCCTTCATGAGACCCGTGCAGACCACCCAGGAGGAGGACGGCTGCAGCTGCAGATTCCCCGAGGAGGAGGAGGGCGGCTGCGAGCTGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCAGAGTGAAGTTCAGCAGAAGCGCCGACGCCCCCGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCAGAAGAGAGGAGTACGACGTGCTGGACAAGAGAAGAGGCAGAGACCCCGAGATGGGCGGCAAGCCCAGAAGAAAGAACCCCCAGGAGGGCCTGTACAACGAGCTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGAGAAGAAGAGGCAAGGGCCACGACGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCCAGAACCAGCGGCAGCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCCATGGGCGTGCAGGTGGAGACCATCAGCCCCGGCGACGGCAGAACCTTCCCCAAGAGAGGCCAGACCTGCGTGGTGCACTACACCGGCATGCTGGAGGACGGCAAGAAGGTGGACAGCAGCAGAGACAGAAACAAGCCCTTCAAGTTCATGCTGGGCAAGCAGGAGGTGATCAGAGGCTGGGAGGAGGGCGTGGCCCAGATGAGCGTGGGCCAGAGAGCCAAGCTGACCATCAGCCCCGACTACGCCTACGGCGCCACCGGCCACCCCGGCATCATCCCCCCCCACGCCACCCTGGTGTTCGACGTGGAGCTGCTGAAGCTGGAGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGCCATGGTGGGCGCCCTGGAGAGCCTGAGAGGCAACGCCGACCTGGCCTACATCCTGAGCATGGAGCCCTGCGGCCACTGCCTGATCATCAACAACGTGAACTTCTGCAGAGAGAGCGGCCTGAGAACCAGAACCGGCAGCAACATCGACTGCGAGAAGCTGAGAAGAAGATTCAGCAGCCTGCACTTCATGGTGGAGGTGAAGGGCGACCTGACCGCCAAGAAGATGGTGCTGGCCCTGCTGGAGCTGGCCAGACAGGACCACGGCGCCCTGGACTGCTGCGTGGTGGTGATCCTGAGCCACGGCTGCCAGGCCAGCCACCTGCAGTTCCCCGGCGCCGTGTACGGCACCGACGGCTGCCCCGTGAGCGTGGAGAAGATCGTGAACATCTTCAACGGCACCAGCTGCCCCAGCCTGGGCGGCAAGCCCAAGCTGTTCTTCATCCAGGCCTGCGGCGGCGAGCAGAAGGACCACGGCTTCGAGGTGGCCAGCACCAGCCCCGAGGACGAGAGCCCCGGCAGCAACCCCGAGCCCGACGCCACCCCCTTCCAGGAGGGCCTGAGAACCTTCGACCAGCTGGACGCCATCAGCAGCCTGCCCACCCCCAGCGACATCTTCGTGAGCTACAGCACCTTCCCCGGCTTCGTGAGCTGGAGAGACCCCAAGAGCGGCAGCTGGTACGTGGAGACCCTGGACGACATCTTCGAGCAGTGGGCCCACAGCGAGGACCTGCAGAGCCTGCTGCTGAGAGTGGCCAACGCCGTGAGCGTGAAGGGCATCTACAAGCAGATGCCCGGCTGCTTCAACTTCCTGAGAAAGAAGCTGTTCTTCAAGACCAGCGCCAGCTGA.

in the invention, the chimeric antigen receptor also comprises a promoter, wherein the promoter is any one or the combination of at least two of EF1a, CMV-TAR or CMV.

According to the invention, the chimeric antigen receptor is expressed by transfection of its encoded nucleic acid sequence into a T cell.

According to the invention, the transfection is by transfection into T cells by any one of or a combination of at least two of viral vectors, eukaryotic expression plasmids or mRNA sequences, preferably by viral vectors.

Preferably, the viral vector is a lentiviral vector and/or a retroviral vector, preferably a lentiviral vector.

In a second aspect, the present invention provides a recombinant lentivirus obtained by co-transfecting a mammalian cell with a viral vector comprising the chimeric antigen receptor of the first aspect and the packaging helper plasmids pNHP and pHEF-VSVG.

According to the present invention, the mammalian cell is any one of 293 cell, 293T cell or TE671 cell or a combination of at least two thereof.

In a third aspect, the present invention provides a composition comprising a chimeric antigen receptor according to the first aspect and/or a recombinant lentivirus according to the second aspect.

In a fourth aspect, the present invention provides a chimeric antigen receptor according to the first aspect, a recombinant lentivirus according to the second aspect or a composition according to the third aspect, for preparing chimeric antigen receptor T cells and the use thereof in drugs for treating tumors;

preferably, the tumor is a blood-related tumor disease, which is a leukemia or lymphoma.

Compared with the prior art, the invention has the following beneficial effects:

(1) the chimeric antigen receptor of the invention carries out specific gene modification on CD117 tumor surface antigen, and the modified antibody can make the antigen-antibody binding force stronger;

(2) the CD117 chimeric antigen receptor can specifically recognize the tumor surface antigen CD117, has high expression of CD117 in leukemia and lymphoma, and has better effect compared with other chimeric antigen receptors and other tumor antigens, so that the immune effect of CAR-T cells is enhanced, and the treatment effect of the CAR-T cells is enhanced;

(3) after CAR-T cell reinfusion is carried out on the chimeric antigen receptor, the expression quantity of CD117 on the surface of a tumor cannot be reduced, an immune mechanism cannot easily escape, and better treatment can be carried out.

Drawings

FIG. 1 is a graph showing the results of flow cytometry analysis of the expression level of CD117 in a sample of an acute T-cell leukemia patient, wherein FIG. 1(a) is a graph showing the results of flow cytometry analysis of a sample of an acute T-cell leukemia patient, and FIG. 1(b) is a graph showing the expression level of CD117 in an acute T-cell leukemia cell;

FIG. 2 is a graph showing the results of flow cytometry analysis of the expression level of CD117 in a sample of an acute myelogenous leukemia patient, wherein FIG. 2(a) is a graph showing the results of flow cytometry analysis of a sample of an acute myelogenous leukemia patient, and FIG. 2(b) is a graph showing the expression level of CD117 in acute myelogenous leukemia cells;

figure 3 is a graph of the results of flow cytometric analysis of mixed tumor cell and CAR-T cell cultures, wherein figure 3(a) tumor cells were cultured with T cells, figure 3(b) tumor cells were cultured with Mesothelin CAR-T cells, and figure 3(c) tumor cells were cultured with CAR-T cells of the present application.

Detailed Description

To further illustrate the technical means and effects of the present invention, the following further describes the technical solutions of the present invention by way of specific embodiments with reference to the drawings, but the present invention is not limited to the scope of the embodiments.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Example 1: construction of chimeric antigen receptors

(1) Synthesizing a secretor signal peptide, a CD117 antigen binding domain, a CD8 α and/or CD28 transmembrane domain, a CD28 signaling domain, a CD137 signaling domain and/or a CD27 signaling domain, a CD3 zeta signaling domain, a 2A sequence and a caspase 9 domain, i.e., secretor-CD 117-CD28-CD137-CD27-CD3 zeta-2A-iCasp 9, by whole genes;

the nucleotide sequence SEQ ID NO.3 of the chimeric antigen receptor is as follows:

ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCCAGGTGCAGCTGGTGCAGAGCGGCGCCGCCGTGAAGAAGCCCGGCGAGAGCCTGAAGATCAGCTGCAAGGGCAGCGGCTACAGATTCACCAGCTACTGGATCGGCTGGGTGAGACAGATGCCCGGCAAGGGCCTGGAGTGGATGGGCATCATCTACCCCGGCGACAGCGACACCAGATACAGCCCCAGCTTCCAGGGCCAGGTGACCATCAGCGCCGGCAAGAGCATCAGCACCGCCTACCTGCAGTGGAGCAGCCTGAAGGCCAGCGACACCGCCATGTACTACTGCGCCAGACACGGCAGAGGCTACAACGGCTACGAGGGCGCCTTCGACATCTGGGGCCAGGGCACCATGGTGACCGTGAGCAGCGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAGGGCGCCATCCAGCTGACCCAGAGCCCCAGCAGCCTGAGCGCCAGCGTGGGCGACAGAGTGACCATCACCTGCAGAGCCAGCCAGGGCATCAGCAGCGCCCTGGCCTGGTACCAGCAGAAGCCCGGCAAGGCCCCCAAGCTGCTGATCTACGACGCCAGCAGCCTGGAGAGCGGCGTGCCCAGCAGATTCAGCGGCAGCGGCAGCGGCACCGACTTCACCCTGACCATCAGCAGCCTGCAGCCCGAGGACTTCGCCACCTACTACTGCCAGCAGTTCAACAGCTACCCCCTGACCTTCGGCGGCGGCACCAAGGTGGAGATCAAGGCCGCCGCCATCGAGGTGATGTACCCCCCCCCCTACCTGGACAACGAGAAGAGCAACGGCACCATCATCCACGTGAAGGGCAAGCACCTGTGCCCCAGCCCCCTGTTCCCCGGCCCCAGCAAGCCCTTCTGGGTGCTGGTGGTGGTGGGCGGCGTGCTGGCCTGCTACAGCCTGCTGGTGACCGTGGCCTTCATCATCTTCTGGGTGAGAAGCAAGAGAAGCAGACTGCTGCACAGCGACTACATGAACATGACCCCCAGAAGACCCGGCCCCACCAGAAAGCACTACCAGCCCTACGCCCCCCCCAGAGACTTCGCCGCCTACAGAAGCGCCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCCAGAGAAGAAAGTACAGAAGCAACAAGGGCGAGAGCCCCGTGGAGCCCGCCGAGCCCTGCCACTACAGCTGCCCCAGAGAGGAGGAGGGCAGCACCATCCCCATCCAGGAGGACTACAGAAAGCCCGAGCCCGCCTGCAGCCCCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCACCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGTGGTGAAGAGAGGCAGAAAGAAGCTGCTGTACATCTTCAAGCAGCCCTTCATGAGACCCGTGCAGACCACCCAGGAGGAGGACGGCTGCAGCTGCAGATTCCCCGAGGAGGAGGAGGGCGGCTGCGAGCTGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCAGAGTGAAGTTCAGCAGAAGCGCCGACGCCCCCGCCTACCAGCAGGGCCAGAACCAGCTGTACAACGAGCTGAACCTGGGCAGAAGAGAGGAGTACGACGTGCTGGACAAGAGAAGAGGCAGAGACCCCGAGATGGGCGGCAAGCCCAGAAGAAAGAACCCCCAGGAGGGCCTGTACAACGAGCTGCAGAAGGACAAGATGGCCGAGGCCTACAGCGAGATCGGCATGAAGGGCGAGAGAAGAAGAGGCAAGGGCCACGACGGCCTGTACCAGGGCCTGAGCACCGCCACCAAGGACACCTACGACGCCCTGCACATGCAGGCCCTGCCCCCCAGAACCAGCGGCAGCGGCGCCACCAACTTCAGCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCCATGGGCGTGCAGGTGGAGACCATCAGCCCCGGCGACGGCAGAACCTTCCCCAAGAGAGGCCAGACCTGCGTGGTGCACTACACCGGCATGCTGGAGGACGGCAAGAAGGTGGACAGCAGCAGAGACAGAAACAAGCCCTTCAAGTTCATGCTGGGCAAGCAGGAGGTGATCAGAGGCTGGGAGGAGGGCGTGGCCCAGATGAGCGTGGGCCAGAGAGCCAAGCTGACCATCAGCCCCGACTACGCCTACGGCGCCACCGGCCACCCCGGCATCATCCCCCCCCACGCCACCCTGGTGTTCGACGTGGAGCTGCTGAAGCTGGAGGGCGGCGGCGGCAGCGGCGGCGGCGGCAGCGGCGCCATGGTGGGCGCCCTGGAGAGCCTGAGAGGCAACGCCGACCTGGCCTACATCCTGAGCATGGAGCCCTGCGGCCACTGCCTGATCATCAACAACGTGAACTTCTGCAGAGAGAGCGGCCTGAGAACCAGAACCGGCAGCAACATCGACTGCGAGAAGCTGAGAAGAAGATTCAGCAGCCTGCACTTCATGGTGGAGGTGAAGGGCGACCTGACCGCCAAGAAGATGGTGCTGGCCCTGCTGGAGCTGGCCAGACAGGACCACGGCGCCCTGGACTGCTGCGTGGTGGTGATCCTGAGCCACGGCTGCCAGGCCAGCCACCTGCAGTTCCCCGGCGCCGTGTACGGCACCGACGGCTGCCCCGTGAGCGTGGAGAAGATCGTGAACATCTTCAACGGCACCAGCTGCCCCAGCCTGGGCGGCAAGCCCAAGCTGTTCTTCATCCAGGCCTGCGGCGGCGAGCAGAAGGACCACGGCTTCGAGGTGGCCAGCACCAGCCCCGAGGACGAGAGCCCCGGCAGCAACCCCGAGCCCGACGCCACCCCCTTCCAGGAGGGCCTGAGAACCTTCGACCAGCTGGACGCCATCAGCAGCCTGCCCACCCCCAGCGACATCTTCGTGAGCTACAGCACCTTCCCCGGCTTCGTGAGCTGGAGAGACCCCAAGAGCGGCAGCTGGTACGTGGAGACCCTGGACGACATCTTCGAGCAGTGGGCCCACAGCGAGGACCTGCAGAGCCTGCTGCTGAGAGTGGCCAACGCCGTGAGCGTGAAGGGCATCTACAAGCAGATGCCCGGCTGCTTCAACTTCCTGAGAAAGAAGCTGTTCTTCAAGACCAGCGCCAGCTGA。

example 2: lentiviral packaging

(1) 293T cells, 1X 10, were cultured separately in six-well plates⁶Culturing each cell/well for 17-18 hours;

(2) add 600. mu.L/well fresh DMEM containing 10% FBS;

(3) the following reagents were added to sterile centrifuge tubes: each well was subjected to vortex shaking with 75. mu.L of supernatant of DMEM, 2.7. mu.g of auxiliary DNA mixture (1.8. mu.g of pNHP, 0.5. mu.g of pHEF-VSV-G, 0.2. mu.g of pHEF-GFP) and 0.8. mu.g of pTYF DNA vector;

(4) sucking 7 mu L of Superfect from the center of each pore plate, adding the Superfect into a centrifugal tube, blowing and beating for 5 times, and standing for 7-10 minutes at room temperature;

(5) dropwise adding the DNA-Superfect mixed solution in the centrifugal tube into each culture hole, and uniformly swirling;

(6)37℃3％CO₂culturing in an incubator for 4-5 hours;

(7) sucking the culture solution of the culture medium, flushing the culture medium with 1.5mL of AIM-V, and adding 1.5mL of AIM-V for continuous culture;

(8) the medium was returned to 3% CO₂The cells were incubated overnight in an incubator and the transfection efficiency was observed by fluorescence microscopy on the morning of 2-3 days.

Example 3: lentivirus purification and concentration

1) Virus purification

Removing cell debris by centrifugation (1000g, 5 min) to obtain viral supernatant, filtering the viral supernatant with a 0.45 micron low protein binding filter, dividing the virus into small portions, and storing at-80 deg.C;

generally, transfected cells can produce 10 cells per ml of medium⁶To 10⁷Transduction unit titrated lentiviral vectors.

2) Concentration of lentiviral vectors with Centricon Filter

(1) In a biological safety cabinet, taking a Centricon tube, disinfecting the tube for 1 time by using 70% alcohol, and then cleaning the tube for 3 times by using sterile PBS (phosphate buffer solution);

(2) add 18ml of virus supernatant to each Centricon P-20 filter tube, then centrifuge at 2500g for 30 minutes or until the virus volume is reduced to 0.5 ml;

(3) the filter tube was shaken and then centrifuged at 400g for 2 minutes to collect the concentrated virus in a collection cup. Finally, the viruses in all tubes are collected in a centrifuge tube.

Example 4: transfection of CAR-T cells

Activating the T cells at 5X 10⁶Inoculating to 24-well plate, adding 50 μ l of lentivirus concentrated with target gene, centrifuging at 100g centrifugal speed at room temperature for 100 min, culturing at 37 deg.C for 24 hr, adding 1ml AIM-V medium containing 2% human serum and cell culture factor, culturing for 2-3 days, harvesting and counting cells, and culturing at 1 × 10⁷Inoculating to 12-well plate, culturing for 2-3 days, infecting target cells with lentivirus vector carrying GFP and observing the cytotoxic effect by annexin V/PI staining method.

The results are shown in FIGS. 1-2, and as shown in FIGS. 1(a) -1 (b), CD117 was highly expressed by 73% of tumor cells in patients with acute T cell leukemia; as shown in fig. 2(a) -2 (b), 49.2% of the tumor cells highly expressed CD117 in patients with acute myeloid leukemia. Therefore, the CD117 selected by the invention as the target of the chimeric antigen receptor has strong specificity, and can quickly and accurately identify and poison the lymphoblastic leukemia cells.

Example 5 in vitro tumor killing of CAR-T cells

(1) Control T cells, Mesothelin CAR T and prepared CAR-T cells were CO-cultured with tumor cells at 37 degrees 5% CO₂Co-culturing for 18h in an incubator;

(2) evaluating the recognition and killing functions of the CAR-T cells on cancer cells in vitro, wherein the tumor cells are calcein markers or infected with LV-GFP;

the results are shown in FIGS. 3(a) to 3(b), and it can be seen from FIG. 3(a) that the ratio of tumor cells showed 52.7% after co-culturing tumor cells with T cells, and from FIG. 3(b) that the ratio of tumor cells showed a slight decrease of 35.5% after co-culturing tumor cells with Mesothelin CAR T cells, and from FIG. 3(c) that the ratio of tumor cells showed a decrease of 16.7% after co-culturing tumor cells with the prepared CAR-T cells, and it can be seen that the CAR-T cells prepared in the present application had the best effect of killing tumors.

In conclusion, the CD117 tumor surface antigen of the chimeric antigen receptor is not easy to mutate, and has better effect compared with other chimeric antigen receptors and other tumor antigens, and the expression amount of the target is high, so that the immune effect of the CAR-T cell is enhanced, and the treatment effect of the CAR-T cell is enhanced.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

SEQUENCE LISTING

<110> Shenzhen City institute of immune gene therapy

<120> CD 117-based chimeric antigen receptor and application thereof

<130>2017

<160>6

<170>PatentIn version 3.3

<210>1

<211>248

<212>PRT

<213> artificially synthesized sequence

<400>1

Gln Val Gln Leu Val Gln Ser Gly Ala Ala Val Lys Lys Pro Gly Glu

1 5 10 15

Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly Tyr Arg Phe Thr Ser Tyr

20 25 30

Trp Ile Gly Trp Val Arg Gln Met Pro Gly Lys Gly Leu Glu Trp Met

35 40 45

Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr Arg Tyr Ser Pro Ser Phe

50 55 60

Gln Gly Gln Val Thr Ile Ser Ala Gly Lys Ser Ile Ser Thr Ala Tyr

65 70 75 80

Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp Thr Ala Met Tyr Tyr Cys

85 90 95

Ala Arg His Gly Arg Gly Tyr Asn Gly Tyr Glu Gly Ala Phe Asp Ile

100 105 110

Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Ser Thr Ser Gly

115 120125

Ser Gly Lys Pro Gly Ser Ser Glu Gly Ser Thr Lys Gly Ala Ile Gln

130 135 140

Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val

145 150 155 160

Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile Ser Ser Ala Leu Ala Trp

165 170 175

Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala

180 185 190

Ser Ser Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser

195 200 205

Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe

210 215 220

Ala Thr Tyr Tyr Cys Gln Gln Phe Asn Ser Tyr Pro Leu Thr Phe Gly

225 230 235 240

Gly Gly Thr Lys Val Glu Ile Lys

245

<210>2

<211>1058

<212>PRT

<213> artificially synthesized sequence

<400>2

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 510 15

Ala Phe Leu Leu Ile Pro Gln Val Gln Leu Val Gln Ser Gly Ala Ala

20 25 30

Val Lys Lys Pro Gly Glu Ser Leu Lys Ile Ser Cys Lys Gly Ser Gly

35 40 45

Tyr Arg Phe Thr Ser Tyr Trp Ile Gly Trp Val Arg Gln Met Pro Gly

50 55 60

Lys Gly Leu Glu Trp Met Gly Ile Ile Tyr Pro Gly Asp Ser Asp Thr

65 70 75 80

Arg Tyr Ser Pro Ser Phe Gln Gly Gln Val Thr Ile Ser Ala Gly Lys

85 90 95

Ser Ile Ser Thr Ala Tyr Leu Gln Trp Ser Ser Leu Lys Ala Ser Asp

100 105 110

Thr Ala Met Tyr Tyr Cys Ala Arg His Gly Arg Gly Tyr Asn Gly Tyr

115 120 125

Glu Gly Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser

130 135 140

Ser Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Ser Glu Gly Ser

145 150 155 160

Thr Lys Gly Ala Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu Ser Ala

165 170175

Ser Val Gly Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Gly Ile

180 185 190

Ser Ser Ala Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys

195 200 205

Leu Leu Ile Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro Ser Arg

210 215 220

Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser

225 230 235 240

Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Phe Asn Ser

245 250 255

Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Ala Ala

260 265 270

Ala Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser

275 280 285

Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro

290 295 300

Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly

305 310 315 320

Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile

325 330335

Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met

340 345 350

Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro

355 360 365

Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Ala Ser Gly Gly

370 375 380

Gly Gly Ser Gly Gly Gly Gly Ser Gln Arg Arg Lys Tyr Arg Ser Asn

385 390 395 400

Lys Gly Glu Ser Pro Val Glu Pro Ala Glu Pro Cys His Tyr Ser Cys

405 410 415

Pro Arg Glu Glu Glu Gly Ser Thr Ile Pro Ile Gln Glu Asp Tyr Arg

420 425 430

Lys Pro Glu Pro Ala Cys Ser Pro Gly Gly Gly Gly Ser Gly Gly Gly

435 440 445

Gly Ser Thr Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Val Val

450 455 460

Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met

465 470 475 480

Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe

485 490 495

Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Gly Ser Gly

500 505 510

Gly Gly Gly Ser Gly Gly Gly Gly Ser Arg Val Lys Phe Ser Arg Ser

515 520 525

Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu

530 535 540

Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg

545 550 555 560

Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln

565 570 575

Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr

580 585 590

Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp

595 600 605

Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala

610 615 620

Leu His Met Gln Ala Leu Pro Pro Arg Thr Ser Gly Ser Gly Ala Thr

625 630 635 640

Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val Glu Glu Asn Pro Gly

645 650 655

Pro Met Gly Val Gln Val Glu Thr Ile Ser Pro Gly Asp Gly Arg Thr

660 665 670

Phe Pro Lys Arg Gly Gln Thr Cys Val Val His Tyr Thr Gly Met Leu

675 680 685

Glu Asp Gly Lys Lys Val Asp Ser Ser Arg Asp Arg Asn Lys Pro Phe

690 695 700

Lys Phe Met Leu Gly Lys Gln Glu Val Ile Arg Gly Trp Glu Glu Gly

705 710 715 720

Val Ala Gln Met Ser Val Gly Gln Arg Ala Lys Leu Thr Ile Ser Pro

725 730 735

Asp Tyr Ala Tyr Gly Ala Thr Gly His Pro Gly Ile Ile Pro Pro His

740 745 750

Ala Thr Leu Val Phe Asp Val Glu Leu Leu Lys Leu Glu Gly Gly Gly

755 760 765

Gly Ser Gly Gly Gly Gly Ser Gly Ala Met Val Gly Ala Leu Glu Ser

770 775 780

Leu Arg Gly Asn Ala Asp Leu Ala Tyr Ile Leu Ser Met Glu Pro Cys

785 790 795 800

Gly His Cys Leu Ile Ile Asn Asn Val Asn Phe Cys Arg Glu Ser Gly

805 810 815

Leu Arg Thr Arg Thr Gly Ser Asn Ile Asp Cys Glu Lys Leu Arg Arg

820 825 830

Arg Phe Ser Ser Leu His Phe Met Val Glu Val Lys Gly Asp Leu Thr

835 840 845

Ala Lys Lys Met Val Leu Ala Leu Leu Glu Leu Ala Arg Gln Asp His

850 855 860

Gly Ala Leu Asp Cys Cys Val Val Val Ile Leu Ser His Gly Cys Gln

865 870 875 880

Ala Ser His Leu Gln Phe Pro Gly Ala Val Tyr Gly Thr Asp Gly Cys

885 890 895

Pro Val Ser Val Glu Lys Ile Val Asn Ile Phe Asn Gly Thr Ser Cys

900 905 910

Pro Ser Leu Gly Gly Lys Pro Lys Leu Phe Phe Ile Gln Ala Cys Gly

915 920 925

Gly Glu Gln Lys Asp His Gly Phe Glu Val Ala Ser Thr Ser Pro Glu

930 935 940

Asp Glu Ser Pro Gly Ser Asn Pro Glu Pro Asp Ala Thr Pro Phe Gln

945 950 955 960

Glu Gly Leu Arg Thr Phe Asp Gln Leu Asp Ala Ile Ser Ser Leu Pro

965 970 975

Thr Pro Ser Asp Ile Phe Val Ser Tyr Ser Thr Phe Pro Gly Phe Val

980 985 990

Ser Trp Arg Asp Pro Lys Ser Gly Ser Trp Tyr Val Glu Thr Leu Asp

995 1000 1005

Asp Ile Phe Glu Gln Trp Ala His Ser Glu Asp Leu Gln Ser Leu

1010 1015 1020

Leu Leu Arg Val Ala Asn Ala Val Ser Val Lys Gly Ile Tyr Lys

1025 1030 1035

Gln Met Pro Gly Cys Phe Asn Phe Leu Arg Lys Lys Leu Phe Phe

1040 1045 1050

Lys Thr Ser Ala Ser

1055

<210>3

<211>3177

<212>DNA

<213> artificially synthesized sequence

<400>3

atgctgctgc tggtgaccag cctgctgctg tgcgagctgc cccaccccgc cttcctgctg 60

atcccccagg tgcagctggt gcagagcggc gccgccgtga agaagcccgg cgagagcctg 120

aagatcagct gcaagggcag cggctacaga ttcaccagct actggatcgg ctgggtgaga 180

cagatgcccg gcaagggcct ggagtggatg ggcatcatct accccggcga cagcgacacc 240

agatacagcc ccagcttcca gggccaggtg accatcagcg ccggcaagag catcagcacc 300

gcctacctgc agtggagcag cctgaaggcc agcgacaccg ccatgtacta ctgcgccaga 360

cacggcagag gctacaacgg ctacgagggc gccttcgaca tctggggcca gggcaccatg 420

gtgaccgtga gcagcggcag caccagcggc agcggcaagc ccggcagcag cgagggcagc 480

accaagggcg ccatccagct gacccagagc cccagcagcc tgagcgccag cgtgggcgac 540

agagtgacca tcacctgcag agccagccag ggcatcagca gcgccctggc ctggtaccag 600

cagaagcccg gcaaggcccc caagctgctg atctacgacg ccagcagcct ggagagcggc 660

gtgcccagca gattcagcgg cagcggcagc ggcaccgact tcaccctgac catcagcagc 720

ctgcagcccg aggacttcgc cacctactac tgccagcagt tcaacagcta ccccctgacc 780

ttcggcggcg gcaccaaggt ggagatcaag gccgccgcca tcgaggtgat gtaccccccc 840

ccctacctgg acaacgagaa gagcaacggc accatcatcc acgtgaaggg caagcacctg 900

tgccccagcc ccctgttccc cggccccagc aagcccttct gggtgctggt ggtggtgggc 960

ggcgtgctgg cctgctacag cctgctggtg accgtggcct tcatcatctt ctgggtgaga 1020

agcaagagaa gcagactgct gcacagcgac tacatgaaca tgacccccag aagacccggc 1080

cccaccagaa agcactacca gccctacgcc ccccccagag acttcgccgc ctacagaagc 1140

gccagcggcg gcggcggcag cggcggcggc ggcagccaga gaagaaagta cagaagcaac 1200

aagggcgaga gccccgtgga gcccgccgag ccctgccact acagctgccc cagagaggag 1260

gagggcagca ccatccccat ccaggaggac tacagaaagc ccgagcccgc ctgcagcccc 1320

ggcggcggcg gcagcggcgg cggcggcagc accagcggcg gcggcggcag cggcggcggc 1380

ggcagcgtgg tgaagagagg cagaaagaag ctgctgtaca tcttcaagca gcccttcatg 1440

agacccgtgc agaccaccca ggaggaggac ggctgcagct gcagattccc cgaggaggag 1500

gagggcggct gcgagctggg cggcggcggc agcggcggcg gcggcagcgg cggcggcggc 1560

agcagagtga agttcagcag aagcgccgac gcccccgcct accagcaggg ccagaaccag 1620

ctgtacaacg agctgaacct gggcagaaga gaggagtacg acgtgctgga caagagaaga 1680

ggcagagacc ccgagatggg cggcaagccc agaagaaaga acccccagga gggcctgtac 1740

aacgagctgc agaaggacaa gatggccgag gcctacagcg agatcggcat gaagggcgag 1800

agaagaagag gcaagggcca cgacggcctg taccagggcc tgagcaccgc caccaaggac 1860

acctacgacg ccctgcacat gcaggccctg ccccccagaa ccagcggcag cggcgccacc 1920

aacttcagcc tgctgaagca ggccggcgac gtggaggaga accccggccc catgggcgtg 1980

caggtggaga ccatcagccc cggcgacggc agaaccttcc ccaagagagg ccagacctgc 2040

gtggtgcact acaccggcat gctggaggac ggcaagaagg tggacagcag cagagacaga 2100

aacaagccct tcaagttcat gctgggcaag caggaggtga tcagaggctg ggaggagggc 2160

gtggcccaga tgagcgtggg ccagagagcc aagctgacca tcagccccga ctacgcctac 2220

ggcgccaccg gccaccccgg catcatcccc ccccacgcca ccctggtgtt cgacgtggag 2280

ctgctgaagc tggagggcgg cggcggcagc ggcggcggcg gcagcggcgc catggtgggc 2340

gccctggaga gcctgagagg caacgccgac ctggcctaca tcctgagcat ggagccctgc 2400

ggccactgcc tgatcatcaa caacgtgaac ttctgcagag agagcggcct gagaaccaga 2460

accggcagca acatcgactg cgagaagctg agaagaagat tcagcagcct gcacttcatg 2520

gtggaggtga agggcgacct gaccgccaag aagatggtgc tggccctgct ggagctggcc 2580

agacaggacc acggcgccct ggactgctgc gtggtggtga tcctgagcca cggctgccag 2640

gccagccacc tgcagttccc cggcgccgtg tacggcaccg acggctgccc cgtgagcgtg 2700

gagaagatcg tgaacatctt caacggcacc agctgcccca gcctgggcgg caagcccaag 2760

ctgttcttca tccaggcctg cggcggcgag cagaaggacc acggcttcga ggtggccagc 2820

accagccccg aggacgagag ccccggcagc aaccccgagc ccgacgccac ccccttccag 2880

gagggcctga gaaccttcga ccagctggac gccatcagca gcctgcccac ccccagcgac 2940

atcttcgtga gctacagcac cttccccggc ttcgtgagct ggagagaccc caagagcggc 3000

agctggtacg tggagaccct ggacgacatc ttcgagcagt gggcccacag cgaggacctg 3060

cagagcctgc tgctgagagt ggccaacgcc gtgagcgtga agggcatcta caagcagatg 3120

cccggctgct tcaacttcct gagaaagaag ctgttcttca agaccagcgc cagctga 3177

<210>4

<211>423

<212>PRT

<213> artificially synthesized sequence

<400>4

Gly Ser Gly Ala Thr Asn Phe Ser Leu Leu Lys Gln Ala Gly Asp Val

1 5 10 15

Glu Glu Asn Pro Gly Pro Met Gly Val Gln Val Glu Thr Ile Ser Pro

20 25 30

Gly Asp Gly Arg Thr Phe Pro Lys Arg Gly Gln Thr Cys Val Val His

35 40 45

Tyr Thr Gly Met Leu Glu Asp Gly Lys Lys Val Asp Ser Ser Arg Asp

50 55 60

Arg Asn Lys Pro Phe Lys Phe Met Leu Gly Lys Gln Glu Val Ile Arg

65 70 75 80

Gly Trp Glu Glu Gly Val Ala Gln Met Ser Val Gly Gln Arg Ala Lys

85 90 95

Leu Thr Ile Ser Pro Asp Tyr Ala Tyr Gly Ala Thr Gly His Pro Gly

100 105 110

Ile Ile Pro Pro His Ala Thr Leu Val Phe Asp Val Glu Leu Leu Lys

115 120 125

Leu Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Ala Met Val

130 135 140

Gly Ala Leu Glu Ser Leu Arg Gly Asn Ala Asp Leu Ala Tyr Ile Leu

145 150 155 160

Ser Met Glu Pro Cys Gly His Cys Leu Ile Ile Asn Asn Val Asn Phe

165 170 175

Cys Arg Glu Ser Gly Leu Arg Thr Arg Thr Gly Ser Asn Ile Asp Cys

180 185 190

Glu Lys Leu Arg Arg Arg Phe Ser Ser Leu His Phe Met Val Glu Val

195 200 205

Lys Gly Asp Leu Thr Ala Lys Lys Met Val Leu Ala Leu Leu Glu Leu

210 215 220

Ala Arg Gln Asp His Gly Ala Leu Asp Cys Cys Val Val Val Ile Leu

225 230 235 240

Ser His Gly Cys Gln Ala Ser His Leu Gln Phe Pro Gly Ala Val Tyr

245 250 255

Gly Thr Asp Gly Cys Pro Val Ser Val Glu Lys Ile Val Asn Ile Phe

260 265 270

Asn Gly Thr Ser Cys Pro Ser Leu Gly Gly Lys Pro Lys Leu Phe Phe

275 280 285

Ile Gln Ala Cys Gly Gly Glu Gln Lys Asp His Gly Phe Glu Val Ala

290 295 300

Ser Thr Ser Pro Glu Asp Glu Ser Pro Gly Ser Asn Pro Glu Pro Asp

305 310 315 320

Ala Thr Pro Phe Gln Glu Gly Leu Arg Thr Phe Asp Gln Leu Asp Ala

325 330 335

Ile Ser Ser Leu Pro Thr Pro Ser Asp Ile Phe Val Ser Tyr Ser Thr

340 345 350

Phe Pro Gly Phe Val Ser Trp Arg Asp Pro Lys Ser Gly Ser Trp Tyr

355 360 365

Val Glu Thr Leu Asp Asp Ile Phe Glu Gln Trp Ala His Ser Glu Asp

370 375 380

Leu Gln Ser Leu Leu Leu Arg Val Ala Asn Ala Val Ser Val Lys Gly

385 390 395 400

Ile Tyr Lys Gln Met Pro Gly Cys Phe Asn Phe Leu Arg Lys Lys Leu

405 410 415

Phe Phe Lys Thr Ser Ala Ser

420

<210>5

<211>21

<212>PRT

<213> artificially synthesized sequence

<400>5

Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu

1 5 10 15

His Ala Ala Arg Pro

20

<210>6

<211>22

<212>PRT

<213> artificially synthesized sequence

<400>6

Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro

1 5 10 15

Ala Phe Leu Leu Ile Pro

20

Claims

1. A CD 117-based chimeric antigen receptor, wherein the chimeric antigen receptor is secretor-CD 117-CD28-CD137-CD27-CD3 ζ -2A-iCasp 9;

the amino acid sequence of the chimeric antigen receptor Secretory-CD117-CD28-CD137-CD27-CD3 zeta-2A-iCasp 9 is shown in SEQ ID NO. 2.

2. The chimeric antigen receptor according to claim 1, wherein the nucleotide sequence of the chimeric antigen receptor Secretory-CD117-CD28-CD137-CD27-CD3 ζ -2A-iCasp9 is shown in SEQ ID No. 3.

3. The chimeric antigen receptor according to claim 2, wherein said chimeric antigen receptor is expressed by transfection into a T cell with its encoded nucleic acid sequence.

4. The chimeric antigen receptor according to claim 3, wherein the transfection is by transfection into T cells by any one of a viral vector, a eukaryotic expression plasmid or an mRNA sequence or a combination of at least two.

5. The chimeric antigen receptor according to claim 4, wherein the transfection is by transfection into T cells with a viral vector.

6. The chimeric antigen receptor according to claim 5, wherein the viral vector is a lentiviral vector and/or a retroviral vector.

7. The chimeric antigen receptor according to claim 6, wherein the viral vector is a lentiviral vector.

8. A recombinant lentivirus, wherein the recombinant lentivirus is obtained by co-transfecting a mammalian cell with a viral vector comprising the chimeric antigen receptor of any one of claims 1 to 7 and the packaging helper plasmids pNHP and pHEF-VSVG.

9. The recombinant lentivirus of claim 8, wherein the mammalian cell is any one of 293 cells, 293T cells or TE671 cells or a combination of at least two thereof.

10. A composition comprising the chimeric antigen receptor of any one of claims 1-7 and/or the recombinant lentivirus of claim 8 or 9.

11. Use of the chimeric antigen receptor of any one of claims 1 to 7, the recombinant lentivirus of claim 8 or 9 or the composition of claim 10 for the preparation of chimeric antigen receptor T cells and for the preparation of a medicament for the treatment of tumors.

12. The use according to claim 11, wherein the tumor is a blood-related tumor disease.

13. Use according to claim 12, wherein the blood-related tumor disease is leukemia and/or lymphoma.