CN107385067A - A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique - Google Patents
A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique Download PDFInfo
- Publication number
- CN107385067A CN107385067A CN201710705692.3A CN201710705692A CN107385067A CN 107385067 A CN107385067 A CN 107385067A CN 201710705692 A CN201710705692 A CN 201710705692A CN 107385067 A CN107385067 A CN 107385067A
- Authority
- CN
- China
- Prior art keywords
- bulbus fritillariae
- fritillariae cirrhosae
- primer
- probe
- quantitative pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of detection method of the bulbus fritillariae cirrhosae species specificity based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique.This method is using Chinese medicine bulbus fritillariae cirrhosae as detection object, using bulbus fritillariae cirrhosae specific gene sequences as target, design real-time fluorescence quantitative PCR primer, probe, and by establishing standard curve, realize the accurate measure of bulbus fritillariae cirrhosae content in traditional Chinese medicine ingredients.Verify that this method has good stability through laboratory flat plate method, can within 1.5h to Chinese medicine in the bulbus fritillariae cirrhosae of unknown content carry out quantitative detection, there is the advantage such as quick, time saving, easy to operate.
Description
Technical field
The invention belongs to traditional Chinese medicine ingredients molecular recognition technology and applied technical field, and in particular to Chinese medicine bulbus fritillariae cirrhosae is into go-on-go
The molecular biology method of survey, it is a kind of molecular detecting method of the Real-Time Fluorescent Quantitative PCR Technique based on TaqMan probe.
Background technology
Bulbus fritillariae cirrhosae medicinal history is very long, first recorded in《Sheng Nong's herbal classic》, clearing heat and moistening lung, the effect of preventing phlegm from forming and stopping coughing, tool
There is the title of " cough-relieving panacea ".Up to 200 kinds of the Chinese patent drug produced at present using bulbus fritillariae cirrhosae as material according to statistics, but tendril-leaved fritillary bulb is suitably in height
Could well it be grown in cold cool specific environment, not only growth cycle is grown, and yields poorly, and production cost is higher, and through excessive
Year excavation, the destruction Of resources are serious, cause price to rise year by year.And then cause a large amount of substandard products, adulterant to circulate in city, influence clinical treatment
Effect.The difficult identification true and false of ordinary person, very disruptive medicinal material market.
Traditional discrimination method has character differential method, microscopical characters, spectroscopic methodology, thin-layered chromatography.But some of which method
Discriminating personnel are needed to possess very strong professional knowledge and experience, some do not meet the development trend of contemporary TCD identificafion technology then.
In version in 2010《Chinese Pharmacopoeia》In one enlarged edition, bulbus fritillariae cirrhosae PCR-RFLP discriminatings have been increased newly, this method has high sensitivity
With the degree of accuracy it is high the characteristics of.But the bulbus fritillariae cirrhosae of commercial type is mostly to mix adulterant, and this method can only be determined test sample
Property detection, can not intuitively reflect the content of bulbus fritillariae cirrhosae, so a kind of new quantitative detecting method of exploitation is extremely urgent.
In recent years, Real-Time Fluorescent Quantitative PCR Technique is obtained with the advantages that its high specificity, high sensitivity in quantitative context of detection
To a kind of development trend of extensive use, and Chinese traditional medicine molecule detection field.Visited in this patent using more conventional TaqMan
Pin, bulbus fritillariae cirrhosae species specificity real-time fluorescence quantitative PCR detection method is explored, and by establishing standard curve, adulterant is mixed in realization
The accurate measure of middle bulbus fritillariae cirrhosae percentage composition, a kind of precisely efficient method of offer is quantitatively detected to mix bulbus fritillariae cirrhosae in adulterant.
The content of the invention
It is an object of the invention to disclose a kind of bulbus fritillariae cirrhosae of the Real-Time Fluorescent Quantitative PCR Technique based on TaqMan probe
The method of species specificity detection, to achieve the above object, the present invention provides following technical scheme：
This method devises bulbus fritillariae cirrhosae specific primer, probe combinations by analyzing bulbus fritillariae cirrhosae specific sequence,
And by primer, the screening of probe combinations, specific test, the optimization of PCR amplification conditions, sensitivity test, establish standard song
The steps such as line, finally establish the real-time fluorescence quantitative PCR detection method for specific detection bulbus fritillariae cirrhosae content.Wherein it is used for
Primer, the probe of bulbus fritillariae cirrhosae quantitative PCR detection be：
| Title | Sequence 5 ' -3 ' |
| CMB-QF | GTGGAGGAAATCCCTGGGAAT |
| CMB-QR | ATCCCTCGGGAATCAAGAACAT |
| CMB-P | FAM-ACATAACCGCTCAACCGCCCACTACA-BHQ1 |
The method of the real-time fluorescence quantitative PCR detection of specific detection bulbus fritillariae cirrhosae content of the present invention, this method is with river
Fritillaria genomic DNA is template, carries out real-time fluorescence quantitative PCR amplification to bulbus fritillariae cirrhosae genome specificity sequence, passes through foundation
Standard curve, the content of bulbus fritillariae cirrhosae in surveyed Chinese medicine is measured.Comprise the following steps：
(1) plant genome DNA extracts kit is used, bulbus fritillariae cirrhosae genomic DNA is extracted, is test sample DNA profiling, it is dilute
Release standby to 25ng/ μ L.
(2) standard items bulbus fritillariae cirrhosae genomic DNA is subjected to gradient dilution with salmon sperm dna, DNA concentration is respectively
100%th, 50%, 10%, 5% and 1%, establish standard curve.
(3) using above-mentioned primer, probe, performing PCR amplification is entered to test sample DNA profiling, pcr amplification reaction therein
Cumulative volume is 20 μ L, and amplification reaction system is：The μ L of Takara Premix Ex Taq 10,10 μm of ol/L primer upstream and downstreams
Primer each 2.4 μ L, 10 μm of μ L of ol/L probes 1.2, test sample DNA profiling (25ng/ μ L) 2 μ L, distilled water supply 20 μ L；PCR is anti-
Program is answered as 95 DEG C of denaturation 10min；95 DEG C of denaturation 15s, 60 DEG C of annealing extension 60s, carry out 45 circulations altogether；In second stage
Annealing extension (60 DEG C) period collects fluorescence signal.
(4) after reaction terminates, according to calibration curve coefficient correlation R2(R2>=0.98), amplification efficiency E (90%≤E%≤
105%), determine whether standard curve has with reference to value.The content of its bulbus fritillariae cirrhosae is determined according to test sample numerical value afterwards.
In the case where not calculating DNA extraction process and taking, real-time fluorescence quantitative PCR takes the detection method of the present invention
80min, so the detection method of the present invention can complete bulbus fritillariae cirrhosae assay in Chinese medicine within 1.5h and work, have fast
The advantage such as fast, inexpensive, easy to operate.
In order to more clearly illustrate the assay method of the present invention, the test method of the present invention is done with detailed below
Explanation.
1st, principle
Real-Time Fluorescent Quantitative PCR Technique, refer to add fluorophor in PCR reaction systems, accumulated using fluorescence signal
Whole PCR processes are monitored in real time, the method for carrying out quantitative analysis to unknown template finally by standard curve.
Real-Time Fluorescent Quantitative PCR Technique is divided into：The methods of SYBR Green I and TaqMan probe method.Used in this patent
TaqMan probe method.Its principle is：When the Taqman probes for being marked with fluorescein are complete, the fluorescence signal of reporter group transmitting
It is quenched group absorptions；After being mixed with template DNA, 5 ' -3 ' 5 prime excision enzyme activities of Taq enzyme by with template DNA complementary pairing
Taqman probes are cut off, and fluorescein is free in reaction system, fluorescence are sent in the case where specific light excites, with cycle-index
Increase, exponentially rule increases the target gene fragment being amplified, and is changed by detecting corresponding in real time with amplification glimmering
Light signal strength, Ct values are tried to achieve, while compared using the standard items of several known template concentration, you can draw sample to be tested
Content.
2nd, primer, probe design
CBM08 bulbus fritillariae cirrhosae specific sequences are obtained by literature search, carried out using the softwares of Primer Express 3.0
Primer, probe design, design 10 pairs of primers, probe combinations, are synthesized by Suzhou Jin Weizhi bio tech ltd altogether,
3rd, sampling and DNA extractions
Use plant genome DNA extracts kit, extraction bulbus fritillariae cirrhosae, fritillary bulb, Siberian fritillary bulb, Bulbus Fritillariae thunbergii, the rhizoma bolbostemmae, Anhui
Fritillaria genomic DNA, it is test sample DNA profiling, it is standby is diluted to 25ng/ μ L.
4th, the screening of primer, probe
1 set of primer, probe combinations are obtained through screening, for bulbus fritillariae cirrhosae content detection.
The primer of table 1, probe sequence table are as follows：
| Title | Sequence 5 ' -3 ' |
| CMB-QF | GTGGAGGAAATCCCTGGGAAT |
| CMB-QR | ATCCCTCGGGAATCAAGAACAT |
| CMB-P | FAM-ACATAACCGCTCAACCGCCCACTACA-BHQ1 |
5th, primer, probe specificity test
Using screening draw primer, probe combinations, respectively with bulbus fritillariae cirrhosae, fritillary bulb, Siberian fritillary bulb, Bulbus Fritillariae thunbergii, the rhizoma bolbostemmae,
Wan Beijing genomic DNA is that template enters performing PCR amplification, investigates the primer, probe combinations in several fritillarias in addition to bulbus fritillariae cirrhosae
In amplification situation.
6th, the optimization of PCR amplification system
0.1 μm of ol/L, 0.2 μm of ol/L, 0.25 μm of ol/L, 0.3 μm of ol/L, 0.4 μm of ol/L, 0.5 μm of ol/L 6 are set
Concentration and probe concentration gradient, corresponding primer concentration are 2 times of concentration and probe concentration, enter the optimization of performing PCR amplification condition.Finally establish
PCE reaction systems and response procedures：The cumulative volume of pcr amplification reaction is 20 μ L, and amplification reaction system is：Takara Premix
Ex Taq 10 μ L, 10 μm of ol/L primer upstream and downstream primers each 2.4 μ L, 10 μm of μ L of ol/L probes 1.2, test sample DNA profiling
(25ng/ μ L) 2 μ L, distilled water supply 20 μ L；PCR response procedures are 95 DEG C of denaturation 10min；95 DEG C of denaturation 15s, 60 DEG C of annealing are prolonged
60s is stretched, carries out 45 circulations altogether；Fluorescence signal is collected in annealing extension (60 DEG C) period of second stage.
7th, method sensitivity test
The bulbus fritillariae cirrhosae genomic DNA of extraction is subjected to gradient dilution with salmon sperm dna, DNA concentration is respectively 100%,
10%th, 1%, 0.5%, 0.1%, 0.05%, 0.01% and 0%, expanded using the PCR amplification conditions after optimization.Finally
Establishment method sensitivity is 0.05%.
8th, the foundation of standard curve
Bulbus fritillariae cirrhosae genomic DNA is subjected to gradient dilution with salmon sperm dna, DNA concentration is respectively 100%, 50%,
10%th, 5% and 1% standard curve is established.
Brief description of the drawings:
Fig. 1 is primer, the canonical plotting of probe combinations foundation obtained using bulbus fritillariae cirrhosae standard items and screening.From left-hand
The right side is followed successively by 1,100% bulbus fritillariae cirrhosae；2,50% bulbus fritillariae cirrhosae；3,10% bulbus fritillariae cirrhosae；4,5% bulbus fritillariae cirrhosae；5,1% bulbus fritillariae cirrhosae.
Fig. 2 is the test sample testing result figure of 4 unknown bulbus fritillariae cirrhosae contents.1 is followed successively by from left to right, test sample 1；2
Test sample 2；3, test sample 3；4, test sample 4.
Embodiment
In order to more clearly illustrate the method for the present invention, the test method of the present invention is made with specifically below
It is bright.
Embodiment 1
(1) reagent：The Takara Premix Ex Taq solution of TaKaRa companies production；Gold only intelligence biotechnology in Suzhou has
Limit company primer and TaqMan probe；
(2) primer, probe sequence table are as follows：
| Title | Sequence 5 ' -3 ' |
| CMB-QF | GTGGAGGAAATCCCTGGGAAT |
| CMB-QR | ATCCCTCGGGAATCAAGAACAT |
| CMB-P | FAM-ACATAACCGCTCAACCGCCCACTACA-BHQ1 |
(3) sampling and DNA extractions
Take 3 parts of test samples at random from 201607 batch bulbus fritillariae cirrhosaes, using plant genome DNA extracts kit, carry
Take bulbus fritillariae cirrhosae genomic DNA.
(4) standard curve is established
Standard items bulbus fritillariae cirrhosae genomic DNA is subjected to gradient dilution with salmon sperm dna, DNA concentration is respectively 100%,
50%th, 10%, 5% and 1%, establish standard curve.
(5) real-time fluorescence quantitative PCR expands
Using above-mentioned primer, probe, enter performing PCR amplification to test sample DNA profiling, pcr amplification reaction therein it is total
Volume is 20 μ L, and amplification reaction system is：The μ L of Takara Premix Ex Taq 10,10 μm of ol/L primer upstream and downstreams draw
Thing each 2.4 μ L, 10 μm of μ L of ol/L probes 1.2, test sample DNA profiling (25ng/ μ L) 2 μ L, distilled water supply 20 μ L；PCR reacts
Program is 95 DEG C of denaturation 10min；95 DEG C of denaturation 15s, 60 DEG C of annealing extension 60s, carry out 45 circulations altogether；In second stage
Annealing extension (60 DEG C) period collects fluorescence signal.
(6) result judges
The linear equation of standard curve is：Y=-3.251x+31.575, wherein coefficient R 2=0.994, amplification efficiency
E=103.043%, comply fully with coefficient R2>=0.98, amplification efficiency E (90%≤E%≤105%) requirement.Meanwhile
Adulterant is mixed to 3 kinds of bulbus fritillariae cirrhosaes of known percentage composition and has carried out relative quantification test.This 3 kinds relative quantification results point for mixing adulterant
Not Wei 90%, 30% and 6%, the percentage composition of bulbus fritillariae cirrhosae is corresponding when this is with being pre-mixed.
Sequence table
<110>Agriculture In Tianjin quality standard and detection technique research institute
<120>A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique
<160> 3
<210> 1
<211> 21 bp
<212> DNA
<213>Artificial sequence
<400> 1
GTGGAGGAAATCCCTGGGAAT 21
<210> 2
<211> 22 bp
<212> DNA
<213>Artificial sequence
<400> 2
ATCCCTCGGGAATCAAGAACAT 22
<210> 3
<211> 26 bp
<212> DNA
<213>Artificial sequence
<400> 3
ACATAACCGCTCAACCGCCCACTACA 26
Claims (2)
1. primer, probe for the detection of bulbus fritillariae cirrhosae real-time fluorescence quantitative PCR, it is characterised in that visited including 1 pair of primer and 1
Pin, it is respectively：
Upstream primer sequence CMB-QF:5 '-GTGGAGGAAATCCCTGGGAAT-3 ', downstream primer sequence CMB-QR:5’-
ATCCCTCGGGAATCAAGAACAT-3 ', probe sequence CMB-P：5’-FAM-ACATAACCGCTCAACCGCCCACTACA-
BHQ1-3’
2. one kind uses primer, probe described in claim 1, the river of the Real-Time Fluorescent Quantitative PCR Technique based on TaqMan probe
The detection method of fritillaria species specificity, it is characterised in that comprise the following steps：
(1) plant genome DNA extracts kit is used, bulbus fritillariae cirrhosae genomic DNA is extracted, is test sample DNA profiling, is diluted to
25ng/ μ L are standby.
(2) standard items bulbus fritillariae cirrhosae genomic DNA is subjected to gradient dilution with salmon sperm dna, DNA concentration is respectively 100%,
50%th, 10%, 5% and 1%, establish standard curve.
(3) primer, probe described in claim 1 are used, performing PCR amplification is entered to test sample DNA profiling, PCR therein expands
The cumulative volume for increasing reaction is 20 μ L, and amplification reaction system is：The μ L of Takara Premix Ex Taq 10, on 10 μm of ol/L primers
Trip supplies 20 μ with anti-sense primer each 2.4 μ L, 10 μm of μ L of ol/L probes 1.2, test sample DNA profiling (25ng/ μ L) 2 μ L, distilled water
L；PCR response procedures are 95 DEG C of denaturation 10min；95 DEG C of denaturation 15s, 60 DEG C of annealing extension 60s, carry out 45 circulations altogether；
Annealing extension (60 DEG C) period of two-stage collects fluorescence signal.
(4) after reaction terminates, according to calibration curve coefficient correlation R2(R2>=0.98), amplification efficiency E (90%≤E%≤
105%), determine whether standard curve has with reference to value.The content of its bulbus fritillariae cirrhosae is determined according to test sample numerical value afterwards.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710705692.3A CN107385067A (en) | 2017-08-17 | 2017-08-17 | A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710705692.3A CN107385067A (en) | 2017-08-17 | 2017-08-17 | A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN107385067A true CN107385067A (en) | 2017-11-24 |
Family
ID=60353482
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710705692.3A Pending CN107385067A (en) | 2017-08-17 | 2017-08-17 | A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107385067A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109988859A (en) * | 2018-01-02 | 2019-07-09 | 青岛谱尼测试有限公司 | A method of detection indian iphigenia bulb and wheel blade fritillaria ingredient |
| CN110468227A (en) * | 2019-08-15 | 2019-11-19 | 中检科健(天津)检验检测有限责任公司 | A kind of primer, probe and the method for the specific detection mung bean anaphylactogen based on TaqMan probe real-time fluorescence PCR |
| CN114540346A (en) * | 2022-02-28 | 2022-05-27 | 中国食品药品检定研究院 | Probe primer and fluorescent quantitative PCR detection method and application thereof for fritillaria ussuriensis specificity detection |
-
2017
- 2017-08-17 CN CN201710705692.3A patent/CN107385067A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109988859A (en) * | 2018-01-02 | 2019-07-09 | 青岛谱尼测试有限公司 | A method of detection indian iphigenia bulb and wheel blade fritillaria ingredient |
| CN110468227A (en) * | 2019-08-15 | 2019-11-19 | 中检科健(天津)检验检测有限责任公司 | A kind of primer, probe and the method for the specific detection mung bean anaphylactogen based on TaqMan probe real-time fluorescence PCR |
| CN114540346A (en) * | 2022-02-28 | 2022-05-27 | 中国食品药品检定研究院 | Probe primer and fluorescent quantitative PCR detection method and application thereof for fritillaria ussuriensis specificity detection |
| CN114540346B (en) * | 2022-02-28 | 2024-04-16 | 中国食品药品检定研究院 | Probe primer, fluorescence quantitative PCR detection method for fritillary bulb specificity detection and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103757134A (en) | Fluorescent quantitative PCR (Polymerase Chain Reaction) detection reagent, kit and detection method for African swine fever virus (ASFV) | |
| CN107385067A (en) | A kind of method of the bulbus fritillariae cirrhosae species specificity detection based on TaqMan probe Real-Time Fluorescent Quantitative PCR Technique | |
| CN108060257A (en) | It is a kind of that strong male rotten mould Primer composition and its detection method are detected based on loop-mediated isothermal amplification technique | |
| CN102154503A (en) | Method for detecting DNA (deoxyribonucleic acid) content of CHO (cholesterol) cells by probe | |
| CN110273027A (en) | Norovirus G I, G II and IV type nucleic acid parting detecting reagent of G and detection method | |
| CN109280711A (en) | LAMP detection primer group, detection kit and its detection method of mycobacterium kansasii | |
| CN106434989B (en) | The LAMP rapid detection method of tobacco brown spot pathogen | |
| CN106148484B (en) | A kind of kit that diagnosis Y chromosome is micro-deleted | |
| CN104673926B (en) | Pine beam thread insect PCR detection kit and its detection method | |
| CN106480201A (en) | Metastasis in Breast Cancer assesses test kit | |
| CN109609632A (en) | Reagent, kit and the application of detection fusion gene | |
| CN103074428B (en) | A kind of mycobacterium tuberculosis TB detection kits | |
| CN106399536B (en) | Body fluid circulatory DNA quantitative detecting method and kit | |
| CN108048589A (en) | The Real-time PCR specific primers and probe and detection kit and detection method of ox two-pressure humidity generator | |
| CN108085397A (en) | Primer and probe and its kit and method based on fluorescence quantitative PCR detection Mandarin fish | |
| CN103215373A (en) | Honey detection composition, kit, detection method and application | |
| CN102994650A (en) | Multi-gene detection method of encephalitis viruses based on capillary electrophoresis | |
| CN102146467A (en) | Reagent for detecting Yersinia pestis and method for carrying out fluorescence quantitative PCR (Polymerase Chain Reaction) detection on Yersinia pestis | |
| CN110396542A (en) | A kind of LncRNA marker and its application in diabetes | |
| CN105420362A (en) | Fluorescent quantitative PCR (polymerase chain reaction) detection primers and kit for Eimeria media-rabbit | |
| CN108085396A (en) | Primer and probe and its kit and method based on fluorescence quantitative PCR detection silvery pomfret | |
| CN106282398B (en) | Citrus anthracnose bacterium and citrus foot rot pathogen double check kit and its application | |
| CN101974621A (en) | LAMP detection method for babesia bovis | |
| CN104894248A (en) | Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) primers for quantitatively detecting tylenchulus semipenetrans as well as probe and application thereof | |
| CN102952887A (en) | Real-time fluorescence PCR (polymerase chain reaction) kit and detection method for detecting Byssochlamys nivea |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WD01 | Invention patent application deemed withdrawn after publication | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20171124 |