CN107384882B

CN107384882B - Molecular cloning and identification method of silkworm gene

Info

Publication number: CN107384882B
Application number: CN201710726332.1A
Authority: CN
Inventors: 崔红娟; 赵二虎; 蒋小兰; 张奎; 杨丽群
Original assignee: Southwest University
Current assignee: Southwest University
Priority date: 2017-08-22
Filing date: 2017-08-22
Publication date: 2021-06-29
Anticipated expiration: 2037-08-22
Also published as: CN107384882A

Abstract

The invention belongs to the field of biology, and discloses a molecular cloning and identification method of silkworm genes, wherein the sequences of the silkworm genes are SEQ ID NO: 1; named BmDHODH. According to the invention, the leflunomide is used for treating silkworm cells, and the inhibition effect on BmDHODH expression and cell proliferation is great; as a component in pyrimidine synthesis, BmDHODH is an essential biological enzyme closely related to cell growth and proliferation, and the BmDHODH can possibly become a new gene target for killing lepidoptera pests, provides new insight for ecological friendly pest control, and provides a new target and a theoretical method for developing environment friendly pesticides; as a biological model of lepidoptera pests, the BmDHODH can enrich basic knowledge of the lepidoptera pests for silkworms, and provides a new method for environment-friendly pest control.

Description

Molecular cloning and identification method of silkworm gene

Technical Field

The invention belongs to the field of biology, and particularly relates to a molecular cloning and identification method of silkworm genes.

Background

The silkworm as a typical representative and an ideal biological model of lepidoptera insects plays an important role in promoting the scientific development of animals and is also an important mode for the ecological-friendly pest control. BmDHODH is a dihydroorotate dehydrogenase, which oxidizes dihydroorotate to orotate, a fourth enzyme in the de novo pyrimidine biosynthetic pathway for pyrimidines. First, we cloned and studied the function of BmDHODH in Bombyx mori and found that it was ubiquitously expressed throughout the developmental stage and in nine different tissues. Then, BmDHODH was knocked down at mRNA and protein levels by leflunomide treatment or dsRNA interference in silkworm cells, significantly reducing cell growth and proliferation by inducing cell cycle arrest at G2/M phase. As a component in pyrimidine synthesis, BmDHODH is an essential biological enzyme closely associated with cell growth and proliferation. The basic knowledge of lepidoptera insects can be enriched for silkworm BmDHODH, and a new insight is provided for environment-friendly pest control. In addition, leflunomide, a low molecular weight compound, can specifically inhibit BmDHODH activity, which can lead to a decrease in synthesis of new pyrimidine nucleotides in cells. The silkworm serves as a lepidoptera insect, and is not only an important economic insect in silk production, but also a good lepidoptera insect mode; has wide prospect for the development of environment-friendly pesticide for new genes of silkworms. The current pesticides are typically nerve or respiratory agents such as organophosphates, organochlorines, carbamates and hydrocyanic acid. These organic poisons are harmful to humans, animals and the like, including carcinogenesis, teratogenicity, mutagenicity and chronic or acute poisoning, and are relatively difficult to decompose and excrete, easily concentrated in the organism, and finally cause more serious harm.

In summary, the problems of the prior art are as follows: the existing pesticide has great harm to human, livestock and the like, is difficult to decompose and excrete, and is easy to enrich in organisms.

Disclosure of Invention

Aiming at the problems in the prior art, the invention provides a molecular cloning and identification method of silkworm genes.

The invention is realized in such a way that the sequence of the silkworm gene is SEQ ID NO: 1; named BmDHODH.

The invention also aims to provide a molecular cloning and identification method of the silkworm gene, which comprises the following steps:

step one, RNA extraction, namely extracting total RNA by using a TRIZOL reagent;

step two, identifying the BmDHODH by using a bioinformatics method based on a silkworm genome, an EST database, a CDS database and a Bombyx mori predicted protein database;

thirdly, designing a primer according to the CDS and EST sequences predicted in the SilkDB, and obtaining a BmDHODH fragment through PCR; 3 'and 5' RNA ligase-mediated rapid amplification of cDNA ends using a GeneRacer kit with gene-specific primers to obtain full-length cDNA thereof; all open reading frames were confirmed by PCR; all PCR products were cloned into a simple vector PMD19-T and sequenced;

determining the ORF of BmDHODH in the silkworm by using ORF Finder software; the signal peptide was predicted by SignalP 4.0; predicting the domain using SMART; the amino acid sequences of the BmDHODH are aligned by using a ClustalX program, a phylogenetic tree of the BmDHODH is constructed by using a MEGA 6.0 program through an adjacent connection method, and the BmDHODH is repeated by using 1000 times of guidance;

step five, amplifying three DNA fragments with the lengths of about 473,460 bp and 394bp by PCR; the primers are listed in MEGAScriptTM RNAi kit for synthesizing dsRNA, and the PCR product is used as a template; generating three groups of dsRNA by 1% agarose gel electrophoresis, and detecting the concentration of the dsRNA by adopting a spectrophotometry;

step six, after 6 days of incubation, cells were removed from the embryo block, suspension cells were collected and re-cultured with 3ml Grace's medium supplemented with 20% FBS; after culturing for 6 months again, the cells are successfully differentiated and cultured; the time interval for the first 5 passages was 30 days at a ratio of 1:2, then 10 days, and the cells were successfully subcultured for 60 passages at 5-day intervals;

step seven, dissolving leflunomide in dimethyl sulfoxide (DMSO) as a 200mM stock solution, and treating BmE-SWU3 cells with leflunomide for 96 hours; cell survival was analyzed by trypan blue exclusion assay; one day before transfection, cells were diluted with fresh medium and 2X 10 cells were added⁵Inoculating the individual cells into 24-well culture plates; serum-free transfection with dsRNA was performed using transmessenger (tm) transfection reagent;

step eight, evaluating the cell proliferation activity by using (3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyl) tetrazole bromide assay; cells were plated at 8X 10 per well³The density of the cells was inoculated into a 96-well plate and the proliferation rate was measured; measuring the absorbance value at 560nm with a microplate reader;

step nine, after treating with 10 μ M thymidine analog 5-bromo-2-deoxyuridine for 2 hours, incubating the cells with primary rat antibodies against BrdU for 2 hours, adding secondary antibody for 1 hour, adding 300nM DAPI for counterstaining; cells were mounted in fluorescent mounting media and Image analysis was performed using a nikon microscope with Image-Pro Plus software;

step ten, cell cycle analysis was performed when the cells reached 80% confluence, and the cells were seeded in 6-well culture plates and treated with 100 μ M leflunomide or DMSO; after 96h of treatment, cells were fixed in 70% ethanol and stained with propidium iodide; cells were passed through a FACScan instrument and data analyzed by CellQuest analysis software;

step eleven, protein extracts separated with RIPA lysis buffer were fractionated with SDS-PAGE at the corresponding gel concentrations, and anti-BmDHODH antibodies and anti-tubulin antibodies were purchased from Beyotime;

step twelve, extracting total RNA by using TRIzol Reagent, reversely transcribing 2 mu gRNA of each sample, and amplifying the obtained cDNA; RT-PCR amplification is carried out within 5 minutes at 94 ℃; calculating the expression values of BmDHODH and housekeeping gene actin3mRNA by using quantity One software;

step thirteen, using a StepOnePlusTM real-time PCR system and using SYBR Premix Ex TaqTM II to carry out quantitative real-time PCR;

step fourteen, statistical analysis, and the result is in the average value plus or minus S.D; differences between experimental groups were determined by two-tailed t-test.

Further, in the first step, after digesting the remaining genomic DNA at 37 ℃ for 30 minutes using RNase-free DNase I, first strand cDNA transcriptase was synthesized using 2. mu.g of total RNA in 20. mu.L of the reaction mixture in M-MLV reverse orientation and stored at-20 ℃.

Further, in the twelfth step, RT-PCR amplification, at 94 ℃ for 30 seconds, at 55.5 ℃ for 30 seconds, at 72 ℃ for 1 minute, and at 72 ℃ for 10 minutes, 30 cycles.

Further, the PCR conditions in step thirteen were 95 ℃ for 30 seconds, followed by 40 cycles, 95 ℃ for 5 seconds, 60 ℃ for 30 seconds.

The invention has the advantages and positive effects that: the novel gene BmDHODH of the silkworm is cloned and identified in the silkworm for the first time, and the leflunomide is found to have great inhibition effect on the expression and cell proliferation of the silkworm cell BmDHODH, so that the gene target is a novel gene target for killing lepidoptera pests, provides novel insight for ecological friendly pest control, and provides a novel target and a theoretical method for developing environment-friendly pesticides. Meanwhile, silkworm serves as a promising lepidoptera pest model, and BmDHODH can enrich basic knowledge of lepidoptera insects and provide new insight for environment-friendly pest control. BmDHODH is essentially dihydroorotate dehydrogenase, an iron-containing flavin-dependent mitochondrial enzyme in the silkworm body, a key enzyme in pyrimidine synthesis in nucleic acids, catalyzing the fourth step of reactions in the de novo pyrimidine biosynthetic pathway. The BmDHODH is inhibited, the synthesis of new pyrimidine can be blocked, DNA synthesis is obstructed, and the growth and proliferation of silkworm cells are influenced.

Drawings

FIG. 1 is a flow chart of the molecular cloning and identification method of silkworm genes provided by the implementation of the invention.

FIG. 2 is a list of primers provided in the practice of the invention.

FIG. 3 is a schematic representation of a primer provided by the practice of the present invention.

FIG. 4 is a sequence listing of all primers provided in the practice of the present invention.

FIG. 5 is a schematic representation of an amino acid protein provided by the practice of the present invention.

FIG. 6 is a schematic representation of Lepidoptera, Hymenoptera, and Diptera in accordance with an embodiment of the present invention.

FIG. 7 is a schematic representation of the motif DHO _ dh provided in the practice of the invention.

FIG. 8 is a graphical representation of epidermal, midgut and hemolymph expression provided by practice of the present invention.

FIG. 9 is a schematic representation of protein levels provided by the practice of the invention.

FIG. 10 is a schematic representation of the reduction in cell number provided by the practice of the present invention.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

The following detailed description of the principles of the invention is provided in connection with the accompanying drawings.

The silkworm gene provided by the embodiment of the invention is SEQ ID NO: 1; named BmDHODH.

As shown in fig. 1, the method for molecular cloning and identification of silkworm genes provided by the embodiment of the present invention comprises the following steps:

s101: and (3) extracting RNA, namely extracting total RNA by using TRIZOL reagent. After digesting the remaining genomic DNA with RNase-free DNase I at 37 ℃ for 30 minutes, first strand cDNA transcriptase was synthesized using 2. mu.g of total RNA in 20. mu.L of the reaction mixture in M-MLV reverse orientation and stored at-20 ℃;

s102: identifying the BmDHODH using bioinformatics methods based on Bombyx mori genome, EST database, CDS database and bomyx mori predicted protein database;

s103: designing a primer according to a predicted CDS and EST sequence in the SilkDB, and obtaining a BmDHODH fragment through PCR; 3 'and 5' RNA ligase-mediated rapid amplification of cDNA ends using a GeneRacer kit with gene-specific primers to obtain full-length cDNA thereof; all open reading frames were confirmed by PCR; all PCR products were cloned into a simple vector PMD19-T and sequenced;

s104; determining ORF of BmDHODH in silkworm by using ORF Finder software; the signal peptide was predicted by SignalP 4.0; predicting the domain using SMART; the amino acid sequences of the BmDHODH are aligned by using a ClustalX program, a phylogenetic tree of the BmDHODH is constructed by using a MEGA 6.0 program through an adjacent connection method, and the BmDHODH is repeated by using 1000 times of guidance;

s105: amplifying three DNA fragments with the length of about 473,460 bp and 394bp by PCR; the primers are listed in MEGAScriptTM RNAi kit for synthesizing dsRNA, and the PCR product is used as a template; generating three groups of dsRNA by 1% agarose gel electrophoresis and ensuring the purity of the dsRNA, and detecting the concentration of the dsRNA by adopting a spectrophotometry with dsRed as a control;

s106: after 6 days of incubation, cells were removed from the embryo block, and suspension cells were collected and re-cultured with 3ml Grace's medium supplemented with 20% FBS; after culturing for 6 months again, the cells are successfully differentiated and cultured; the time interval for the first 5 passages was 30 days at a ratio of 1:2, then 10 days, and the cells were successfully subcultured for 60 passages at 5-day intervals;

s107: leflunomide was dissolved in dimethyl sulfoxide as a 200mM stock solution and BmE-SWU3 cells were treated with leflunomide for 96 hours; cell survival was analyzed by trypan blue exclusion assay; one day before transfection, cells were diluted with fresh medium and 2X 10 cells were added⁵Inoculating the individual cells into 24-well culture plates; serum-free transfection with dsRNA was performed using transmessenger (tm) transfection reagent;

s108: (3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyl) tetrazolium bromide assay to assess cell proliferation activity; cells were plated at 8X 10 per well³The density of the cells was inoculated into a 96-well plate and the proliferation rate was measured; measuring the absorbance value at 560nm with a microplate reader;

s109: after 2 hours of treatment with 10 μ M thymidine analog 5-bromo-2-deoxyuridine, cells were incubated with primary rat antibodies to BrdU for 2 hours, followed by addition of secondary antibody for 1 hour, and counterstaining with 300nM DAPI; cells were mounted in fluorescent mounting media and Image analysis was performed using a nikon microscope with Image-Pro Plus software;

s110: cell cycle analysis was performed when cells reached 80% confluence, seeded in 6-well culture plates and treated with 100 μ M leflunomide or DMSO; after 96h of treatment, cells were fixed in 70% ethanol and stained with propidium iodide; cells were passed through a FACScan instrument and data analyzed by CellQuest analysis software;

s111: protein extracts separated with RIPA lysis buffer were fractionated with SDS-PAGE at the corresponding gel concentrations, and anti-BmDHODH antibodies and anti-tubulin antibodies were purchased from Beyotime;

s112: total RNA was extracted using TRIzol Reagent, 2 μ gRNA of each sample was reverse transcribed, and the resulting cDNA was amplified; performing RT-PCR amplification at 94 ℃ for 5 minutes, at 94 ℃ for 30 seconds, at 55.5 ℃ for 30 seconds, at 72 ℃ for 1 minute, and at 72 ℃ for 10 minutes for 30 cycles; calculating the expression values of BmDHODH and housekeeping gene actin3mRNA by using quantity One software;

s113: quantitative real-time PCR was performed using a StepOnePlusTM real-time PCR system with SYBR Premix Ex TaqTM II; PCR conditions were 95 ℃ for 30 seconds followed by 40 cycles, 95 ℃ for 5 seconds, 60 ℃ for 30 seconds;

s114: statistical analysis, and the results are expressed as the mean value +/-S.D; differences between experimental groups were determined by two-tailed t-test.

The application principle of the present invention will be further described with reference to experiments.

Step 1: biological material

The invention uses Chinese silkworm pupa (P50) and stores in the key laboratory of silkworm genome biology country. Feeding fresh mulberry leaves or artificial feed at 25 + -2 deg.C, 60% -90% relative humidity and temperature of 16 hr light/8 hr dark cycle. Specimens were isolated from larvae throughout the development phase and 3 days old 5 instar tissues and stored in liquid nitrogen until use.

Step 2: method of producing a composite material

RNA extraction

Total RNA was extracted using TRIZOL reagent (Life Technology, China) according to the manufacturer's protocol. After digesting the residual genomic DNA at 37 ℃ for 30 minutes using RNase-free DNase I (TaKaRa, Japan), first strand cDNA transcriptase (Promega, USA) was synthesized using 2. mu.g of total RNA in 20. mu.L of the reaction mixture in M-MLV reverse orientation and stored at-20 ℃ according to the protocol provided by the manufacturer.

Prediction of bombyx mori BmDHODH

BmDHODH was identified using bioinformatics methods based on the Bombyx mori genome, EST database, CDS database and Bombyx mori predicted proteins database (http:// www.silkdb.org/Silkdb /). The amino acid sequence of the DHODH gene from Danaus plexippus, Drosophila melanogaster and other species was obtained from NCBI GenBank (http:// www.ncbi.nlm.nih.gov /). DHODH sequences from other species were used as BLAST for queries of silkDB with an E-value threshold of 10-6 (Altschul et al, 1997; Duan et al, 2010) then each putative protein was further validated by domain prediction using SMART (http:// SMART. embl-heidelberg. de /).

Full Length cDNA cloning

Primers were designed based on the predicted CDS and EST sequences in SilkDB, and a fragment of BmDHODH was obtained by PCR. Subsequently, 3 'and 5' RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) was performed using GeneRacer kit (Invitrogen, USA) with gene-specific primers to obtain its full-length cDNA. Finally, all Open Reading Frames (ORFs) were confirmed by PCR. All PCR products were cloned into PMD19-T simple vector (TaKaRa, Japan) and sequenced in Invitrogen (shanghai, china).

Bioinformatics and system analysis

ORF of BmDHODH in silkworm was determined using ORF Finder software (http:// www.ncbi.nlm.nih.gov/gorf. html). The signal peptide was deduced from SignalP4.0 (http:// www.cbs.dtu.dk/services/SignalP). SMART (http:// SMART. embl-heidelberg. de /) was used to predict this domain. Alignment of the amino acid sequences of BmDHODH using the ClustalX program and construction of a phylogenetic tree of BmDHODH by the Adjacent ligation method using the MEGA 6.0 program and repeat with 1000 leads (Teramoto et al, 2007)

dsRNA production

Three DNA fragments of about 473,460 and 394bp in length were amplified by PCR. Primers are listed in FIG. 2.MEGAScript RNAi kit (Ambion, USA) for synthesizing dsRNA with PCR product as template. Three sets of dsRNA were generated and their purity was guaranteed by electrophoresis on a 1% agarose gel and the concentration of dsRNA was detected spectrophotometrically with dsRed as a control.

Preparation of silkworm egg cell

After 6 days of incubation, cells were moved from the embryo mass. The suspension cells were collected and then re-cultured with 3ml Grace's medium (pH6.8) supplemented with 20% FBS. After culturing for another 6 months, the cells were successfully differentiated and cultured. The time interval for the first 5 passages was 30 days at a ratio of 1:2, then 10 days. Most cells are round in morphology and smaller than the BmE cell line, spindle cells can round at 80% confluence. Cells were successfully subcultured for 60 passages at 5 day intervals. The suspension cells were prepared from Juan Tan in the laboratory (data not published). This was tentatively named BmE-SWU3 cells. BmE-SWU3 cells were grown in 25 ℃ T flasks for three days in Grace medium (GIBCO BRL) supplemented with 10% fetal bovine serum (FBS; Invitrogen) and 1% penicillin-streptomycin (P/S) at 27 ℃.

Drug therapy and transfection

Leflunomide (Sigma, USA) was dissolved in dimethyl sulfoxide (DMSO) as a 200mM stock solution. BmE-SWU3 cells were treated with leflunomide (100. mu.M) for 96 hours, with DMSO as a control. Cell survival was analyzed by trypan blue exclusion assay. In addition, two sets of dsRNA were used to knock down BmDHODH, dsRed as a control. The day before transfection, cells were diluted with fresh medium and 2 × 105 cells were seeded into 24-well culture plates. Serum-free transfection with dsRNA was performed using TransMessenger (TM) transfection reagent (QIAGEN, Germany) as described by the manufacturer. The optimal ratio of dsRNA to TransMessenger Reagent (μ g/. mu.L) is 1: 2.5.

Cell proliferation assay

Cell proliferation activity was assessed using a (3- (4, 5-dimethylthiazol-2-yl) -2, 5-diphenyl) tetrazolium bromide (MTT) assay (Sigma, USA). Cells were seeded into 96-well plates at a density of 8 × 103 cells per well, and then proliferation rates were measured. The absorbance values were measured at 560nm with a microplate reader. Each experiment was performed at least three times independently.

BrdU staining

After 2 hours of treatment with 10 μ M thymidine analog 5-bromo-2-deoxyuridine (BrdU) (Sigma, USA), cells were incubated with primary rat antibody against BrdU (Abcam, USA) for 2 hours, followed by addition of appropriate secondary antibody for 1 hour, and counterstaining with 300nM DAPI (Beyotime, China). Cells were mounted in fluorescent mounting media (Beyotime, China) and Image analysis was performed using a nikon microscope with Image-Pro Plus software.

Cell cycle assay

Cell cycle analysis was performed when cells reached 80% confluence. Cells were seeded in 6-well culture plates and treated with 100 μ M leflunomide or DMSO. After 96h of treatment, cells were fixed in 70% ethanol and then stained with Propidium Iodide (PI) (Beyotime, China). Cells were passed through a FACScan instrument (BD BioSciences) and data analyzed by CellQuest analysis software.

Western blotting method

Protein extracts separated with RIPA lysis buffer were fractionated by SDS-PAGE at the corresponding gel concentration. anti-BmDHODH antibodies (prepared by zoonobio Biotechnology) and anti-tubulin antibodies were purchased from Beyotime.

RNA extraction and semi-quantitative RT-PCR analysis

Total RNA was extracted using TRIzol Reagent (Life Technology, China) according to the manufacturer's protocol. Then 2. mu.g RNA of each sample was reverse transcribed, and the resulting cDNA was amplified. RT-PCR amplification was performed at 94 ℃ for 5 min, at 94 ℃ for 30 sec, at 55.5 ℃ for 30 sec, at 72 ℃ for 1 min, and at 72 ℃ for 10 min for 30 cycles. The quantitative One software was used to calculate the values of BmDHODH and housekeeping gene actin3mRNA expression. Relative expression levels were calculated after normalization with reference to quantification of actin3mRNA expression. The primer used is shown in figure 3.

Quantitative real-time PCR (qRT-PCR)

Quantitative real-time PCR (qRT-PCR) was performed using the StepOnePlusTM real-time PCR system (Applied Biosystems) with SYBR Premix Ex TaqTM II (TaKaRa, Japan). PCR conditions were 95 ℃ for 30 seconds, followed by 40 cycles, 95 ℃ for 5 seconds, and 60 ℃ for 30 seconds. Primers for all genes are listed in FIG. 4. Action 3 was used as a control. Relative gene expression levels were calculated by the 2 Δ Ct method (Livak and schmitgen, 2001).

Statistical analysis

Duplicate determinations were performed, and the results were expressed as mean ± s.d. Differences between experimental groups were determined by two-tailed t-test. P <0.05 was considered statistically significant.

And step 3: results

Cloning and characterization of Bombyx mori BmDHODH

Complementary DNA (cDNA) of BmDHODH was obtained using PCR amplification and Rapid Amplification of CDNA Ends (RACE), and the results were confirmed by amplification of the Open Reading Frame (ORF). The full-length cDNA sequence of BmDHODH was 1339bp, including 1173bp ORF encoding a protein of 390 amino acids, 93bp 5'UTR and 73bp 3' UTR (FIG. 5A). They all cluster on nscaf3032, which is located on chromosome 26 in the genome of silkworm. The BmDHODH amino acid sequence contains a DHO _ dh domain with a transmembrane domain at the N-terminus (fig. 5B and S1). In addition, to predict potential signal peptides of the BmDHODH protein, the presence and position of signal peptide cleavage sites in the BmDHODH sequence were predicted using SignalP 4.0. The Y value output by SignalP is used to identify signal peptides from non-signal peptides. As shown in the figure. 1C, the BmDHODH sequence does not contain any cleavage site, which means that it belongs to a non-secreted protein.

(FIG. 5) A. Gene structure of BmDHODH in silkworm. Exons and introns are represented by brown boxes and solid black lines, respectively. The 5 'and 3' UTRs are indicated by blue boxes.

Putative structural protein domains of bmdhodh. This domain is predicted by SMART.

C. The signal peptide predicts BmDHODH. The result is generated by the SignalIP 4.2 server.

Phylogenetic analysis of DHODH homologs

In order to investigate the evolutionary relationship between silkworms and other species, phylogenetic trees aligning amino acid sequences were constructed from different species using MEGA 6.0. Phylogenetic analyses have shown that DHODH is conserved from invertebrates and vertebrates, but its members can still be divided into two classes, vertebrate (including mammal, Aves, Pisce, Amhibia) and invertebrate (insect). Insecta can also be divided into three separate subgroups: lepidoptera, hymenoptera and diptera (fig. 6). The BmDHODH is expected to be aggregated into lepidopteran subgroups. It is most closely related to diamondback moth (Plutella xylostella), Papilio polytes, Papilio Machaon, Papilio xuthus (which forms clades) (FIG. 6).

The phylogenetic tree of DHODH is built by the adjacency method. The number of individual branches represents the percentage of 1000 bootstrap iterations supporting the branch, omitting values below 60%.

Amino acid sequence alignment of BmDHODH homologs

The Open Reading Frame (ORF) of DHODH from Plutella xylostella, the amino acid sequence 390a (PxDHODH), 392aa (PpDHODH), 392aa (PmDHODH), 392aa (PxuDHODH) encoded by Plutella xylostella, Papilio polytes, Papilio machaon, Papaio xutus, respectively. The results show that BmDHODH has 70%, 67%, 67%, 67%, BmDHODH and other DHODH sequences. These sequences show a high degree of identity to the BmDHODH sequence and contain the highly conserved motif DHO _ dh (fig. 7). Secondary structure analysis using SMART homologues showed that they all contained possible N-terminal transmembrane domains with amino acid positions 12-29 (PxDHHODH) and 13-30(BmDHODH, PpDHODH, PxuDHODH PmDHODH) (FIG. 7).

Multiple alignments of DHODH amino acid sequences from diamondback moth (PxDHHODH, XP _011556582.1), Papilio polytes (PpDHODH, XP _013138102.1), Papilio machaon (PmDHODH, XP _014361985.1), Papilio xuthus (PxuDHODH, KPJ 04273.1). Identical amino acids and amino acids divided into more than four sequences are highlighted in black and grey, respectively.

Expression profile of BmDHODH in silkworm

An expression sequence tag (ETS) database is analyzed from 3-day-old and 5-year-old silkworm larvae, and BmDHODH is found to be highly expressed in tissues such as testis, ovary, head, silk gland and the like. However, its expression was relatively low in epidermis, midgut and hemolymph, moderate in fat and rather low in ointment tubes (fig. 8A). The results were confirmed by RT-PCR (FIG. 8B). Next, the expression profile of BmDHODH at different developmental stages was analyzed. The results indicate that BmDHODH is normally expressed throughout the developmental stages. The expression level of BmDHODH in pre-molting stage was higher than that in other corresponding stages (FIG. 8C). The value of the BmDHODH expression is calculated by using Quantity One software.

(FIG. 8) A. the expression level of BmDHODH was produced from a 3-day-old 5-instar larva tissue based on the EST database of silkworms.

B. Expression levels of BmDHODH were obtained from 3-day-old 5-instar larval tissues by RT-PCR, and actin3 was used as a control. A and B: te: a testis; and Ov: the ovary comprises the following steps: the first method comprises the following steps: fat body Ep: rice husk: the middle intestine ha: hemolymph horses: horse tube Si: the silk gland.

C. Expression profiling of BmDHODH was performed by RT-PCR using actin3 as a control throughout the development stage of silkworm larvae. 1-3: day 1 to day 3; 4: pre-molting at age 1; 5: day 2 to day 2; 7: pre-molting at 2 years old; 8-10: day 3 to day 3; 11: pre-molting at 3 years old; 12-15: day 4, day 1 to day 4; 16: pre-molting at 4 th instar; 17-23: day 5 to day 7. Data represent mean ± SD of at least three independent experiments.

Knock-out BmDHODH inhibits cell growth and proliferation by G2/M cell cycle arrest

The function of BmDHODH in silkworm is further studied. DsRNA interference was used to knock down BmDHODH expression. BmDHODH expression levels were detected by RT-PCR analysis and western blot, and dsRed was used as a control. As predicted, dsRNA #1 or dsRNA #2 significantly reduced BmDHODH mRNA and protein levels compared to dsRed control (FIGS. 9A and B). Upon knockdown of BmDHODH by dsRNA interference, cell morphology or trypan blue assay showed a significant reduction in cell number (fig. 9C and S2). BrdU staining assays also showed that the BrdU positive signal in either dsRNA #1 or dsRNA #2 treated groups was much lower than in dsRed treated groups (fig. 9D). In conclusion, down-regulation of BmDHODH expression by dsRNA interference significantly inhibited cell growth and proliferation in BmE-SWU3 cells.

As shown in fig. 5. 5E, interference with knockdown of BmDHODH by dsRNA resulted in accumulation of BmE-SWU3 at G2/M phase in cells. Statistical analysis showed that the differences were statistically significant. The results were also confirmed by qRT-PCR analysis of the relevant cell cycle regulators. Cdk2 and cyclin B levels were significantly reduced following BmDHODH knockdown, with relative increases in cyclin A, cyclin D and cyclin E (FIG. 9F). In conclusion, knockdown of BmDHODH by dsRNA interference leads to accumulation of G2/M phase cells by reducing certain cell cycle factors that regulate G2/M phase progression in BmE-SWU3 cells. (FIG. 9) A. BmDHODH was knocked out of BmE-SWU3 cells by dsRNA interference for 48 hours, and then RT-PCR was performed to detect the expression level of BmDHODH mRNA using actin3 as a control.

B. Through dsRNA interference for 48 hours, the expression level of BmDHODH protein is detected by Western blot after BmDHODH knockouts BmE-SWU3 cells, and tubulin is used as a control.

Morphological examination of BmE-SWU3 cells was shown 48h after dsRNA interference, with dsRed as a control. Scale bar, 50 μm.

D. Cells were grown on coverslips and 48 hours after dsRNA interference, respectively, dsRed was used as a control. Cells were stained with antibody against BrdU and re-stained with DAPI, scale bar, 100 μm. BrdU positive cells were counted randomly under the microscope for at least 10 fields.

E. After interfering with BmDHODH knockdown by dsRNA in BmE-SWU3 cells, cell cycle was analyzed by FACS assay and dsRed was used as a control. FL 2-A: fluorescence plus area; an X axis: the intensity of fluorescence; y-axis: the number of cells was tested.

F. After 48 hours of dsRNA #1 or dsRNA #2 interference, qRT-PCR analysis was performed in BmE-SWU3 cells and dsRed was used as a control.

In D, E and F, Data represents the mean ± SD of at least three independent experiments. Statistical analysis was performed using a 2-tailed student's t-test, p <0.05, p <0.01, p < 0.001.

Leflunomide also reduces cell growth and proliferation by inhibiting the expression of BmDHODH

To determine the effect of the DHODH inhibitor leflunomide on cell growth and proliferation, cell morphology was first observed after leflunomide treatment, followed by trypan blue assay. The results showed a significant reduction in cell number, over 50% reduction in cells (fig. 10A and S3). MTT assays were also performed and showed significant inhibition of cell growth by leflunomide compared to the DMSO group (FIG. 10B). In addition, using the BrdU staining assay, it was shown that the BrdU positive cells were less in the leflunomide-treated group than in the DMSO-treated group (fig. 10C), indicating that leflunomide significantly inhibited the cell proliferation of BmE-SWU3 cells. Taken together, these data show that leflunomide reduces cell growth and proliferation of BmE-SWU3 cells. As shown in fig. 5. Leflunomide treatment caused the accumulation of G2/M phase cell cycles in BmE-SWU3 cells. Statistical analysis showed that after leflunomide treatment, the cell cycle was arrested and showed significant differences.

The mechanism of leflunomide inhibition was further investigated. The expression of BmDHODH after leflunomide treatment is detected by adopting an RT-PCR and western blot method. The results showed that not only BmDHODH mRNA levels but also the protein levels were significantly reduced (FIG. 10E). In addition, the expression level of relevant cell cycle regulators was checked by qRT-PCR. The results show a significant decrease in cdk2 and cyclin B mRNA levels and an increase in cyclin a, cyclin D and cyclin E levels compared to DMSO-treated cells (fig. 10G). In conclusion, down-regulation of BmDHODH by leflunomide leads to accumulation of G2/M phase cells by reducing certain cell cycle factors that regulate G2/M phase progression. These findings, along with the above results, indicate that leflunomide can reduce cell growth and proliferation by inhibiting the expression of BmDHODH in BmE-SWU3 cells.

(FIG. 10) A. after 96 hours of treatment with 100. mu.M leflunomide, a morphological examination of BmE-SWU3 cells was shown, with DMSO as a control. Scale bar, 50 μm.

B. Cell growth was measured every 2 days by MTT assay after treatment with 100 μ M leflunomide, using DMSO as a control.

C. Cells were grown on coverslips and treated with 100 μ M leflunomide or DMSO, respectively, for 96 hours. Cells were stained with antibody against BrdU and re-stained with DAPI, scale bar, 100 μm. BrdU positive cells were counted randomly under the microscope for at least 10 fields.

D. Leflunomide blocked the cell cycle at the G2/M phase of BmE-SWU3 cells after 96 hours of treatment with 100. mu.M leflunomide, with DMSO as a control. Cell cycle was analyzed by FACS assay. FL 2-A: fluorescence plus area; an X axis: the intensity of fluorescence; y-axis: the number of cells was tested.

E. After 96 hours of treatment with leflunomide (10. mu.M, 50. mu.M, 100. mu.M), RT-PCR was performed to measure the expression level of BmDHODH mRNA in BmE-SWU3 cells, and actin3 was used as a control.

F. Western blot assay was performed and BmDHODH protein expression levels in BmE-SWU3 cells were determined 96 hours after treatment with leflunomide (10. mu.M, 50. mu.M, 100. mu.M) using tubulin as a control.

qRT-PCR analysis was performed in BmE-SWU3 cells after 96 hours of treatment with 100. mu.M leflunomide. DMSO was used as a control.

In C, D and G, each bar represents the mean ± SD of three independent experiments. Statistical analysis was performed using a 2-tailed student's t-test, p <0.01, p < 0.001.

And 4, step 4: DHODH converts dihydroorotate to orotate, and other enzymes modify orotate to produce pyrimidine. It has been found that at least 11 mutations in DHODH cause miller syndrome, most of which have only single amino acid mutations (Ng et al, 2010). However, the mechanism of miller syndrome is not yet clear (Ng et al, 2010). Denovo pyrimidine biosynthesis is essential for rapid cell proliferation of human T cells, and therefore DHODH small molecule inhibitors may constitute an attractive therapeutic approach to the treatment of autoimmune diseases and immunosuppression (Liu et al, 2010).

The putative BmDHODH in the Bombyx mori is searched by a bioinformatics method, and BGIBMGA011887-TA is identified as a potential target. BmDHODH was first cloned and characterized using PCR amplification and RACE methods and was found to contain a DHOD-2-like domain, the TIM phosphate binding superfamily, the conserved protein domain family PRK05286 and the transmembrane domain from the reverse leaves and verterbrates. The data show that BmDHODH is usually expressed in silkworms and has a peak at the molting stage, which means that BmDHODH may be associated with an increased metabolic rate at the molting stage.

dsRNA interference was found to inhibit cell growth and proliferation. It induces cell cycle arrest in the G2/M phase and a significant decrease in cyclin B and cdk2, which are determinants of G2/M turnover in the cell cycle (Elridge, 1996; King and Cidlowski, 1998). These results indicate that BmDHODH controls the expression of several genes involved in the proliferation of silkworm cells, such as cyclin B and cdk 2. There are two domains in the human DHODH gene, including an α/β -barrel domain containing the active site and an α -helical domain that forms a tunnel opening to the active site. Leflunomide has been shown to bind in this tunnel (Liu et al, 2010). Leflunomide is therefore useful as a DHODH specific inhibitor. Similarly, leflunomide also induced cell cycle arrest in the G2/M phase with a significant decrease in cyclin B and cdk 2. Of particular interest, leflunomide significantly inhibited BmDHODH expression. It has previously been shown that leflunomide inhibits de novo pyrimidine synthesis, leading to cell cycle arrest in prostate and malignant prostate epithelial cells (Lamb et al, 2015). These findings, together with the above results, suggest that leflunomide may inhibit cell proliferation, down-regulation of BmDHODH.

As a component in pyrimidine synthesis, BmDHODH is an essential biological enzyme closely related to the growth and proliferation of silkworm cells. Therefore, the BmDHODH can be used as a gene target for developing and killing lepidoptera pests, and provides a new target and a theoretical method for developing environment-friendly pesticides. Meanwhile, silkworm serves as a promising lepidoptera pest model, basic knowledge of the lepidoptera pest can be enriched for BmDHODH, and meanwhile, new insight is provided for environment-friendly pest control.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.

<110> university of southwest

<120> molecular cloning and identification method of silkworm gene

<160> 1

<210> 1173

<211> length of sequence

<212> DNA

<213> Artificial sequence

<400> nucleotide sequence

ATGTCGCAGAAGAAAGACCCTTTGAAAAAAATTAGATCCCTTTGTTATGTGACAATCGGAGGAGCTATCGCCTACCAGTATATTTATTACAAGAAGGACTTTAACAGTTATTACGAGAACGCCCTCCAACCTCTCAGTCAGTATCTGAGTCCTGAAGTCGCTCATCGAATCGGAGTGGCAGCGATCAAACACGGACTATTTCCACCTGATCAAAATGAAGACCCAAAGATTTTAAAAACAAGATTGCTTGACTACGACCTAAGCAATCCACTTGGCATAGCCGCCGGGTTCGACAAGCACGGAGACGCGGTCGTGGGCCTGATGAAACTGGGCTTCTCGATCATCGAAGTGGGCTCGGTCACGCCGCAGCCGCAGCCCGGGAATCCCAAGCCGAGGGTCTTCCGACTCCCGGAGGACGGAGCCGTCATCAACAGATATGGCTTCAACAGCATAGGGCACGACGAAGTATACAAAAAGCTGGAAGGAATCGAGAAGGCCGTAATGAATCGGGCACTCCTCGGCGTGAATCTGGGAAAGAATAAGCTCTCCGATGATGCAGGGAAGGATTATGTGTCCGGCATTGAAAAGTTCTCGGATGTGGCTGATTATTTTGTTGTGAACGTTAGCAGCCCTAACACCCCCGGCCTGAGATCATTACAAAACAAGAACGAACTAGAAAACTTATTGACCGAAATAAACAGAGCTAGAAAACGGCGGAACTCGAACAAGCCGCTGCTCCTCAAACTGGCTCCGGACCTGAACGAGGACGAGCTAAAAGACGTGGTCAATGTCATTGGCAAACAGCACAGCAAGGTTGACGGCCTGATCATATCGAACACGACCGTCGAGAGGCAGAGCCTCAAGAATAAGGAGTTTGTGAACGAACCGGGCGGCCTGAGCGGGAAGCCGCTGACCAACAGATCTACGGAGATGATCAGGGACGTGTACAGATTAACTAAAGGTAAAGTTCCGATAATAGGAGTAGGGGGAGTGTTCACGGGGCGTGACGCGTATGAGAAGATCCTGGCGGGCGCCGGCGCCGTGCAAGTGTACACCGCGCTCATCTACCACGGACCTCCGGTCGTGAGGAGGATAAAGGACGAACTGGCCGAGCTACTAGAGAGGGA

CGGATATACTTCCGTCAATGACGCCGTCGGTAAAGGAGTTAAATAG

Claims

1. A molecular cloning and identification method of silkworm genes is characterized in that the sequences of the silkworm genes are SEQ ID NO: 1; is named as BmDHODH;

the molecular cloning and identification method of the silkworm gene comprises the following steps:

the primer is as follows:

BmDHODH-qR T-F GGCTTCAACAGCATAGGGC

BmDHQDH-qR T-R CAGCCACATCCGAGAACTTTT

determining the ORF of BmDHODH in the silkworm by using ORF Finder software; the signal peptide was predicted by signalp4.0; predicting the domain using SMART; the amino acid sequences of the BmDHODH are aligned by using a ClustalX program, a phylogenetic tree of the BmDHODH is constructed by using a MEGA 6.0 program through an adjacent connection method, and the BmDHODH is repeated by using 1000 times of guidance;

step five, amplifying three DNA fragments of 473 bp, 460 bp and 394bp in length by PCR; the primers are listed in MEGAScriptTM RNAi kit for synthesizing dsRNA, and the PCR product is used as a template; generating three groups of dsRNA by 1% agarose gel electrophoresis, and detecting the concentration of the dsRNA by adopting a spectrophotometry;

the primer is as follows:

dsRNA#1dsRNA#1-F GTAATACGACTCACTATAGGGAGAACAACTACAATGTCGCAGAA

dsRNA#1-R GTAATACGACTCACTATAGGGAGA TTCGTCGTGCCCTATGCT

dsRNA#2dsRNA#2-F GTAATACGACTCACTATAGGGAGA TCGACAAGCACGGAGAC

dsRNA#2-R GTAATACGACTCACTATAGGGAGAAGCCAGTTTGAGGAGCAG

dsRed dsRedF GTAATACGACTCACTATAGGGAGAATGG TGAGCAAGGGCGA

dsRedR GTAATACGACTCACTATAGGGAGA TTACTTGTACAGCTCGTCCATG

step twelve, extracting total RNA by using TRIzol Reagent, reversely transcribing 2 mu g of RNA of each sample, and amplifying the obtained cDNA; RT-PCR amplification is carried out within 5 minutes at 94 ℃; calculating the expression values of BmDHODH and housekeeping gene actin3mRNA by using quantity One software;

thirteen, using a StepOnePlusTM real-time PCR system and SYBR Premix Ex TaqTMII to carry out quantitative real-time PCR;

2. The method of claim 1, wherein after digesting residual genomic DNA with DNase I without RNase at 37 ℃ for 30 minutes in the first step, first strand cDNA transcriptase is synthesized using 2. mu.g of total RNA in 20. mu.L of reaction mixture in M-MLV reverse direction and stored at-20 ℃.

3. The method for molecular cloning and identification of silkworm genes according to claim 1, wherein in the step twelve, RT-PCR amplification is performed at 94 ℃ for 30 seconds, 55.5 ℃ for 30 seconds, 72 ℃ for 1 minute, and 72 ℃ for 10 minutes and 30 cycles.

4. The method of claim 1, wherein the PCR conditions in step thirteen are 95 ℃ for 30 seconds, followed by 40 cycles, 95 ℃ for 5 seconds, and 60 ℃ for 30 seconds.