CN107365799A - SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity - Google Patents
SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity Download PDFInfo
- Publication number
- CN107365799A CN107365799A CN201710669628.4A CN201710669628A CN107365799A CN 107365799 A CN107365799 A CN 107365799A CN 201710669628 A CN201710669628 A CN 201710669628A CN 107365799 A CN107365799 A CN 107365799A
- Authority
- CN
- China
- Prior art keywords
- sod2
- plvx
- acgfp1
- fragments
- radiation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Abstract
The invention discloses a kind of SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity, belongs to therapy of tumor technical field, and the carrier is pLVX C9BC‑SOD2‑T2A‑AcGFP1;The chimeric promoters being made up of the CAr G boxes and CMV basal promoters connected have obvious radiation-induced characteristic, the expression of energy effectively start downstream gene under radiation treatment, and can be regulated and controled within the specific limits according to expression of the dose of radiation to downstream gene.Inside and outside experiment proves use in conjunction radiotherapy and SOD2 gene therapies, have radio therapy sensitization effect to tumour cell, can effectively suppress propagation and the growth of tumour cell;There is anti-radiation protection effect to normal cell and tissue simultaneously, reduce the apoptosis rate of normal cell in radiation field size.
Description
Technical field
The present invention relates to therapy of tumor technical field, more particularly to a kind of SOD2 slow virus carriers, construction method and
Its application in targeting radiation protection and tumour enhanced sensitivity.
Background technology
Radiotherapy is one of core technology indispensable in tumour comprehensive therapy, in the Partial controll to tumour, spoke
According to inevitably causing to damage to the normal structure around tumour.To reduce the damage of irradiation normal tissue, irradiation
Dosage and time can be severely limited, also constrain the therapeutic effect of radiotherapy to a certain extent.It is multi-diaphragm collimator, accurate
Technique for fixing, radioprotectant etc. are commonly used to mitigate radioactive damage, but effect is unsatisfactory, and radioprotectant lacks
Targeting, while tumor tissues can also be played a protective role, so as to reduce the effect of radiotherapy.There is also class for radiotherapeutic sensitizer
As problem, while radio therapy sensitization effect is played to tumour, will also tend to strengthen irradiation field in normal structure sensitiveness,
Radiation insult is caused to aggravate.
That is, existing tumour radiotherapy sensitizer and normal structure radioprotectant lack specificity, enhanced sensitivity tumour
When normal tissue injury aggravate, protect normal structure when tumor efficiency decline;Fail to realize in enhanced sensitivity tumour always for many years
The protection of normal tissue.
Gene therapy is the focus of current oncotherapy, by activating tumor suppressor gene, introducing cytotoxic gene, blocking cancer
The strategies such as gene, raising immunogenicity of tumor, change tumor microenvironment play effective tumor-inhibiting action.SOD2 is to be positioned at cell
Intramitochondrial superoxide dismutase, can be important machine of the cell to anti-oxidative damage with the oxygen radical in scavenger-cell
System, it is also regarded as the radioprotectant of definite effect.It is another have multiple studies have shown that, SOD2 has the function that tumor suppressor gene, can press down
The propagation of tumour processed and transfer, and sensitiveness of the tumour cell to radiotherapy can be improved.However, due to lacking targeting at present
The effective gene transfection method of radiation field size and the gene expression of importing is regulated and controled, existed so as to limit SOD2 gene therapies
Clinical popularization and application.
The content of the invention
An object of the present invention, in that a kind of expression vector to solve the above problems is provided, realizes targeting
Tumour radiotherapy enhanced sensitivity and normal structure protection.
To achieve these goals, the technical solution adopted by the present invention is such:A kind of SOD2 slow virus carriers, it is described
Carrier is pLVX-C9BC-SOD2-T2A-AcGFP1。
The promoter region of Egr-1 genes contains 6 CArG boxes, and the region is radiation-induced regulating and controlling sequence, can directly be felt
Stimulated by irradiation.The chimeric promoters containing CArG boxes are built, background expression can be reduced with the starting efficiency of optimal startup.
By building the radiation inducible chimeric promoters of downstream connection SOD2 genes, it is expected to by controlling irradiation dose and time pair
The expression of SOD2 genes carries out accuracy controlling, the characteristics of assigning the restricted expression of SOD2 gene therapy space-times.
The second object of the present invention, it is to provide a kind of construction method of above-mentioned SOD2 slow virus carriers, the technology of use
Scheme is to comprise the following steps:
(1) CArG is synthesized9, CMV basic promoter chimeric promoters C9BC genetic fragments, the C9BC genetic fragments
Cla I restriction enzyme sites are contained in upstream, and Xho I restriction enzyme sites are contained in downstream;
(2) Cla I, Xho I double digestion slow virus carrier pLVX-AcGFP1-N1, by original carrier framework CMV promoter
Remove;Cla I, Xho I double digestions close genetic fragment entirely, obtain radiation-induced promoter C9BC;By C9BC promoters, which are connected to, cuts
Except the pLVX-AcGFP1-N1 fragments of CMV promoter, pLVX-C is obtained9BC-AcGFP1-N1;
(3) using cDNA as template amplification SOD2 full genome fragments, the full genome fragment sequence containing kozak, SOD2 upstreams contain
There are Xho I restriction enzyme sites, BspT104I restriction enzyme sites are contained in downstream;Xho I, BspT104 I double digestions pLVX-C9BC-
AcGFP1-N1, remove part MCS sequences;Xho I, BspT104 I double digestion SOD2 amplified fragments, obtain SOD2 sequence fragments;
Gained SOD2 sequence fragments are connected to pLVX-C9BC-AcGFP1-N1 endonuclease bamhis, obtain pLVX-C9BC-SOD2-AcGFP1;
(4) two complementary T2A aligning primers are synthesized, BspT104 I restriction enzyme sites are contained in the primer upstream, and downstream is contained
Apa I restriction enzyme sites, it is standby after complementary primer annealing;BspT104 I, Apa I double digestions pLVX-C9BC-SOD2-AcGFP1,
Obtain and remove part MCS fragments;
(5) pLVX-C obtained by Connection Step (3)9T2A fragments obtained by BC-SOD2-AcGFP1 fragments and step (4),
Obtain pLVX-C9BC-SOD2-T2A-AcGFP1。
The third object of the present invention, it is to provide above-mentioned SOD2 slow virus carriers in targeting radiation protection and tumour enhanced sensitivity
In application.
Compared with prior art, the advantage of the invention is that:
1. experiment in vitro shows that the SOD2 gene overexpressions for radiating conduct have sensitization tumour cell and protection normal cell concurrently
" double effect ", sensitiveness of the colon cancer cell to radiation can be dramatically increased, cause tumor cell proliferation, growth slow down, wither
Die rate increase;There is anti-radiation protection effect to normal cell, reduce the apoptosis rate after normal cell irradiation.
Shown in the experiment of 2.BALB/c transplanted tumor in nude mice, the SOD2 for radiating conduct is overexpressed slow virus carrier injection transplantation
Knurl, after applying routine clinical dose irradiation, sensitiveness of the transplantable tumor to radiation is significantly increased, and to knurl week normal skin group
Knit and play anti-radiation protection effect.
Brief description of the drawings
Fig. 1-1 and 1-2 is that 48h HT-29 surely turn a plant SOD2 expression changes after 6Gy irradiates:
In figure, Normal:Normal group, pLVX-C9BC-SOD2-T2A-AcGFP1 is not expressed, does not apply treatment with irradiation;
SOD2:Stable expression pLVX-C9BC-SOD2-T2A-AcGFP1, does not apply treatment with irradiation;Normal+R:Normal group receives 6Gy
Gamma-rays irradiates;SOD2+R:SOD2 groups receive the irradiation of 6Gy gamma-rays;
Fig. 2-1 and Fig. 2-2 is that the CoN of 48h CCD 841 surely turn a plant SOD2 expression changes after 6Gy irradiates:
In figure, Normal:Normal group, do not express pLVX-C9BC-SOD2-T2A-AcGFP1, do not apply treatment with irradiation;
SOD2:Stable expression pLVX-C9BC-SOD2-T2A-AcGFP1, do not apply treatment with irradiation;Normal+R:Normal group receives 6Gy
Gamma-rays irradiates;SOD2+R:SOD2 groups receive the irradiation of 6Gy gamma-rays;
Fig. 3 is HT-29 stable cell strains multiplication capacity change after 6Gy irradiations:
In figure, Normal, SOD2, Normal+R, SOD2+R implication are identical with Fig. 1-1;
Fig. 4 is the CoN stable cell strains multiplication capacities of CCD 841 change after 6Gy irradiations;
In figure, Normal, SOD2, Normal+R, SOD2+R implication are identical with Fig. 2-1;
Fig. 5 is different disposal group HT-29 cell line colony formation result figures;
In figure, Normal, SOD2, Normal+R, SOD2+R implication are identical with Fig. 1-1;
Fig. 6 is the CoN cell clonal formation experimental result pictures of different disposal group CCD 841;
In figure, Normal, SOD2, Normal+R, SOD2+R implication are identical with Fig. 2-1;
Fig. 7 tumour cell HT-29 between different grouping apoptosis ratio chart;
Normal, SOD2, Normal+R, SOD2+R implication are identical with Fig. 1-1 in figure;
Fig. 8 CoN Apoptosis ratio charts of normal cell strain CCD 841 between different grouping;
In figure, Normal, SOD2, Normal+R, SOD2+R implication are identical with Fig. 2-1
Fig. 9 is each group nude mice HT-29 growth of transplanted human curves;
Figure 10 is the 24th day each group transplanted tumor in nude mice growing state
Figure 11 is after each group tumor bearing nude mice tumor material obtaining;
Figure 12 different disposal group transplantable tumor paraffin sections HE is dyed:
In figure, A, normal;B,SOD2;C,Normal+Radiation;D,SOD2+Radiation
Figure 13-1 and 13-2 is that SABC detects transplantable tumor different disposal group SOD2 expression;
In figure, A, normal;B,SOD2;C,Normal+Radiation;D,SOD2+Radiation;
Figure 14-1 and 14-2 is that TUNEL methods detect Apoptosis situation in different disposal group tumor tissues
Figure 15-1 and 15-2 is that TUNEL methods detect Apoptosis situation in different disposal group skin histology
In figure, A, normal;B,SOD2;C,Normal+Radiation;D,SOD2+Radiation
Embodiment
Below in conjunction with accompanying drawing, the invention will be further described.
Embodiment 1:
SOD2 slow virus carriers pLVX-C9BC-SOD2-T2A-AcGFP1 construction method, adopts and comprises the following steps:
(1) CArG, is synthesized9, CMV basic promoter chimeric promoters C9BC genetic fragments, the C9BC gene pieces
Duan Shangyou contains Cla I restriction enzyme sites, and Xho I restriction enzyme sites are contained in downstream;
(2), Cla I, Xho I double digestion slow virus carrier pLVX-AcGFP1-N1, by original carrier framework CMV promoter
Remove;Cla I, Xho I double digestions close genetic fragment entirely, obtain radiation-induced promoter C9BC;By C9BC promoters, which are connected to, cuts
Except the pLVX-AcGFP1-N1 fragments of CMV promoter, pLVX-C is obtained9BC-AcGFP1-N1;
(3) using cDNA as template amplification SOD2 full genome fragments, the full genome fragment sequence containing kozak, SOD2 upstreams contain
There are Xho I restriction enzyme sites, BspT104I restriction enzyme sites are contained in downstream;Xho I, BspT104 I double digestions pLVX-C9BC-
AcGFP1-N1, remove part MCS sequences;Xho I, BspT104 I double digestion SOD2 amplified fragments, obtain SOD2 sequence fragments;
Gained SOD2 sequence fragments are connected to pLVX-C9BC-AcGFP1-N1 endonuclease bamhis, obtain pLVX-C9BC-SOD2-AcGFP1;
(4) two complementary T2A aligning primers are synthesized, BspT104I restriction enzyme sites are contained in the primer upstream, and downstream is contained
Apa I restriction enzyme sites, it is standby after complementary primer annealing;BspT104I, Apa I double digestions pLVX-C9BC-SOD2-AcGFP1, obtain
Part MCS fragments must be removed;
(5) pLVX-C obtained by Connection Step (3)9T2A fragments obtained by BC-SOD2-AcGFP1 fragments and step (4),
Obtain pLVX-C9BC-SOD2-T2A-AcGFP1。
Wherein, C in step (1)9The acquisition methods of BC DNA fragmentations are:
C9BC sequences (SEQ.ID.NO:1) it is made up of the 9 CArG sequences connection CMV basal promoters connected, sequence is
(point type underscore part is restriction enzyme site, and Cla I restriction enzyme sites are contained in upstream, and Xho I restriction enzyme sites are contained in downstream;Underscore
Part is CArG9Sequence):
CCATATAAGGCCATATAAGGC
CATATAAGGCCATATAAGGCCATATAAG
GCCATATAAGGCCATATAAGGCCATATA
AGGCCATATAAGGGCGATCGCCCGCCC
CATTGACGCAAATGGGCGGTAGGCGTG
TACGGTGGGAGGTCTATATAAGCAGAG
CTCGTTTAGTGAACCGTCAGATCGCCT
GGAGACGCCATCCACGCTGTTTTGACC
TCCATAGAAGACACCGACTCTACTAGA
GGATCGCTAGCGCTACCGGACTCAGAT
Three pUC pUCs pack slow virus:
(1) when cell confluency degree is to 40%-50%, the culture medium of original 10cm culture dishes is discarded, adds pre-temperature
Opti-Mem 10ml, it is put into incubator and continues to cultivate;
(2) liposome lipofiter is gently blown and beaten mixing;
(3) sterile centrifugation tube is taken, adds appropriate Opti-Mem and each plasmid component, is gently blown and beaten with pipettor mixed
It is even, final volume 1mL;Each plasmid component is as follows:
Plasmid component | Dosage |
pLVX-C9BC-AcGFP1-N1 | 10μg |
pLVX-C9BC-SOD2-T2A-AcGFP1 | 10μg |
psPAX2 | 6μg |
pMD2.G | 4μg |
(4) another centrifuge tube is taken, adds the appropriate μ l of Opti-Mem and lipofiter 40, gently piping and druming mixes, whole body
Product 1mL, is stored at room temperature 5min;
(5) by the centrifuge tube of step (3) and (4) solution mix, gently blown and beaten with pipettor mixings (not vortex or
Concussion, can not give centrifugal treating);
(6) it is stored at room temperature 20min, it is possible to flocculent deposit occur, belong to normal phenomenon, without specially treated;
(7) above 2mL plasmid liposome mixed liquors are uniformly added in 10cm culture dishes, after gently 8 words mix, put back to thin
Cultivated in born of the same parents' incubator;
(8) after 6h, the culture dish after transfection is taken out, original culture medium containing plasmid liposome is discarded, rejoins pre-
Temperature contains 10% hyclone DEME complete mediums, continues to cultivate;
(9) 48h and 72h collects the culture medium (containing virus) in culture dish respectively after transfecting, by 0.45 μm
Millipore filter membranes are filtered, and are removed cell fragment, are put into 50mLbeckman centrifuge tubes, centrifuge tube is put in ice cube
In, keep low temperature;
(10) after centrifuge tube trim, 50000xg centrifuges 2-3h in ultracentrifuge, abandons supernatant.Centrifuge tube is upside down in sterilizing
Gauze on, keep 5-10min, make raffinate stream clean;
(11) 200 μ l Opti-MEM are added, dissolving precipitation is blown and beaten with pipettor (attention avoids producing bubble);After packing
- 80 DEG C are placed in save backup.
Embodiment 2:
Influence experiment after radiation treatment to stable cell strain SOD2 protein expressions
In view of 2-8Gy can effectively activate chimeric promoters C9The horizontal reality of transcriptions of the BC to downstream gene, cell and animal
Test and irradiated using gamma-rays, accumulated dose 6Gy;Wherein zoopery uses single fraction irradiation 2Gy, once a day, Continuous irradiation 3
My god;The method that the experiment of cellular level uses single fraction irradiation 6Gy.
Observe therapy vector (pLVX-C after 6Gy irradiates9BC-SOD2-T2A-AcGFP1) stable expression cell strain HT-29 and
The CoN of CCD 841 express SOD2 change, with reference to front portion experimental result, 48h western blot sides after treatment with irradiation
Method detects.As a result show, compared to other packets, after 6Gy irradiations, HT-29 stable cell strains SOD2, which is expressed, substantially increases (Fig. 1-1
And 1-2), difference has conspicuousness (P<0.01).Do not receive the HT-29 stable cell strains for the treatment of with irradiation, do not connect compared to receiving or
The normal group of exposure, SOD2 expression also have increase (P<0.01), show that chimeric promoters have certain background starting characteristic,
Do not receive irradiation in the case of can be weaker startup downstream gene expression.
As shown in Fig. 2-1 and 2-2,6Gy irradiation after 48h, therapy vector stable expression cell strain CCD 841CoN compared to
Other packets SOD2 expression is substantially increased, and difference has conspicuousness (P<0.01).The CoN of CCD 841 for not receiving treatment with irradiation surely turn
Cell line, compared to the normal group for receiving or not receiving irradiation, SOD2 expression also has increase (P<0.05) chimeric startup, is also shown
Son also has certain background starting characteristic into the cell in Normal Colon
Embodiment 3:
SOD2 is overexpressed the influence experiment to stable cell strain multiplication capacity
The change of ability of cell proliferation between different cell packets is detected using CCK-8 cell proliferation experiments.Experimental result
As shown in Figure 3.48h after irradiation, SOD2+R group ability of cell proliferation are less than Normal+R groups, and difference has conspicuousness (P<
0.05);The 72h trend is more obvious, and SOD2+R group ability of cell proliferation is substantially less than Normal+R groups (P<0.01).Show
SOD2, which is overexpressed, can increase sensitiveness of the tumour cell HT-29 to radiation treatment, strengthen the effect of radiotherapy.
6Gy irradiates the CoN stable cell strains of CCD 841, compared with Normal+R groups, has improvement in 24h, 48h multiplication capacity
Trend, but difference does not have conspicuousness.72h detects ability of cell proliferation, and the CoN stable cell strain multiplication capacities of CCD 841 are significantly high
In Normal+R groups (P<0.05).Result above shows that being overexpressed SOD2, there is certain anti-radiation protection to make to normal colon cell
With (Fig. 4)
Embodiment 4
SOD2 is overexpressed the influence experiment to stable cell strain clonality
Plate clone formation experiment is to detect the ability that individual cells form clone, the propagation and growth energy of energy reacting cells
Power.Because incubation time is longer, survival ability and state that can be than more comprehensive reacting cells by cell after radiation treatment.It is real
Result is tested to show (Fig. 5), 2 weeks after 6Gy radiation treatments, pLVX-C9BC-SOD2-T2A-AcGFP1 surely turns a plant HT-29 Clone formations
Rate is significantly lower than Normal+R groups and other experimental groups, and difference has conspicuousness (P<0.01), show that SOD2 cooperates with suppression with radiotherapy
Knurl acts on, so as to increase the radiosensitivity of tumour cell.The discovery of cloning experimentation simultaneously, Normal Colon cell line CCD 841
After CoN is overexpressed SOD2 therapeutic genes, after being stimulated by 6Gy irradiation, although clonality substantially reduces (Fig. 6), compared with
In radiation alone group, the significantly higher (P of cloning efficiency<0.01), show that Normal Colon is overexpressed SOD2 into the cell, for thin
Born of the same parents have anti-radiation protection effect, can improve resistance of the cell for radiation treatment.
Embodiment 5
The change experiment of different disposal group cell cycle
After implementing 6Gy treatment with irradiation, the stable HT-29 cell line G1 phase cell accountings for expressing SOD2 therapeutic genes substantially increase
More, S, G2 phase cell accounting substantially reduce, and difference has conspicuousness (P<0.01) 1, is shown in Table, shows SOD2 gene therapy combined radiotherapies
Cell division and propagation can effectively be suppressed, so as to effectively suppress tumour growth.Stable expression SOD2 normal cell strain CCD 841
CoN G1 phases ratios after irradiated have compared to other groups increases trend, shows there is certain anti-radiation protection effect (being shown in Table 2)
The different disposal group HT-29 cell line cell cycle ratios of table 1
Normal | SOD2 | Normal+R | SOD2+R | |
G1 | 39.81 | 49.24 | 54.05 | 76.88 |
S | 37.37 | 34.62 | 16.15 | 12.6 |
G2 | 21.41 | 15.18 | 28.63 | 11.04 |
2 different disposal group normal cell cell cycle of table ratio
Normal | SOD2 | Normal+R | SOD2+R | |
G1 | 59.43 | 65.07 | 81.89 | 83.71 |
S | 30.38 | 19.16 | 10.45 | 8.61 |
G2 | 9.18 | 15.99 | 7.69 | 7.8 |
Embodiment 6
The comparative experiments of Apoptosis situation between different disposal group
After receiving 6Gy Irradiations, the stable HT-29 cell lines for expressing SOD2 wither compared to other group of cell line, cell
Dying rate substantially increases, the statistically significant (P of difference<0.01).Show that joint SOD2 is overexpressed and radiotherapy is for improving tumour
Radiosensitivity and optimization ideas of cancer therapy have a clear superiority, as shown in Figure 7.Meanwhile Fig. 8 is showing stable expression SOD2 just
The normal CoN of colon cell strain CCD 841 are after Irradiation is received, compared to radiation alone group, although difference is not up to statistics
Conspicuousness, but the apoptosis rate of Normal Colon cell has obvious downward trend.The above results show that SOD2 gene therapies are being put
There is obvious advantage in treatment, while there is the Apoptosis to tumour cell and the anti-radiation protection to normal cell to make
With.
Embodiment 7
Tumor growth curve and inhibition rate of tumor growth experiment
Nude mice by subcutaneous lotus knurl is smooth, and tumour initially forms macroscopic tumor mass after 1 week, reaches real after 5 days
Test requirement.Nude mice is divided into 4 groups according to random principle.Knurl week, intratumor injection pLVX-C9BC-SOD2-T2A-AcGFP1 is sick slowly
3 days after poison infection, row accumulated dose 6Gy radiation treatments, single 2Gy, once a day, for three days on end.Lotus knurl volume was measured every 3 days,
Describe growth curve after record, calculate inhibition rate of tumor growth.Test result indicates that compared to other experimental groups, intratumor injection
SOD2 is overexpressed after slow virus, can effectively suppress tumour growth (P<0.01).The gross tumor volume at each time point is referring to Fig. 9.It is swollen
Shown in knurl inhibiting rate result as Figure 10, table 3, experimental result illustrates that SOD2+R group oncotherapy effects are best, this group of tumour inhibiting rate with
Other groups compare with notable difference (P<0.01);This shows that SOD2 can play radio therapy sensitization effect, SOD2 gene therapies joint
Radiotherapy can effectively suppress the growth of HT-29 colon cancer cells, have good effect in anti-knurl experiment in vivo.
The 24th day each group transplanted tumor in nude mice volume of table 3 and corresponding tumour inhibiting rate (n=6)
Embodiment 8
Tumor tissue pathology's change experiment
Growth of transplanted human is to 100mm3When, knurl is interior, knurl week injecting lentivirus pLVX-C9BC-SOD2-T2A-AcGFP11×
108TU, 1 time/d, continuous 3d;After last time injection 72h, daily row tumor by local radiation, 2Gy/ times, continuous 3d.To avoid
Histoorgan beyond ray contrast launched field has damage, and local irradiation field is blocked with lead.Treatment with irradiation is seen after terminating
Examine 2 weeks, take off cervical approach and put to death tumor bearing nude mice, cut skin at lotus knurl, carefully peel off tumour, take out knurl body (Figure 11).Take pictures respectively
After taking figure, knurl body is fixed in 4% paraformaldehyde, conventional line histopathological examination after 24h.The arrangement of knurl body cell is disorderly under light microscopic
Disorderly, in irregular, caryoplasm proportional imbalance, the big deep dye of core, pathologic mitosis is mutually common, and part knurl body central area is visible bad
Dead stove.Visible more necrosis region wherein in SOD2 gene therapies combined radiotherapy group tumor tissues, it is bad that liquefaction is presented in tumour cell
Extremely, eucaryotic cell structure disappears, and is rendered as thermophilic Yihong Zao Xing regions (Figure 12)
Embodiment 9
Tumor tissues immunohistochemical S OD2 expression experiments
Knurl body SOD2 immunohistochemical staining results are shown in Figure 13-1 and 13-2.SOD2 localization and expressions are in cytoplasm, DAB sun
Property dyeing be buff or sepia.Compared to normal group, simple SOD2 gene therapies group and radiation alone group, SOD2 is overexpressed
The obvious increase of SOD2 expression, shows that chimeric promoters in vivo can be effectively radiation-induced in plus radiotherapy group tumour cell, swashs
Start downstream target gene SOD2 transcriptional expressions after work.
Embodiment 10
The detection transplantable tumor inner cell apoptosis situation experiment of TUNEL methods
As shown in Figure 14-1 and 14-2, SOD2 stable expression cell strain combined radiotherapy group Apoptosis ratio is significantly more than not
Treatment group, simple irradiation group and stable expression SOD2 do not irradiate group.Show that SOD2 gene therapies combined radiotherapy can be thin by inducing
Born of the same parents' apoptosis plays Synergistic action.
Embodiment 11
TUNEL methods detect skin tissue cell apoptosis situation
Growth of transplanted human is to 100mm3When, in knurl, knurl week (subcutaneous and intracutaneous) injection SOD2 overexpressions slow virus 1 ×
108TU, 1 time/d, continuous 3d;Row tumor by local radiates after 72h is completed in injection, 2Gy/ times/d, continuous 3d, and irradiation field is outer with lead
Block.As shown in Figure 15-1 and 15-2, apoptotic cell is dispersed in distribution, and karyon coloring, positive staining is sepia.Normal group and list
Pure SOD2 gene therapies group apoptosis rate is very low;Radiation alone group apoptosis rate substantially increases;SOD2 gene therapies are combined
Combination radiotherapy group apoptosis rate significantly decreases trend compared to radiation alone group.Result above shows SOD2 gene overexpressions pair
Normal skin tissue in radiation open country has certain anti-radiation protection effect
The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention
All any modification, equivalent and improvement made within refreshing and principle etc., should be included in the scope of the protection.
SEQUENCE LISTING
<110>Sichuan Tumor Hospiatal
<120>SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity
<130> 001
<160> 1
<170> PatentIn version 3.5
<210> 1
<211> 278
<212> DNA
<213>Artificial sequence
<400> 1
atcgatccat ataaggccat ataaggccat ataaggccat ataaggccat ataaggccat 60
ataaggccat ataaggccat ataaggccat ataagggcga tcgcccgccc cattgacgca 120
aatgggcggt aggcgtgtac ggtgggaggt ctatataagc agagctcgtt tagtgaaccg 180
tcagatcgcc tggagacgcc atccacgctg ttttgacctc catagaagac accgactcta 240
ctagaggatc gctagcgcta ccggactcag atctcgag 278
Claims (3)
- A kind of 1. SOD2 slow virus carriers, it is characterised in that:The carrier is pLVX-C9BC-SOD2-T2A-AcGFP1。
- 2. the construction method of the SOD2 slow virus carriers described in claim 1, it is characterised in that:Comprise the following steps:(1) CArG is synthesized9, CMV basic promoter chimeric promoters C9BC genetic fragments, the C9BC genetic fragments upstream Containing Cla I restriction enzyme sites, Xho I restriction enzyme sites are contained in downstream;(2) Cla I, Xho I double digestion slow virus carrier pLVX-AcGFP1-N1, original carrier framework CMV promoter is removed; Cla I, Xho I double digestions close genetic fragment entirely, obtain radiation-induced promoter C9BC;By C9BC promoters are connected to excision CMV The pLVX-AcGFP1-N1 fragments of promoter, obtain pLVX-C9BC-AcGFP1-N1;(3) using cDNA as template amplification SOD2 full genome fragments, the full genome fragment sequence containing kozak, SOD2 contains Xho in upstream BspT104I restriction enzyme sites are contained in I restriction enzyme sites, downstream;Xho I, BspT104 I double digestions pLVX-C9BC-AcGFP1-N1, Remove part MCS sequences;Xho I, BspT104 I double digestion SOD2 amplified fragments, obtain SOD2 sequence fragments;By gained SOD2 Sequence fragment is connected to pLVX-C9BC-AcGFP1-N1 endonuclease bamhis, obtain pLVX-C9BC-SOD2-AcGFP1;(4) two complementary T2A aligning primers are synthesized, BspT104 I restriction enzyme sites are contained in the primer upstream, and Apa is contained in downstream I restriction enzyme sites, it is standby after complementary primer annealing;BspT104 I, Apa I double digestions pLVX-C9BC-SOD2-AcGFP1, obtain Remove part MCS fragments;(5) pLVX-C obtained by Connection Step (3)9T2A fragments obtained by BC-SOD2-AcGFP1 fragments and step (4), obtain pLVX-C9BC-SOD2-T2A-AcGFP1。
- 3. application of the SOD2 slow virus carriers in targeting radiation protection and tumour enhanced sensitivity described in claim 1.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710669628.4A CN107365799A (en) | 2017-08-08 | 2017-08-08 | SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201710669628.4A CN107365799A (en) | 2017-08-08 | 2017-08-08 | SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity |
Publications (1)
Publication Number | Publication Date |
---|---|
CN107365799A true CN107365799A (en) | 2017-11-21 |
Family
ID=60310055
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201710669628.4A Pending CN107365799A (en) | 2017-08-08 | 2017-08-08 | SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN107365799A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112218683A (en) * | 2018-05-30 | 2021-01-12 | 睿谱外科系统股份有限公司 | Radiosurgical neuromodulation near critical structures |
CN112603995A (en) * | 2020-12-30 | 2021-04-06 | 四川省肿瘤医院 | CAFs-targeted tumor cell vaccine, preparation method and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090117047A1 (en) * | 2001-07-31 | 2009-05-07 | Szalay Aladar A | Light emitting microorganisms and cells for diagnosis and therapy of tumors |
CN102174572A (en) * | 2010-12-29 | 2011-09-07 | 南京农业大学 | Porcine somatic cell transgenically-cloned plasmid pEGFP-N1-shRNA (Porcine Enhanced Green Fluorescent Protein-N1-short hairpin Ribonucleic Acid) and structuring method thereof |
-
2017
- 2017-08-08 CN CN201710669628.4A patent/CN107365799A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20090117047A1 (en) * | 2001-07-31 | 2009-05-07 | Szalay Aladar A | Light emitting microorganisms and cells for diagnosis and therapy of tumors |
CN102174572A (en) * | 2010-12-29 | 2011-09-07 | 南京农业大学 | Porcine somatic cell transgenically-cloned plasmid pEGFP-N1-shRNA (Porcine Enhanced Green Fluorescent Protein-N1-short hairpin Ribonucleic Acid) and structuring method thereof |
Non-Patent Citations (1)
Title |
---|
张志强: "辐射诱导型SOD2过表达慢病毒载体的构建及其在结肠癌放疗中的辐射防护和放疗增敏效应", 《中国博士学位论文全文数据库医药卫生科技辑》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN112218683A (en) * | 2018-05-30 | 2021-01-12 | 睿谱外科系统股份有限公司 | Radiosurgical neuromodulation near critical structures |
US11745029B2 (en) | 2018-05-30 | 2023-09-05 | Zap Surgical Systems, Inc. | Radiosurgical neuromodulation close to critical structures |
CN112603995A (en) * | 2020-12-30 | 2021-04-06 | 四川省肿瘤医院 | CAFs-targeted tumor cell vaccine, preparation method and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Li et al. | miR-221/222 confers radioresistance in glioblastoma cells through activating Akt independent of PTEN status | |
Zielske et al. | Radiation increases invasion of gene-modified mesenchymal stem cells into tumors | |
ES2773155T3 (en) | Method to treat leukemia using a reprogramming effect | |
Dastjerd et al. | Gene therapy: A promising approach for breast cancer treatment | |
Wu et al. | Knockdown of checkpoint kinase 1 is associated with the increased radiosensitivity of glioblastoma stem-like cells | |
CN107365799A (en) | SOD2 slow virus carriers, construction method and its application in targeting radiation protection and tumour enhanced sensitivity | |
CN110373428A (en) | A kind of transgene carrier system and its application promoting cell transplantation and gene expression | |
CN101642577A (en) | Application of human ING4 gene serving as radiation sensitizer | |
CN102102102A (en) | Novel application of hsa-miR-185 | |
Bao et al. | MicroRNA-21 mediates bone marrow mesenchymal stem cells protection of radiation-induced lung injury during the acute phase by regulating polarization of alveolar macrophages | |
Zou et al. | The suppression of hypoxia-inducible factor and vascular endothelial growth factor by siRNA does not affect the radiation sensitivity of multicellular tumor spheroids | |
CN101391104B (en) | New use of oncolytic adenovirus recombinant of tumour cell single-expression immunoloregulation fator GM-CSF | |
CN101503685A (en) | Anticancer recombinant adenovirus with tumour cell miR-221/222 as drug target, construction method and use | |
CN105617401A (en) | Tumor radiation-sensitizing and radiation bystander effect reducing function of miRNA, implementation method, and uses | |
Chen et al. | Advances in CAR‐Engineered Immune Cell Generation: Engineering Approaches and Sourcing Strategies | |
Nasehi et al. | Stable silencing of IGF1R using Lentiviral-mediated shRNA in HEK293T cells | |
CN101508989B (en) | Radiation sensibility tumor-targeted promotor and uses thereof | |
CN102352368B (en) | ING4 and OSM double-gene co-expression vector and application thereof | |
CN101126100A (en) | Tumour bi-target adenovirus AdCN103 and its construction method and application | |
CN117860919A (en) | Application of reagent for inhibiting or interfering RBM17 gene expression in preparation of tumor treatment medicine | |
Wang et al. | iRGD-modified exosomes encapsulate anti-miR-25-3p for targeted pancreatic cancer therapy | |
Hu | Application and optimization strategy of CAR-NK in AML | |
Nabizadeh et al. | An Engineered Mesenchymal Stem Cell by Lentiviral Vector Expressing CD44 as a Candidate to Target Colon Cancer Tissue in Mice Model | |
CN103285405B (en) | Gene medicine for promoting differentiation of tumor stem cells and applications thereof | |
Zhang et al. | HIF-1α shRNAs delivered by ultrasound-targeted cationic microbubble inhibit proliferation, migration, and invasion of ovarian cancer cells |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
RJ01 | Rejection of invention patent application after publication | ||
RJ01 | Rejection of invention patent application after publication |
Application publication date: 20171121 |