CN107385073A - A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism - Google Patents
A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism Download PDFInfo
- Publication number
- CN107385073A CN107385073A CN201710743611.9A CN201710743611A CN107385073A CN 107385073 A CN107385073 A CN 107385073A CN 201710743611 A CN201710743611 A CN 201710743611A CN 107385073 A CN107385073 A CN 107385073A
- Authority
- CN
- China
- Prior art keywords
- lhpp
- sirt1
- seq
- rev
- primer sets
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention provides a kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism, primer sets include SIRT1 For, SIRT1 Rev primer pairs, and LHPP For, LHPP Rev primer pairs, SIRT1 For base sequence such as SEQ ID NO：Shown in 1, SIRT1 Rev base sequence such as SEQ ID NO：Shown in 2, LHPP For base sequence such as SEQ ID NO：Shown in 3, LHPP Rev base sequence such as SEQ ID NO：Shown in 4.LHPP and SIRT1 genes are accurate, accuracy is high using the detection of restricted digestion method by the present invention, and specificity is good, and false positive false negative rate is low, simple to operate, and instrument and equipment requires low, wide adaptability.
Description
Technical field
It is more for detecting SIRT1, LHPP gene mononucleotide more particularly, to one kind the invention belongs to biomedicine field
Primer sets, kit and its application of state property.
Background technology
Depression is also known as depressive disorder, low for main clinical characteristics with notable and lasting mental state, is mood disorder
Main Types.Clinical visible mental state is low unbecoming with its situation, and the downhearted of mood can be from depressed to extremely grieved, certainly
Inferior depression, in addition it is pessimistic and worldweary, can there are conamen or behavior；Even occur numb；Some cases have obvious anxiety and fortune
Dynamic property is intense；Severe patient may occur in which the psychotic symptoms such as illusion, vain hope.Even breaking-out continues at least more than 2 weeks, elder every time
Several years, majority of cases have the tendency of recurrent exerbation, and breaking-out is most of every time to alleviate, and can partly have residual symptoms or switch to slow
Property.One joint study of the World Health Organization, the World Bank and Harvard University shows that depression has become Chinese disease and born
Second serious disease of load.
In recent years, the incidence of depression is in cumulative year after year, and depressed crowd's ratio constantly increases.Defended according to the world within 2014
Raw tissue latest data shows that the incidence of disease of global depression is 3.1%.Chinese incidence of depression is up to 5%~6%.With
The continuous quickening of entire society's rhythm of life and the increase of people's mental events pressure, when and occur what is triggered by depression
Social event.Just have been reported that star Qiao Renliang commits suiside because of depression in the recent period.Generation superstar Zhang Guorong is also had been reported before because of suppression
Strongly fragrant suicide.The disease not only seriously perplexs the life of patient, also brings heavy burden to family and society.Therefore we need to be to suppression
Strongly fragrant disease is paid much attention to.
The factors such as depressed generation and heredity, biochemistry and Psychosocial are relevant.1) inherent cause (10%) large sample
The investigation display of crowd's genetic epidemiology, nearer with patient's genetic connection, P is higher.The ill probability of first degree relative
Far above other relatives, this is consistent with the universal law of genetic disease.2) biochemical factors (25%) catecholamine hypothesis：Refer mainly to
The generation of depression may be with the concentration of brain synaptic cleft neurotransmitter serotonin (5-HT) and norepinephrine (NE)
Decline relevant；Due to many antidepressants, such as selective serotonin reuptake inhibitor (SSRI) or selective 5- hydroxyls color
After the use such as amine and NRI (SNRI), although the concentration of these neurotransmitters of brain synaptic cleft
Raise quickly, but antidepressant effect typically still needs 2 weeks or so just work, therefore have 5-HT and NE acceptors sensitive again
Property increases the hypothesis of (super quick).3) psychosocial factor (25%) various momentous life events occur suddenly, or persistently deposit for a long time
Can cause it is strong or (and) lasting depression experience, cause the generation of depression.Depression be by inherent cause,
The coefficient result of biochemical factors and psychosocial factor.
The treatment method of depression mainly has drug therapy, recognizing factor and other therapies at present.But these therapies be
Medical diagnosis on disease is the treatment method that depression is just given afterwards, it is impossible to has the function that prevention.Genetic test has proved to be pre-
Survey the effective means of disease risks.Depressed occurrence risk can be predicted by the detection to depressed related some genes.
Patient is helped to find oneself depressed high risk condition that may be present ahead of time, so as to cause enough attention, in daily life
Strengthen health guidance and management in working and learning, reach the purpose prevented as far as possible.
The SIRT1 genes gene related to severe depression, positioned at No. 10 chromosome of the mankind.The gene is weight in mitochondria
The protease wanted.Research shows that schizophrenic patients cognitive disorder is relevant with the protein.Based on Chinese depression people group discovery
The genome association of extensive sample, which is analyzed, to be shown, a mononucleotide polymorphism site rs12415800's on the gene
Polymorphism and depressed height correlation.When the loci gene type is GG, suffer from low 1.2 times that depression Hazard ratio is not undergone mutation；
When the genotype in the site is AA, the risk for suffering from depression then increases by 1.2 times；The risk that GA genotype suffers from depression is placed in the middle.
LHPP genes are also the gene related to severe depression.Oxford University geneticist Jonathan Flint discoveries,
SIRT1 and LHPP is the genetic marker of 2 major depressive disorders.Sample populations are the Chinese Han women with major depressive disorder,
The DNA sequence analysis of 5303 Chinese Han women major depressive disorder patients is completed, there are 5337 control group sequences in addition.This
Item achievement is published in July, 2015《Nature》On.A mononucleotide polymorphism site rs35936514 on the gene
Polymorphism and depressed height correlation.When the loci gene type is TT, suffer from depressed Hazard ratio do not undergo mutation it is high 0.8 times；
When the genotype in the site is CC, the risk for suffering from depression is relatively low；It is placed in the middle that CT genotype suffers from depressed risk.
But the common method of detection SNP has PCR-RFLP, genetic chip, sanger sequencings etc. at present
Method.PCR-RFLP complex operations take, and credible result degree is poor.The requirement of PCR-RFLP amplification conditions is strict, cumbersome.
Rapidly and efficiently, but its cost is high for genetic chip.Sanger sequencings are costly, and heterozygote is not easy parting.
The content of the invention
In view of this, the present invention is directed to propose a kind of primer for being used to detect SIRT1, LHPP gene mononucleotide polymorphism
Group, kit and its application, to solve the method for existing detection SNP to cumbersome, costly and miscellaneous
Zoarium is not easy the problems such as parting.
To reach above-mentioned purpose, the technical proposal of the invention is realized in this way：
A kind of primer sets for being used to detect SIRT1, LHPP gene mononucleotide polymorphism, including SIRT1-For, SIRT1-
Rev primer pairs, and LHPP-For, LHPP-Rev primer pair, SIRT1-For base sequence such as SEQ ID NO：Shown in 1,
SIRT1-Rev base sequence such as SEQ ID NO：Shown in 2, LHPP-For base sequence such as SEQ ID NO：Shown in 3,
LHPP-Rev base sequence such as SEQ ID NO：Shown in 4.
It is a kind of to be used to detect the kit of SIRT1, LHPP gene mononucleotide polymorphism, comprising it is following any one or it is more
Kind：
1) primer sets of claim 1；
2)SEQ ID No：1~SEQ ID No：The complementary strand of every sequence in sequence shown in 4；
3) with SEQ ID No：1~SEQ ID No：Every sequence has the sequence of at least 70% homology in sequence shown in 4
Row.
Above-mentioned primer sets or above-mentioned kit are being prepared for detecting SIRT1, LHPP gene mononucleotide polymorphism
Reagent or medicine in application.
When entering performing PCR using above-mentioned primer sets or above-mentioned kit, reaction system is as follows：
PCR amplification conditions：
Relative to prior art, the primer of the present invention for being used to detect SIRT1, LHPP gene mononucleotide polymorphism
Group has the advantage that：
The primer sets or reagent cartridge configuration of the present invention for being used to detect SIRT1, LHPP gene mononucleotide polymorphism
Simply, low cost, detection speed are fast, and the present invention is using on the method detection SIRT1 and LHPP genes of restriction enzyme
SNP, accuracy is high, and specificity is good, and false positive false negative rate is low, simple to operate, instrument and equipment requirement
It is low, wide adaptability.
Embodiment
In addition to being defined, technical term used has universal with those skilled in the art of the invention in following examples
The identical meanings of understanding.Test reagent used, is routine biochemistry reagent unless otherwise specified in following examples；It is described
Experimental method, it is conventional method unless otherwise specified.Wherein：SIRT1-For, SIRT1-Rev, LHPP- in following examples
For and LHPP-Rev is designed by my company and is transferred to Suzhou Jin Weizhi bio tech ltd to be synthesized using existing method；
Certain SIRT1-For, SIRT1-Rev, LHPP-For and LHPP-Rev can also use other existing methods to synthesize.
The present invention is described in detail with reference to embodiment.
A kind of primer sets for being used to detect SIRT1, LHPP gene mononucleotide polymorphism, including SIRT1-For, SIRT1-
Rev primer pairs, and LHPP-For, LHPP-Rev primer pair, SIRT1-For base sequence such as SEQ ID NO：Shown in 1,
SIRT1-Rev base sequence such as SEQ ID NO：Shown in 2, LHPP-For base sequence such as SEQ ID NO：Shown in 3,
LHPP-Rev base sequence such as SEQ ID NO：Shown in 4.
SIRT1-For:CCAGAACAGTTTCATAGAGCC
SIRT1-Rev:TCTTACTTTCAGAGAAGACCCAATA
LHPP-For：GAATCTCCCAAATCCCAGAACTCA
LHPP-Rev：ACACCGGGCATGACACCTTCAAGT
It is a kind of to be used to detect the kit of SIRT1, LHPP gene mononucleotide polymorphism, comprising it is following any one or it is more
Kind：
1) primer sets of claim 1；
2)SEQ ID No：1~SEQ ID No：The complementary strand of every sequence in sequence shown in 4；
3) with SEQ ID No：1~SEQ ID No：Every sequence has the sequence of at least 70% homology in sequence shown in 4
Row.
Above-mentioned primer sets or above-mentioned kit are being prepared for detecting SIRT1, LHPP gene mononucleotide polymorphism
Reagent or medicine in application.
When entering performing PCR using above-mentioned primer sets or above-mentioned kit, reaction system is as follows：
PCR amplification conditions are as follows：
Detection method using primer detection SIRT1, LHPP gene mononucleotide polymorphism provided by the invention is as follows：
1) sample DNA extracts：Oral mucosa swab is taken, under being wiped repeatedly 20 on the inside of oral cavity, swab is taken out and is folded down cotton
Wadding part, as in the μ L of 100 liquid of Chelex 150 1.5ml centrifuge tubes, making its submerge sample, add Proteinase K (20mg/
ML) 20 μ L, whirlpool mix.50 DEG C of water-bath digestion overnight (50 DEG C of water-bath digestion 10h in this example), are boiled 10min, are placed on ice
3min is stood, l2,000r/min centrifugation 2min, takes supernatant, -20 DEG C of preservations are stand-by.
2) PCR is expanded：
PCR reaction systems are as shown in table 1：
Table 1
| 10×buffer | 2.5μL |
| dNTPs(2.5mM each) | 2μL |
| Primer forward(10μM) | 1μL |
| Primer reverse(10μM) | 1μL |
| DNA sample(20ng/μl) | 2μL |
| DNA polymerase(5U/μl) | 0.5μL |
| ddH2O | Up to 25μL |
The μ L of wherein dNTPs (2.5mM each) 2 refer to that four kinds of deoxyribonucleoside triphosphates of concentration are respectively 2.5mmol/L
DNTP respectively addition 2 μ L；The μ L of Primer forward (10 μM) 1 refer to that concentration is 10 μm of ol/L SIRT1-For, LHPP-
For respectively adds 1 μ L；The μ L of Primer reverse (10 μM) 1 refer to that concentration is 10 μm of ol/L SIRT1-Rev, LHPP-Rev
1 μ L of each addition；DNA sample are that concentration is 20ng/ μ L obtained by step 1).
PCR amplification conditions are as shown in table 2：
Table 2
3) restricted digestion：
It is that step 2) PCR amplification products therefroms carry out endonuclease digestion by previous step, is reacted by the system configurations of table 3,37
Reacted 3 hours in DEG C insulating box.SIRT1 gene polynorphisms are detected with RsaI；LHPP gene polynorphisms are entered with NcoI
Row detection (RsaI and NcoI are purchased from NEB companies).
Table 3
| 10×CutSmart buffer | 2μL |
| PCR pruduct | 10μL |
| Enzyme(RsaI/NcoI) | 1μL |
| ddH2O | Up to 20μL |
The μ L of Enzyme (RsaI/NcoI) 1 refer to the different choice RsaI or NcoI according to detection target.
4) result interpretation：
It is after digestion products obtained by step 3) carry out electrophoresis with 1% Ago-Gel by previous step, it is big according to band
It is small to carry out result interpretation according to following index, it is simple easy to identify.Sentence read result is as shown in table 4.LHPP genes are shown at 338bp
1 band, it is low to suffer from depression risk；Two bands are shown at 209bp and 129bp, suffer from depression risk height；Display 338bp,
The band of 209bp, 129bp tri-, moderate risk suffer from depression.If SIRT1 genes show the bands of 296bp mono-, excessive risk suffers from depression；
Display 195bp and the bands of 101bp two, low-risk suffer from depression；The band of 296bp, 195bp, 101bp tri- is shown, moderate risk is suffered from
Depression.Detection accuracy 99%.
Table 4
The application introduces newest research results, and the depressed related SNP of LHPP to SIRT1 genes is carried out
Detection, LHPP and SIRT1 gene mutations are relevant with the risk of major depressive disorder.
LHPP and SIRT1 genes are accurate, accuracy is high using the detection of restricted digestion method by the application, and specificity is good,
False positive false negative rate is low, simple to operate, and instrument and equipment requires low, wide adaptability.
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
God any modification, equivalent substitution and improvements made etc., should be included in the scope of the protection with principle.
Sequence table
<110>Tianjin ends to grace medical science and technology Co., Ltd
<120>A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism
<130> AZEYL1703
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 1
ccagaacagt ttcatagagc c 21
<210> 2
<211> 25
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 2
tcttactttc agagaagacc caata 25
<210> 3
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 3
gaatctccca aatcccagaa ctca 24
<210> 4
<211> 24
<212> DNA
<213>Artificial sequence (Artificial Sequence)
<400> 4
acaccgggca tgacaccttc aagt 24
Claims (4)
- A kind of 1. primer sets for being used to detect SIRT1, LHPP gene mononucleotide polymorphism, it is characterised in that：Including SIRT1- For, SIRT1-Rev primer pair, and LHPP-For, LHPP-Rev primer pair, SIRT1-For base sequence such as SEQ ID NO： Shown in 1, SIRT1-Rev base sequence such as SEQ ID NO：Shown in 2, LHPP-For base sequence such as SEQ ID NO：3 institutes Show, LHPP-Rev base sequence such as SEQ ID NO：Shown in 4.
- A kind of 2. kit for being used to detect SIRT1, LHPP gene mononucleotide polymorphism, it is characterised in that：Comprising it is following any one or more：1) primer sets of claim 1；2)SEQ ID No：1~SEQ ID No：The complementary strand of every sequence in sequence shown in 4；3) with SEQ ID No：1~SEQ ID No：Every sequence has the sequence of at least 70% homology in sequence shown in 4.
- 3. the primer sets of claim 1 or the kit of claim 2 are being prepared for detecting SIRT1, LHPP gene monokaryon glycosides Application in the reagent or medicine of sour polymorphism.
- 4. the kit described in primer sets or claim 3 described in usage right requirement 1 enters performing PCR, reaction system is as follows：PCR amplification conditions：。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710743611.9A CN107385073A (en) | 2017-08-25 | 2017-08-25 | A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710743611.9A CN107385073A (en) | 2017-08-25 | 2017-08-25 | A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107385073A true CN107385073A (en) | 2017-11-24 |
Family
ID=60346719
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710743611.9A Pending CN107385073A (en) | 2017-08-25 | 2017-08-25 | A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107385073A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113337596A (en) * | 2021-06-18 | 2021-09-03 | 同济大学 | Application of reagent for detecting MDLN protein or gene mutation in preparation of kit for diagnosing depression |
| CN114794016A (en) * | 2022-05-09 | 2022-07-29 | 承葛生物技术(广州)有限公司 | Method for constructing intestinal flora distribution disorder and anti-tumor immunity disorder model |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070256148A1 (en) * | 2006-04-26 | 2007-11-01 | Katz David A | DEP2 and its uses in major depressive disorder and other related disorders |
| CN103290113A (en) * | 2013-05-06 | 2013-09-11 | 西北农林科技大学 | Method for quickly detecting RFLP (restriction fragment length polymorphism) of SNP (single nucleotide polymorphism) of common ox SIRT1 (silent information regulator 1) gene |
-
2017
- 2017-08-25 CN CN201710743611.9A patent/CN107385073A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20070256148A1 (en) * | 2006-04-26 | 2007-11-01 | Katz David A | DEP2 and its uses in major depressive disorder and other related disorders |
| CN103290113A (en) * | 2013-05-06 | 2013-09-11 | 西北农林科技大学 | Method for quickly detecting RFLP (restriction fragment length polymorphism) of SNP (single nucleotide polymorphism) of common ox SIRT1 (silent information regulator 1) gene |
Non-Patent Citations (3)
| Title |
|---|
| CD NEFF ET AL: "Evidence for HTR1A and LHPP as interacting genetic riskfactors in major depression", 《MOLECULAR PSYCHIATRY》 * |
| NA CAI ET AL: "Sparse whole-genome sequencing identifies two loci for major depressive disorder", 《NATURE》 * |
| WEIBIN QIAN ET AL: "Effect of Daisaikoto on Expressions of SIRT1 and NF-kappaB of Diabetic Fatty Liver Rats Induced by High-Fat Diet and Streptozotocin", 《YONAGO ACTA MEDICA》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113337596A (en) * | 2021-06-18 | 2021-09-03 | 同济大学 | Application of reagent for detecting MDLN protein or gene mutation in preparation of kit for diagnosing depression |
| CN114794016A (en) * | 2022-05-09 | 2022-07-29 | 承葛生物技术(广州)有限公司 | Method for constructing intestinal flora distribution disorder and anti-tumor immunity disorder model |
| CN114794016B (en) * | 2022-05-09 | 2023-07-18 | 承葛生物技术(广州)有限公司 | Method for constructing intestinal flora distribution disorder and anti-tumor immunity disorder model |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2606156C (en) | Mitochondrial mutations and rearrangements as a diagnostic tool for the detection of sun exposure, prostate cancer and other cancers | |
| Eissa et al. | Integrative functional genetic-epigenetic approach for selecting genes as urine biomarkers for bladder cancer diagnosis | |
| Mardassi et al. | Tuberculosis due to resistant Haarlem strain, Tunisia | |
| Haberstick et al. | Population frequencies of the triallelic 5HTTLPR in six ethnicially diverse samples from North America, Southeast Asia, and Africa | |
| CN103484533A (en) | Method used for detecting HLA-B*5801 alleles | |
| Guo et al. | Analysis of the mitochondrial 4977 bp deletion in patients with hepatocellular carcinoma | |
| CN102140518A (en) | Quantitative detection kit and method for exon mutation of epidermal growth factor receptor (EGFR) relevant to lung cancers | |
| CN104450707B (en) | A kind of application of Serum miRNA biomarker | |
| Smelov et al. | Chlamydia trachomatis strain types have diversified regionally and globally with evidence for recombination across geographic divides | |
| Park et al. | Traveller-associated high-level ciprofloxacin-resistant Salmonella enterica Serovar Kentucky in the Republic of Korea | |
| CN110699446B (en) | SNP marker rs3174298 related to non-syndrome cleft lip and palate diagnosis and application thereof | |
| da Silva et al. | Expression of GNAS, TP53, and PTEN improves the patient prognostication in sonic hedgehog (SHH) medulloblastoma subgroup | |
| CN107385073A (en) | A kind of primer sets, kit and its application for being used to detect SIRT1, LHPP gene mononucleotide polymorphism | |
| Jiang et al. | Transcription factor 21 (TCF21) rs12190287 polymorphism is associated with osteosarcoma risk and outcomes in East Chinese population | |
| Tang et al. | Assay for transposase-accessible chromatin using sequencing analysis reveals a widespread increase in chromatin accessibility in psoriasis | |
| CN112481374B (en) | Detection method and detection kit for HLA-B1502 gene and application thereof | |
| Jang et al. | Significance of KIT exon 17 mutation depends on mutant level rather than positivity in core-binding factor acute myeloid leukemia | |
| CN105506164A (en) | Kit for detecting susceptibility of hebephrenic schizophrenia | |
| Kim et al. | Prognostic implications of PIK3CA amplification in curatively resected liposarcoma | |
| Altunkol et al. | Detection of CYP1A1 and GSTP1 gene polymorphisms in bladder cancer patients in a Turkish population using a polymerase chain reaction-restriction fragment length polymorphism method | |
| Su et al. | Cytochrome P450 2E1 RsaI/PstI and DraI polymorphisms are risk factors for lung cancer in Mongolian and Han population in inner Mongolia | |
| Guo et al. | Association analysis of ANK3 gene variants with schizophrenia in a northern Chinese Han population | |
| Qin et al. | Risk of disease progression in low-risk MDS is linked to distinct epigenetic subtypes | |
| Huang et al. | Relationship among methadone dose, polymorphisms of dopamine D2 receptor and tri-dimensional personality questionnaire in heroin-addicted patients | |
| Tsou et al. | The joint effect of hOGG1 single nucleotide polymorphism and betel quid chewing on oral cancer in Taiwan |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171124 |
|
| RJ01 | Rejection of invention patent application after publication |