CN107385062A - Applications of the YKL 40 as glioblastoma biomarker - Google Patents

Applications of the YKL 40 as glioblastoma biomarker Download PDF

Info

Publication number
CN107385062A
CN107385062A CN201710695815.XA CN201710695815A CN107385062A CN 107385062 A CN107385062 A CN 107385062A CN 201710695815 A CN201710695815 A CN 201710695815A CN 107385062 A CN107385062 A CN 107385062A
Authority
CN
China
Prior art keywords
ykl
glioblastoma
patient
biomarker
prognosis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201710695815.XA
Other languages
Chinese (zh)
Inventor
不公告发明人
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Beijing Kai Sheng Biotechnology Co Ltd
Original Assignee
Beijing Kai Sheng Biotechnology Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Beijing Kai Sheng Biotechnology Co Ltd filed Critical Beijing Kai Sheng Biotechnology Co Ltd
Priority to CN201710695815.XA priority Critical patent/CN107385062A/en
Publication of CN107385062A publication Critical patent/CN107385062A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Organic Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Food Science & Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to application of the HC gp-39 (YKL 40) as glioma biomarker.Glioblastoma (Glioblastoma, GBM) patient survival is low, poor prognosis, lacks effective biomarker and monitoring method at present.The mRNA gene expression datas of glioblastoma patient YKL 40 in present invention analysis TCGA (The Cancer Genome Atlas) database, it was found that 40 overall middle positions of YKL expression significantly up-regulation (Fold change=9.483, P ＜ 0.0001).45 IV phase Chinese population glioblastoma clinical samples are further collected, qPCR quantitative analysis YKL 40 is expressed, and is significantly raised with prognosis correlation analysis, 41 mRNA transcriptional levels of patient YKL 40 of discovery, and this some patientss life cycle is short, poor prognosis.The life cycle of the invention analyzed and demonstrate YKL 40 and patient and poor prognosis are closely related, confirm that YKL 40 can be used as potential glioblastoma biomarker, the method monitored using qPCR or protein quantification may indicate that life cycle and the prognosis of glioblastoma cells patient.

Description

Applications of the YKL-40 as glioblastoma biomarker
Technical field
The invention belongs to biomedicine field.It is related to the biomarker YKL40 of Gliblastoma in treatment and pre- The clinical practice monitored afterwards.
Background technology
Effects of the YKL-40 in tumour progression is promoted
HC gp-39 (YKL-40) is the member of chitinase sample glycoprotein family, thin in human osteosarcoma first Found in born of the same parents' strain MG-63 culture[1].Structural analysis shows that YKL-40 includes highly conserved chitin binding structural domain, so And because it in chitinase catalytic domain Glutamic Acid sports leucine, it is functionally lacked as chitinase Ability[2,3].Although YKL-40 physiological action is not fully understood, it is believed that YKL-40 and connective tissue proliferation It is relevant with the activation of vascular endothelial cell[4-6].Increasing clinical evidence shows, YKL-40 unconventionality expression mainly with it is various The pathogenesis of human diseases is relevant.For example, YKL-40 contents raise extremely in serum in chronic inflammation disease[7-11], table Understand its extracellular matrix remodeling function and the correlation of pathology.
Past 10 years, increasing research showed the horizontal rises of serum YKL-40 and breast cancer, colon cancer, oophoroma The low correlation with the survival rate of malignant tumour in brain tissue[12-18], show serum YKL-40 level can be used as diagnosis and The clinical marker thing of prognosis.In addition, YKL-40 can promote the angiogenesis of breast cancer CMEC[19], it is induced Angiogenesis depend on membrane receptor syndecan-1 (Syn-1)2With beta 2 integrin alpha v β 3.There are some researches show, YKL-40 can be with Promote VEGF expression, VEGF and YKL-40 synergies promote tumor vascular generation[72].If continuing antagonism VEGF, The up-regulation that YKL-40 can be caused to express, promote Tumor Angiongesis bounce-back, further promote the invasion and attack of tumour.In addition, tumour is thin Born of the same parents pass through radiotherapy, can also promote YKL-40 expression, so as to promote endothelial cell to generate blood vessel, and produce radiotherapy resistance[72]。
Glioblastoma is most fatal and most aggressive brain tumor, is the tumour of very vascular, has resistance The feature of chemicotherapy[20].There are some researches show YKL-40 is one of albumen that highest is expressed in malignant glioblastoma[21-23]。 In glioblastoma, YKL-40 transcription and protein level are all significantly higher than normal cerebral tissue, transcriptional level and albumen table Up to notable positive correlation between level being present[24]。
The content of the invention
This research obtains glioblastoma patient from TCGA (The Cancer Genome Atlas) database YKL-40 (a kind of secreting type glycoprotein) mRNA microarray datas, using Oncomine Outlier and cBio Portal is analyzed.As a result prompt, compared with normal cerebral tissue, the YKL-40 entirety middle positions expression hair of 542 patients Notable up-regulation (Fold change=9.483, P are given birth to<0.001) (Fig. 1).The low patient of YKL-40mRNA expressions is wherein Position life cycle is 14.19 months, and high patient its median survival interval of YKL-40 expression quantity is 9.86 months (P=0.0747) (Fig. 5).In addition, low middle position progression free survival phase (the 7.49months vs for being advantageous to patient of YKL-40mRNA expressions 4.6months, P=0.214) (Fig. 6).Result of study shows that YKL-40 is overexpressed in the glioblastoma patient of part, Potential Tumor biomarkers can be used as, indicate the prognosis of patient[25]。
In order to further study differences of the YKL-40 in Chinese glioblastoma patients on transcriptional level, originally grind Study carefully and further have collected 45 IV phase glioblastoma clinical samples (WHO grade IV), and 9 as control just Normal brain tissue sample.
This research detects YKL-40 gene transcription levels using the method for quantitative fluorescent PCR relative quantification.Using GAPDH as Reference gene, by the contrast of tumour and normal structure, the change multiplying power of YKL-40 gene transcription levels is calculated.As a result table Bright, in the patient of 9% (4/45), YKL-40mRNA transcriptional level significantly reduces than normal cerebral tissue.Other 91% (41/45) in patient, compared with normal cerebral tissue, significantly up-regulation occurs for YKL-40mRNA transcriptional level, and change multiplying power is 1.7 times to 19375 times (Fig. 2).
The clinical pathologic characteristic of the glioblastoma patient of table 1..
Median (range) orn (%)
Age(years) 49(5-67)
WHOgrade IV 45(100)
Gender Male 32(71)
Female 13(29)
Chemo/radiotherapy + 23(51)
- 22(49)
Follow-upTime(months) 36
Normalbraintissues 9
Table 1
This research further analyze YKL-40mRNA expressions and patient life cycle and prognosis between it is related Property.As a result showing, the life cycle of YKL-40mRNA expressions and patient are in significantly negatively correlated, i.e. YKL-40 expression quantity is higher, Life span shorter (r=0.33, the P of patient<0.05) (Fig. 3).In addition, the higher patient of YKL-40 expression quantity compares YKL-40 The low patient's prognosis of expression quantity worse (13/41vs.4/4, P=0.0389, n=45) (Fig. 4).
In addition to glioblastoma, in the tumours such as liver cancer, colorectal cancer, YKL-40 expression or gene copy Number all there occurs notable up-regulation, shows that YKL-40 plays a significant role (Fig. 7) in the progression of disease of these tumours.
In summary, YKL-40 can be used as glioblastoma biomarker, can also be used as liver cancer, colorectal cancer Etc. the potential source biomolecule mark of tumour, the existence and prognosis of patient are indicated.
Brief description of the drawings
Glioblastoma patient YKL-40 transcriptional level in Fig. 1 .TCGA databases.It is and normal in TCGA databases Brain tissue is compared, and the YKL-40 transcriptional levels of 542 spongiocytoma patients significantly raise.
Transcriptional levels of Fig. 2 .YKL-40 in 45 glioblastoma patients.In this 45 glioblastoma patients In, 4 patient's YKL-40 transcriptional levels are substantially less than normal cerebral tissue, and 41 patient's YKL-40 transcriptional levels are significantly high in addition In normal structure.
Fig. 3 are in 45 glioblastoma patients of collection, YKL-40mRNA transcriptional level and the life cycle of patient In notable negative correlation (r=0.33, P<0.05).
Fig. 4 .YKL-40 transcriptional levels are higher, and the survival of patients time is shorter, the prognosis of patient it is also worse (13/41vs.4/4, P=0.0389, n=45)；
The median survival interval of the high glioblastoma patient of YKL-40 expression quantity is 9.86 in Fig. 5 .TCGA databases Month, the low patient's median survival interval of YKL-40 expression quantity is 14.19 months (P=0.0747, n=604)；
The high glioblastoma patient progression free survival phase of YKL-40 expression quantity is 4.6 in Fig. 6 .TCGA databases Month, the low patient's progression free survival phase of YKL-40 expression quantity is 7.49 months (P=0.214, n=604).
Expression and copy number change of Fig. 7 .YKL-40 (CHI3L1) in kinds of tumors.As a result show, be shown in liver cancer, In melanoma, adenocarcinoma of colon and sarcoma, compared with normal structure, there occurs notable for YKL-40 expression or copy number Up-regulation (P<0.01).
Embodiment
Embodiment 1
TCGA data analyses
The present invention is entered using Oncomine Outlier to the YKL-40 expression quantity of 542 GBM patients in TCGA databases Row analysis.
As a result show, compared with normal cerebral tissue, the YKL-40 expression of 542 spongiocytoma patients in TCGA databases Horizontal significantly rise, foldchange=9.483, P<0.001 (Fig. 1).
Embodiment 2
QPCR45 example Chinese patients crowd verifies
The present invention further have collected by operative treatment and the complete 45 glioblastoma patients of medical history data Lesion resection tissue specimen, oneself is diagnosed as glioblastoma, male 32, female 13 through pathology department；According to WHO tumor grades, The all IV levels of 45 patients.Normal group is woven to normal brain tissue 9, is all from donor.
3rd, RNA extractions, cDNA synthesis
By tumor tissues liquid nitrogen grinding it is broken after, using Trizol reagents extraction method carry out total tissue RNA extractions, then will The total tissue RNA of extraction in time with reverse transcription system by its reverse transcription into cDNA, you can gathered using the method for quantitative fluorescent PCR Analyze gene expression data.
4、qPCR
Primer is synthesized by Shanghai JaRa company.YKL-40 genes and reference gene GAPDH the primer sequences are as follows：
YKL-40：
Forward：GACCACAGGCCATCACAGTCC
Reverse：TGTACCCCACAGCATAGTCAGTGTT
GAPDH：
ForwardAGAAGGCTGGGGCTCATTTG
ReverseAGGGGCCATCCACAGTCTTC
QPCR reactions are carried out using cDNA3.0 μ l.Amplification program is：95 DEG C of 5min, (95 DEG C of 10s, 60 DEG C of 65s) * 40 Circulation.Using SYBR Green as fluorescent marker, in the enterprising performing PCR reaction of ABI7500 fluorescence real-time quantitative PCR instrument, Δ Δ CT methods carry out relative quantification.
As a result show, in 45 glioblastoma patients, 4 patient's YKL-40 transcriptional levels are substantially less than normal brain activity Tissue, 41 patient's YKL-40 transcriptional levels are significantly higher than normal structure (Fig. 2) in addition.
Embodiment 3
The existence of YKL-40 transcriptional levels and patient and relationship with prognosis analysis
Using Excel2013 and GraphPadPrism5.0 to 45 glioblastoma patient's YKL-40 genetic transcription water Flat to be analyzed, the YKL-40 gene chip expressions data from TCGA databases pass through cBio Cancer Genomics Portal is analyzed.
As a result show, in 45 glioblastoma patients of collection, YKL-40mRNA transcriptional level and patient's Life cycle is in notable negative correlation (r=0.33, P<0.05)；YKL-40 transcriptional levels are higher, and the survival of patients time is shorter, patient's Prognosis also worse (13/41vs.4/4, P=0.0389, n=45) (Fig. 4)；The high colloid of YKL-40 expression quantity in TCGA databases The median survival interval of blastoma patient is 9.86 months, and the low patient's median survival interval of YKL-40 expression quantity is 14.19 months (P=0.0747, n=604) (Fig. 5)；The high glioblastoma patient of YKL-40 expression quantity gets nowhere life in TCGA databases The phase is deposited as 4.6 months, the low patient's progression free survival phase of YKL-40 expression quantity is 7.49 months (P=0.214, n=604) (figure 6)。
Embodiment 4
Transcriptional levels and copy number change of the YKL-40 (CHI3L1) in other tumours
YKL-40 gene chip expressions data come from TCGA databases, are then divided by Oncomine Outlier Analysis.
As a result showing, normal structure is compared, in liver cancer, melanoma, adenocarcinoma of colon and sarcoma, YKL-40 transcription There occurs significant up-regulation, P for horizontal or copy number<0.01 (Fig. 7).
Bibliography
1.Johansen JS, Williamson MK, Rice JS et al.Identification of Proteins Secreted by Human Osteoblastic Cells in Culture.Journal of Bone and Mineral Research7,501-512(1992).
2.Renkema GH, Boot RG, Au FL et al.Chitotriosidase, a chitinase, and the 39-kDa human cartilage glycoprotein,a chitin-binding lectin,are homologues of family 18 glycosyl hydrolases secreted by human macrophages.European Journal of Biochemistry 251, 504-509(1998).
3.Fusetti F, Pijning T, Kalk KH et al.Crystal structure and carbohydrate-binding properties of the human cartilage glycoprotein- 39.Journal of Biological Chemistry 278,37753-37760 (2003).
4.Recklies AD, White C, Ling H.The chitinase 3-like protein human cartilage glycoprotein 39 (HC-gp39)stimulates proliferation of human connective-tissue cells and activates both extracellular signal-regulated kinase-and protein kinase beta-mediated signalling pathways. Biochemical Journal 365,119-126(2002).
5.De Ceuninck F, Gaufillier S, Bonnaud A et al.YKL-40 (cartilagegp-39) induces proliferative events in cultured chondrocytes and synoviocytes and increases glycosaminoglycan synthesis in chondrocytes.Biochemical and Biophysical Research Communications 285,926-931(2001).
6.Malinda KM, Ponce L, Kleinman HK et al.Gp38k, a protein synthesized by vascular smooth muscle cells,stimulates directional migration of human umbilical vein endothelial cells.Experimental Cell Research 250,168-173 (1999).
7.Sharif M, Granell R, Johansen J et al.Serum cartilage oligomeric matrix protein and other biomarker profiles in tibiofemoral and patellofemoral osteoarthritis of the knee. Rheumatology 45,522-526(2006).
8.Johansen JS, Christoffersen P, Moller S et al.Serum YKL-40 is increased in patients with hepatic fibrosis.Journal of Hepatology 32,911-920 (2000).
9.Volck B, Johansen JS, Stoltenberg M et al.Studies on YKL-40 in knee joints of patients with rheumatoid arthritis and osteoarthritis.Involvement of YKL-40 in the joint pathology. Osteoarthritis and Cartilage 9,203-214 (2001).
10.Kirkpatrick RB, Emery JG, Connor JR et al.Induction and expression of human cartilage glycoprotein 39 in rheumatoid inflammatory and peripheral blood monocyte-derived macrophages.Experimental Cell Research 237,46-54 (1997).
11.Letuve S, Kozhich A, Arouche N et al.YKL-40 is elevated in patients with chronic obstructive pulmonary disease and activates alveolar macrophages.Journal of Immunology 181,5167-5173(2008).
12.Pelloski CE, Mahajan A, Maor M et al.YKL-40 expression is associated with poorer response to radiation end shorter overall survival in glioblastoma.Clinical Cancer Research 11,3326-3334(2005).
13.Cintin C, Johansen JS, Christensen IJ et al.Serum YKL-40 and colorectal cancer.British Journal of Cancer 79,1494-1499(1999).
14.Cintin C, Johansen JS, Christensen IJ et al.High serum YKL-40 level after surgery for colorectal carcinoma is related to short survival.Cancer 95,267-274(2002).
15.Hogdall EVS, Johansen JS, Kjaer SK et al.High plasma YKL-40 level in patients with ovarian cancer stage III is related to shorter survival.Oncology Reports 10,1535-1538 (2003).
16.Johansen JS, Christensen IJ, Riisbro R et al.High serum YKL-40 levels in patients with primary breast cancer is related to short recurrence free survival.Breast Cancer Research and Treatment 80,15-21(2003).
17.Jensen BV, Johansen JS, Price PA.High levels of serum HER-2/neu and YKL-40 independently reflect aggressiveness of metastatic breast cancer.Clin Cancer Res 9, 4423-34(2003).
18.Bergmann OJ, Johansen JS, Klausen TW et al.High serum concentration of YKL-40 is associated with short survival in patients with acute myeloid leukemia.Clinical Cancer Research 11,8644-8652(2005).
19.Shao R, Hamel K, Petersen L et al.YKL-40, a secreted glycoprotein, promotes tumor angiogenesis.Oncogene28,4456-4468(2009).
20.Wen PY, Kesari S.Malignant gliomas in adults.New England Journal of Medicine 359, 492-507(2008).
21.Tanwar MK, Gilbert MR, Holland EC.Gene expression microarray analysis reveals YKL-40 to be a potential serum marker for malignant character in human glioma.Cancer Research 62,4364-4368(2002).
22.Nigro JM, Misra A, Zhang L et al.Integrated array-comparative genomic hybridization and expression array profiles identify clinically relevant molecular subtypes of glioblastoma. Cancer Research 65,1678-1686 (2005).
23.LalA, LashAE, Altschul SF et al.A public database for gene expression in human cancers. Cancer Research 59,5403-5407(1999).
24.Kazakova MH, Staneva DN, Koev IG et al.Protein and mRNA Levels of YKL-40 in High-Grade Glioma.Folia Biologica 60,261-267(2014).
25.Francescone RA, Scully S, Faibish M et al.Role of YKL-40 in the Angiogenesis, Radioresistance,and Progression of Glioblastoma.Journal of Biological Chemistry 286, 15332-15343(2011).
26.Steponaitis G, Skiriute D, Kazlauskas A et al.High CHI3L1 expression is associated with glioma patient survival.Diagnostic Pathology 11(2016).
27.Vargas AJ, Harris CC.Biomarker development in the precision medicine era:lung cancer as a case study.Nature Reviews Cancer 16,525-537 (2016)。

Claims (6)

1. detect application of the product of HC gp-39 (YKL-40) in the treatment and recurrence monitoring of glioma.
2. application according to claim 1, it is characterised in that the product of the detection YKL-40 includes that YKL- can be quantified The product of 40 gene mRNAs, and/or the product of YKL-40 albumen can be quantified.
3. application according to claim 3, it is characterised in that the reagent that can quantify YKL-40 gene mRNAs includes The primer of the specific amplified YKL-40 genes used in real-time quantitative PCR and digital pcr；The YKL-40 albumen of can quantifying Reagent includes the antibody of specific binding YKL-40 albumen.
4. a kind of instrument for diagnosing glioma, it is characterised in that the instrument includes that YKL-40 gene expression amounts can be detected Instrument.
5. instrument according to claim 4, it is characterised in that the instrument includes that YKL-40 gene mRNAs can be quantified Reagent, and/or the reagent of YKL-40 albumen can be quantified.
6. instrument according to claim 6, it is characterised in that the reagent that can quantify YKL-40 gene mRNAs is real When quantitative PCR and/or digital pcr in the primer of specific amplified YKL-40 genes that uses.
CN201710695815.XA 2017-08-15 2017-08-15 Applications of the YKL 40 as glioblastoma biomarker Pending CN107385062A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201710695815.XA CN107385062A (en) 2017-08-15 2017-08-15 Applications of the YKL 40 as glioblastoma biomarker

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201710695815.XA CN107385062A (en) 2017-08-15 2017-08-15 Applications of the YKL 40 as glioblastoma biomarker

Publications (1)

Publication Number Publication Date
CN107385062A true CN107385062A (en) 2017-11-24

Family

ID=60354540

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201710695815.XA Pending CN107385062A (en) 2017-08-15 2017-08-15 Applications of the YKL 40 as glioblastoma biomarker

Country Status (1)

Country Link
CN (1) CN107385062A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110358827A (en) * 2019-07-09 2019-10-22 中国人民解放军第四军医大学 The preparation of application and its kit of the VMP1 gene in pathological diagnosis glioblastoma
CN113621574A (en) * 2021-08-13 2021-11-09 四川大学华西医院 Human glioblastoma radiotherapy resistant cell strain and application thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110358827A (en) * 2019-07-09 2019-10-22 中国人民解放军第四军医大学 The preparation of application and its kit of the VMP1 gene in pathological diagnosis glioblastoma
CN113621574A (en) * 2021-08-13 2021-11-09 四川大学华西医院 Human glioblastoma radiotherapy resistant cell strain and application thereof
CN113621574B (en) * 2021-08-13 2023-09-01 四川大学华西医院 Cell strain for resisting human glioblastoma radiotherapy and application thereof

Similar Documents

Publication Publication Date Title
CN106834462B (en) Application of gastric cancer genes
AU2015334840B2 (en) Assessment of TGF-beta cellular signaling pathway activity using mathematical modelling of target gene expression
Jacot et al. Actionability of HER2-amplified circulating tumor cells in HER2-negative metastatic breast cancer: the CirCe T-DM1 trial
Birkhahn et al. Predicting recurrence and progression of noninvasive papillary bladder cancer at initial presentation based on quantitative gene expression profiles
Gutierrez-Escolano et al. Dysregulated microRNAs involved in contrast-induced acute kidney injury in rat and human
US8911940B2 (en) Methods of assessing a risk of cancer progression
Tesfai et al. Interactions between acute lymphoblastic leukemia and bone marrow stromal cells influence response to therapy
CN103602724A (en) Methods for determining hepatocellular carcinoma subtype and detecting hepatic cancer stem cells
CN110551819A (en) Application of group of ovarian cancer prognosis related genes
CN104140967A (en) Long noncoding RNA CLMAT1 related with colorectal liver metastasis and application of long non-coding RNA CLAMT1
CN104805197A (en) Method for taking molecular marker in diagnosis and prognosis evaluation of breast cancer
CN107130027A (en) Application of the biomarker in colorectal cancer
CN106350600A (en) Application of LOC80054 in diagnosis or prognosis of pancreatic cancer
Liu et al. lncRNA MEG3 is downregulated in ankylosing spondylitis and associated with disease activity, hospitalization time and disease duration
CN107385062A (en) Applications of the YKL 40 as glioblastoma biomarker
CN106295244B (en) The screening technique of diagnosing tumor marker, the breast cancer Lung metastases related gene obtained in this way and its application
CN109628600A (en) A kind of biomarker for early-stage breast cancer diagnosis
CN110004229A (en) Application of the polygenes as EGFR monoclonal antibody class Drug-resistant marker
Sun et al. Identification of clinical heterogeneity and construction of a novel subtype predictive model in patients with ankylosing spondylitis: An unsupervised machine learning study
WO2010130825A2 (en) New targets for cancer therapy and/or diagnosis and new screening tools
Barsola et al. Circulatory RNA based non-invasive detection and diagnosis of breast cancer
CN109852698A (en) Detect application and the kit of the reagent of 32 expression of ring finger protein
CN103865981B (en) The application of MLH1 gene and the test kit of detection gastrointestinal stromal tumor
CN110998328A (en) Diagnosis and treatment of cancer
Guo et al. microRNA‑10b expression and its correlation with molecular subtypes of early invasive ductal carcinoma

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
CB03 Change of inventor or designer information
CB03 Change of inventor or designer information

Inventor after: The inventor has waived the right to be mentioned

Inventor before: The inventor has waived the right to be mentioned

SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20171124