CN107312862B

CN107312862B - Kit for detecting serotype 10A of pneumococcus

Info

Publication number: CN107312862B
Application number: CN201710655873.XA
Authority: CN
Inventors: 赵泽坤; 翟振华; 杨子义
Original assignee: Beijing Hua'an Innovation Biotechnology Co ltd
Current assignee: AB&B Bio Tech Co Ltd JS
Priority date: 2017-08-03
Filing date: 2017-08-03
Publication date: 2021-01-01
Anticipated expiration: 2037-08-03
Also published as: CN107312862A

Abstract

The invention provides a kit for detecting serotype 10A of pneumococcus, and belongs to the technical field of PCR detection. The kit comprises a pair of specific primer pairs, and the nucleotide sequence of the specific primer pairs is shown in SEQ ID NO. 1-2. The invention also provides a method for detecting the serotype 10A of the pneumococcus, the specific primer pair is utilized to carry out PCR detection on a sample to be detected, and if the amplification product is 607bp, the sample to be detected contains the serotype 10A of the pneumococcus. The kit has the advantages of accurate detection, high sensitivity, strong specificity, simplicity, convenience and rapidness, is suitable for the epidemiological investigation of the pneumococcus and is also suitable for the rapid detection and identification of strains for producing 23-valent pneumococcus polysaccharide vaccines, and has good application prospect.

Description

Kit for detecting serotype 10A of pneumococcus

Technical Field

The invention relates to the technical field of PCR detection, in particular to a kit for detecting serotype 10A of pneumococcus and application thereof.

Background

Streptococcus pneumoniae is a common human pathogenic bacterium, is the most common cause of acquired pneumonia of people of all age groups in developing countries and developed countries, and is also a main pathogenic bacterium causing diseases such as otitis media, pneumonia, meningitis, septicemia and the like. The pneumococcus belongs to gram-positive bacteria, is arranged in a single sphere or a double sphere, has no flagella, spores and capsules, and has different thicknesses of capsules of different types. The capsule of pneumococci is a necessary condition for its virulence, and the capsular polysaccharide is group/type specific and is the basis for pneumococcal grouping/type. Pneumococci can be divided into 46 groups and 90 serotypes to date, and the types of pneumococci causing the disease often vary by region, age and population.

For more than 20 major serotypes causing diseases in pneumococci, vaccines are currently prepared from purified capsular polysaccharide, and the serotypes contained in the vaccines are determined according to the WHO protocol, namely 1, 2,3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F, namely 23-valent pneumococcal polysaccharide vaccines. The coverage rate of the 23 serotypes to the common serotypes in the United states, France, China and the like is over 85 percent, and the serotype can be used as a vaccine commonly used in the whole world. Experiments prove that the 23-valent pneumococcal polysaccharide vaccine has obvious effects on controlling and preventing pneumococcal infection, particularly pulmonary infection of old people, otitis media of children and meningitis.

The detection of the strain for producing the 23-valent pneumococcal polysaccharide vaccine is mainly completed by experiments such as culture characteristics of pneumococcus, gram stain, alpro degoxin, bile dissolution, biochemical reaction and the like. The common methods for typing of the species are the serum agglutination and capsular swelling experiments, and the capsular swelling experiment is also called gold standard for pneumococcal typing. However, the standard serum used in the serum coagulation and capsular swelling experiments is expensive, the requirement on professional technology is high, the result interpretation has certain subjectivity, and the standard serum becomes a great obstacle for restricting the popularization and application of the serotyping technology. In addition, for the phenomenon of common carriage of multiple serotypes, the capsular swelling experiment can only identify the dominant serotype, but cannot identify multiple serotypes simultaneously.

With the continuous perfection and richness of pneumococcal gene sequences and the development of molecular biology techniques, some PCR test methods for serotype typing of pneumococci have been established (Wulisan, Yanjianzi, Liu Xiao Yue, etc. methods for multiplex PCR detection of serotype of pneumococci and clinical applications, J.Microcyclics, 2012,22(4): 43-45). Rekha Pai et al established a multiplex PCR assay against the common 29 serotypes of pneumococcus, while covering the serotypes contained in 7-valent polysaccharide conjugate vaccines (Pai R, Gertz RE, Bell B. sequential. multiplex PCR for determining the serotype of Streptococcus pneumoniae isolates. Clin Microbiol,2006,44(1): 124. 131.). Fatma Filiz desk-Ari et al established a multiplex PCR diagnostic method against 13 valent pneumococcal polysaccharide conjugate vaccine (Cooskun-Ari F, Guldemir D, Durmaz R.one-step multiplex PCR assay for detecting streptococcus pneumoniae sequential antigens/types converted by 13-value pneumococcal conjugate vaccine (PCV13). PLoS ONE; 2012,7(12), e 50406.). Researchers in China also carry out related researches, for example, in order to understand the distribution condition of streptococcus pneumoniae serotypes/groups separated from children clinical pneumonia patients, a PCR method for rapid detection containing 12 serotypes is also established according to primers reported in the literature, and the PCR method can be used for identifying the streptococcus pneumoniae serotypes/groups (including Lima ultrastrons, strains, Liqian, and the like) which are mainly prevalent in people, but only covers 52.17% of all serotypes of 23-valent pneumococcal polysaccharide vaccines. According to literature reports, multiple PCR detection methods are established for 18 common serotypes of pneumococcus (clobetan, xufei, Chenqian, and the like. preliminary establishment of a PCR typing method consistent with serotypes of streptococcus pneumoniae. J.Clin.clinical examination, 2012,30(1): 29-30). However, the primers of type 10A cited in the established method do not amplify specific fragments of the expected size and cover only 72.26% of the 23 serotypes contained in the 23-valent pneumococcal polysaccharide vaccine.

As described above, the 10A primer reported at home and abroad cannot specifically amplify a fragment with an expected size. At present, a one-step multiplex PCR typing method which completely covers 23 serotypes contained in 23-valent pneumococcal polysaccharide vaccines does not exist, and a detection method for rapid detection and molecular typing of strains for producing the 23-valent pneumococcal polysaccharide vaccines does not exist.

Disclosure of Invention

The invention aims to provide a specific primer pair for specifically detecting the serotype 10A of pneumococcus.

Another objective of the invention is to provide a multiplex PCR typing method for detecting 23 serotypes contained in 23-valent pneumococcal polysaccharide vaccine.

The invention firstly provides a specific primer pair for detecting the serotype 10A of pneumococcus, and the nucleotide sequence of the specific primer pair is shown as SEQ ID NO. 1-2.

The invention provides application of the specific primer pair in detecting pneumococcal 10A serotype. In particular to the application of the serotype 10A of the pneumococcus in the detection of the vaccine.

The invention provides application of the specific primer pair in quality control of pneumococcal vaccine production.

The kit containing the specific primer pair shown in SEQ ID NO.1-2 belongs to the protection scope of the invention.

Further, the kit working procedure of the present invention comprises the following steps:

(1) extracting the genome DNA of a sample to be detected;

(2) carrying out PCR reaction on the sample DNA by using a specific primer pair shown in SEQ ID NO. 1-2; and (3) detecting the PCR product through electrophoresis, wherein if the size of the fragment of the target product is 607bp, the sample to be detected contains the pneumococcal 10A serotype.

The PCR reaction has the following reaction conditions: pre-denaturation at 94 ℃ for 5 min; 94 ℃ for 45s, 55 ℃ for 45s, 72 ℃ for 90s, 30 cycles; extension at 72 ℃ for 10 min.

The invention provides a method for detecting pneumococcal 10A serotype in a vaccine, which comprises the following steps:

(1) extracting the genome DNA of a sample to be detected;

The invention provides a kit for detecting 23-valent pneumococcal serotypes, which comprises a specific primer pair shown in SEQ ID NO.1-2, wherein the 23-valent pneumococcal serotypes are 1, 2,3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F respectively.

Further, the kit for detecting 23-valent pneumococcal serotypes contains 6 groups of specific primer combinations which are A, B, C, D, E, F groups respectively,

wherein the nucleotide sequences of the specific primer pairs contained in the group A are respectively shown in SEQ ID NO. 3-12;

wherein the nucleotide sequences of the specific primer pairs contained in the group B are respectively shown in SEQ ID NO. 11-20;

wherein the nucleotide sequences of the specific primer pair contained in the group C are respectively shown in SEQ ID NO.11-12 and SEQ ID NO. 21-28;

wherein the nucleotide sequences of the specific primer pair contained in the group D are respectively shown as SEQ ID NO.11-12 and SEQ ID NO. 29-36;

wherein the nucleotide sequences of the specific primer pair contained in the group E are respectively shown as SEQ ID NO.1-2, SEQ ID NO.11-12 and SEQ ID NO. 37-42;

wherein the nucleotide sequences of the specific primer pair contained in the F group are respectively shown as SEQ ID NO.11-12 and SEQ ID NO. 43-48.

The invention provides a specific primer combination for detecting 23-valent pneumococcal serotypes, which comprises 24 pairs of specific primer pairs, wherein the nucleotide sequences of the specific primer pairs are respectively shown in SEQ ID NO. 1-48.

The invention provides a multiplex PCR typing method aiming at 23 serotypes contained in 23-valent pneumococcal polysaccharide vaccine, and specific primers of the 23 serotypes are prepared into 6 groups of composite primers according to different sizes of PCR amplification product fragments, wherein each group contains a positive control primer cpsA. The 6 groups of composite primers are used for carrying out multiple PCR amplification on strains for producing the 23-valent pneumococcal polysaccharide vaccine, 23 serotypes are classified according to the difference of the sizes of amplified fragments, and the specificity identification is carried out on the properties and the purity of the 23 serotype pneumococcal strains.

The invention provides application of the specific primer combination in quality control of pneumococcal vaccine production.

The invention has the beneficial effects that the invention firstly makes up the technical blank that the serotype of pneumococcus 10A is not detected in the prior art, and based on the specific primer pair for detecting the serotype of pneumococcus 10A provided by the invention, the invention provides a multiplex PCR primer combination for quickly detecting and identifying strains for producing 23-valent pneumococcus polysaccharide vaccines and a molecular typing method based on a one-step multiplex PCR technology. The method is simple and convenient to operate, and detection of one serotype can be completed by only one PCR reaction; the economy is good, the cost is lower compared with the capsular swelling experiment, and the implementation is easier; the method has good sensitivity and specificity, can eliminate the influence of subjective factors, has more accurate and reliable results, and has great superiority compared with the physiological and biochemical detection method.

Drawings

FIG. 1 is a diagram: electrophoresis chart of 10A type primer specificity test.

FIG. 2 is a diagram of: the reference literature contains the existing 10A type primer amplification electrophoretogram, M is DNA Marker DL 2000; A. b, C, D, E, F represents the primer set and "negative" represents the negative control.

FIG. 3 is a diagram of: a 10A type primer 10A (1) designed aiming at the same target gene is used for amplifying an electrophoretogram, and M is DNA Marker DL 2000; A. b, C, D, E, F represents the primer set and "negative" represents the negative control.

FIG. 4 is a diagram of: a 10A type primer 10A (2) designed aiming at the same target gene is used for amplifying an electrophoretogram, and M is DNA Marker DL 2000; A. b, C, D, E, F represents the primer set and "negative" represents the negative control.

FIG. 5 is a diagram: and (3) amplifying electrophoresis images of the primers in the group A.

FIG. 6 is a diagram of: and B group primer amplification electrophoretogram.

FIG. 7 is a diagram of: and C group primer amplification electrophoretogram.

FIG. 8 is a diagram of: and D group of primer amplification electrophoretograms.

FIG. 9 is a diagram of: e group primer amplification electrophoretogram.

FIG. 10 is a diagram: f group primer amplification electrophoretogram.

Detailed Description

The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications or substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and scope of the invention.

Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art; all reagents used in the examples are commercially available unless otherwise specified.

Example 1 design of primers specific for pneumococcal 10A

The cps genes between the dexB and aliA genes in the pneumococcal genome are pneumococcal serotype related genes, the cps genome structure and composition of different serotypes are different, Bently et al have completed the determination of the cps genome sequence of 90 serotypes of pneumococcus, and disclose http:// www.sanger.ac.uk on the website (Bently S D, Aanensen D M, Malroidi A, et al. genetic analysis of the capsular biochemical from all 90pneumococcal serogroups. PLoS Gene, 2006,2(3): e 31). Downloading the cps genome sequences of 23 serotypes, comparing the cps genome sequences of 10A type genomes and other types of genomes by DNAStar software, and designing a pair of specific primers aiming at medium-size specific regions of the genomes, wherein the primer sequences are as follows:

10A-F:CCA GTG CAA TAC ATT CCA ATG TCA TTC TCG(SEQ ID NO.1)

10A-R:AAA TCA TTT GGG GCA TCT GTT ATC GGT GAA(SEQ ID NO.2)

single PCR amplifications were performed using type 10A specific primer pairs prepared

type

1, 2,3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, 33F DNA templates in 25 ul: 3ul of DNA template, 2.5mM dNTP mix 2ul, TaKaRa LA Taq DNA polymerase 0.5ul, 10 XPCR Buffer 5ul, 10A type upstream and downstream primers each 2ul, sterilized pure water make up to 25 ul. The PCR amplification procedure was: (1) pre-denaturation at 95 deg.C for 5 min; (2) denaturation at 94 ℃ for 45 s; (3) annealing at 55 ℃ for 45 s; (4) extension at 72 ℃ for 90 s; (5) returning to (2) for 30 cycles; (6) 10min at 72 ℃. And taking the amplification product to perform electrophoresis by using 1.5% agarose gel, and imaging and analyzing the result.

The results are shown in FIG. 1: and M is DNA Marker DL2000, 1, 2,3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F represent 23 pneumococcal serotypes. As can be seen from FIG. 1, only 10A pneumococcus as a positive control amplified a specific target band of 607bp, and none of the remaining 22 serotypes, indicating that the 10A primer had good specificity and no nonspecific amplification for 23 serotypes of pneumococcus.

The sequences of primers specific to type 10A provided in the prior art are:

10A-F:GGTGTAGATTTACCATTAGTGTCG GCAGAC(SEQ ID NO.49)

10A-R:GAATTTCTTCTTTAAGATTCGGATATTTCTC(SEQ ID NO.50)

in addition to SEQ ID NO.1-2, the inventors designed two additional pairs of primers for the same target gene:

10A(1)-F:CACGGCTGAGATGTTGGATAATATGGAAAC(SEQ ID NO.51)

10A(1)-R:TGCCCTGATTGTGGAAGTCTAATGAAGAAA(SEQ ID NO.52)

10A(2)-F:AAAGGCGAAAGAACACTTGGAACAAACAGG(SEQ ID NO.53)

10A(2)-R:CCTCACTCCTACCAGAAACTTGCCACATCC(SEQ ID NO.54)

however, after tests, the amplification effect of the 3 pairs of primers is not ideal, and the expected target fragments cannot be amplified; the results shown in FIG. 2 indicate that the type 10A specific primers (SEQ ID NO.49-50) provided by the prior art fail to amplify the expected target fragment; as shown in FIG. 3, the results indicate that specific primers (SEQ ID NO.51-52) designed for the same target gene fail to amplify the expected target fragment; as shown in FIG. 4, the results indicate that specific primers (SEQ ID NO: 53-54) designed for the same target gene failed to amplify the expected target fragment.

Example 2 establishment of multiplex PCR detection System for detecting 23-valent serotype of pneumococcus

1. Multiplex PCR composite primer combination design and preparation

According to the difference of the sizes of the target fragments amplified by 23 pairs of primers, the target fragments are optimally combined, so that the difference of the sizes of the amplified fragments of the primers in each group is about 100bp, the electrophoresis result is more visual, and different serotypes can be directly distinguished according to the difference of the sizes of the amplified fragments. Then, corresponding primers are respectively taken to prepare 6 groups of composite primers A, B, C, D, E, F, and each group of composite primers contains a positive control primer cpsA, and the primer sequences are as follows:

SEQ ID NO11：GCAGTACAGCAGTTTGTTGGACTGACC

SEQ ID NO12：GAATATTTTCATTATCAGTCCCAGTC

the serotype, amplification length, final concentration of each primer and other detailed parameters of each primer group are shown in Table 1:

TABLE 1

2. Performing multiple PCR amplification on the prepared DNA template by using a composite primer group

Using prepared 23 serotype pneumococcal genome DNA as a template, preparing 6 groups of PCR reaction systems A, B, C, D, E, F by using 6 groups of composite primers, and using cpsA primers in each group as positive controls to amplify 160bp fragments aiming at all serotypes; the N groups were negative control groups, using pure water as template, and the remaining groups were identical to the other groups. After 7 sets of PCR systems were prepared, multiplex PCR amplification was performed under the same amplification conditions. The PCR reaction system is 25 ul: DNA template 3ul, dNTP mix (2.5mM)2ul, TaKaRa LA Taq DNA polymerase 0.5ul, 10X PCR Buffer 5ul, composite primers each 2ul, sterilized pure water make up to 25 ul. The PCR amplification procedure was: (1) pre-denaturation at 95 deg.C for 5 min; (2) denaturation at 94 ℃ for 45 s; (3) annealing at 55 ℃ for 45 s; (4) extension at 72 ℃ for 90 s; (5) returning to (2) for 30 cycles; (6) 10min at 72 ℃. And (5) taking the PCR product, performing electrophoresis on the PCR product by using 1.5% agarose gel, and imaging and analyzing the result.

The results are shown in FIGS. 5-10: m is DNA Marker DL 2000; n is a negative control; A. b, C, D, E, F are each composite primer set; 1. 2,3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F, 33F represent 23 serotypes of pneumococci.

As shown in fig. 5: clear target bands with different sizes are respectively amplified by the 4

serotypes

19F, 23F, 20 and 7F contained in the group A, and the amplified fragments of 19F, 23F, 20 and 7F are sequentially increased.

As shown in fig. 6: clear target bands with different sizes are respectively amplified by the 4

serotypes

8, 2, 9N and 9V contained in the group B, and the amplified fragments of 8, 2, 9N and 9V are sequentially increased.

As shown in fig. 7: clear target bands with different sizes are respectively amplified by the 4

serotypes

1, 3, 15B and 17F contained in the group C, and the amplified fragments of 1, 3, 15B and 17F are sequentially increased.

As shown in fig. 8: the 4

serotypes

6B, 12F, 19A and 22F contained in the group D respectively amplify clear target bands with different sizes, and the amplified fragments of 6B, 12F, 19A and 22F are sequentially increased.

As shown in fig. 9: the 4

serotypes

14, 5, 11A and 10A contained in the group E respectively amplify clear target bands with different sizes, and the 14, 5, 11A and 10A amplified fragments are sequentially increased.

As shown in fig. 10: the 3

serotypes

33F, 4 and 18C contained in the F group respectively amplify clear bands with different sizes, and the amplified fragments of 33F, 4 and 18C are sequentially increased.

Each serotype pneumococcus amplifies target bands with different sizes in a corresponding primer group, and simultaneously, positive control bands with the size of 160bp are amplified in each group, and the negative control group has no band amplification. The method can be used for rapidly and accurately identifying and typing 23 serotypes of pneumococcus, and can be used for detecting the properties and the purities of the 23 serotypes of pneumococcus, so that a molecular biology basis is provided for detecting the pneumococcus.

Example 3 multiplex PCR amplification of fermentation broth sampled on fermentor

The method established in example 2 is adopted to carry out PCR amplification on 23 serotype pneumococcal fermentation liquids fermented on a fermentation tank, no cross contamination exists among types in the fermentation process, and because some polysaccharide and protein generated in the fermentation process can interfere with the PCR amplification, before carrying out PCR, genome extraction is carried out on each type of fermentation liquid by adopting a bacterial genome extraction kit of a Corynol reagent company according to the instruction, and PCR amplification is carried out after a template with higher purity is prepared.

The extracted genome DNA of each type of fermentation liquor is used as a template, A, B, C, D, E, F groups of 6 groups of composite primers are used for carrying out PCR amplification on each type, and N groups are used as negative controls. The PCR reaction system is 25 ul: DNA template 3ul, dNTP mix (2.5mM)2ul, TaKaRa LA Taq DNA polymerase 0.5ul, 10X PCR Buffer 5ul, composite primers each 2ul, sterilized pure water make up to 25 ul. The PCR amplification procedure was: (1) pre-denaturation at 95 deg.C for 5 min; (2) denaturation at 94 ℃ for 45 s; (3) annealing at 55 ℃ for 45 s; (4) extension at 72 ℃ for 90 s; (5) returning to (2) for 30 cycles; (6) 10min at 72 ℃. And (5) taking the PCR product, performing electrophoresis on the PCR product by using 1.5% agarose gel, and imaging and analyzing the result.

After the fermented fermentation liquor of 23 serotypes on a fermentation tank is extracted by genome DNA, bands with the same size as target fragments are amplified in corresponding primer groups, and nonspecific target band amplification is not seen in other primer groups. The embodiment shows that the method can be used for quickly and accurately detecting the pneumococcal fermentation liquor on the fermentation tank by PCR, can detect whether the pneumococcus of different serotypes have cross contamination in the fermentation process, and provides a molecular biological monitoring means for the fermentation process of the pneumococcus. .

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Beijing Hua' an scientific Biotech Co., Ltd

<120> a kit for detecting pneumococcal 10A serotype

<130> KHP171113852.9

<160> 54

<170> PatentIn version 3.5

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence

<400> 1

ccagtgcaat acattccaat gtcattctcg 30

<210> 2

<211> 30

<212> DNA

<213> Artificial sequence

<400> 2

aaatcatttg gggcatctgt tatcggtgaa 30

<210> 3

<211> 30

<212> DNA

<213> Artificial sequence

<400> 3

cctacgggag gatataaaat tatttttgag 30

<210> 4

<211> 32

<212> DNA

<213> Artificial sequence

<400> 4

caaatacacc actataggct gttgagacta ac 32

<210> 5

<211> 31

<212> DNA

<213> Artificial sequence

<400> 5

gagcaagagt ttttcacctg acagcgagaa g 31

<210> 6

<211> 33

<212> DNA

<213> Artificial sequence

<400> 6

ctaaattcct gtaatttagc taaaactctt atc 33

<210> 7

<211> 32

<212> DNA

<213> Artificial sequence

<400> 7

gtaacagttg ctgtagaggg aattggcttt tc 32

<210> 8

<211> 33

<212> DNA

<213> Artificial sequence

<400> 8

cacaacacct aacacacgat ggctatatga ttc 33

<210> 9

<211> 31

<212> DNA

<213> Artificial sequence

<400> 9

gttaagattg ctgatcgatt aattgatatc c 31

<210> 10

<211> 30

<212> DNA

<213> Artificial sequence

<400> 10

gagcagtcaa taagatgaga cgatagttag 30

<210> 11

<211> 27

<212> DNA

<213> Artificial sequence

<400> 11

gcagtacagc agtttgttgg actgacc 27

<210> 12

<211> 26

<212> DNA

<213> Artificial sequence

<400> 12

gaatattttc attatcagtc ccagtc 26

<210> 13

<211> 32

<212> DNA

<213> Artificial sequence

<400> 13

cttcgttagt taaaattcta aatttttcta ag 32

<210> 14

<211> 28

<212> DNA

<213> Artificial sequence

<400> 14

gtcccaatac cagtccttgc aacacaag 28

<210> 15

<211> 27

<212> DNA

<213> Artificial sequence

<400> 15

gaactgaata agtcagattt aatcagc 27

<210> 16

<211> 26

<212> DNA

<213> Artificial sequence

<400> 16

accaagatcc tgacgggcta atcaat 26

<210> 17

<211> 32

<212> DNA

<213> Artificial sequence

<400> 17

gtcattgtta cgattagttt cgatagttga gg 32

<210> 18

<211> 32

<212> DNA

<213> Artificial sequence

<400> 18

aattcaattc ctaagtcctc ttccataaac tc 32

<210> 19

<211> 31

<212> DNA

<213> Artificial sequence

<400> 19

gatgccatga atcaagcagt ggctataaat c 31

<210> 20

<211> 30

<212> DNA

<213> Artificial sequence

<400> 20

atcctcgtgt ataatttcag gtatgccacc 30

<210> 21

<211> 33

<212> DNA

<213> Artificial sequence

<400> 21

ttcgtgatga taattccaat gatcaaacaa gag 33

<210> 22

<211> 32

<212> DNA

<213> Artificial sequence

<400> 22

gatgtaacaa atttgtagcg actaaggtct gc 32

<210> 23

<211> 29

<212> DNA

<213> Artificial sequence

<400> 23

ttggaatttt ttaattagtg gcttaccta 29

<210> 24

<211> 31

<212> DNA

<213> Artificial sequence

<400> 24

catccgctta ttaattgaag taatctgaac c 31

<210> 25

<211> 31

<212> DNA

<213> Artificial sequence

<400> 25

atggtgtgat ttctcctaga ttggaaagta g 31

<210> 26

<211> 31

<212> DNA

<213> Artificial sequence

<400> 26

cttctccaat tgcttaccaa gtgcaataac g 31

<210> 27

<211> 32

<212> DNA

<213> Artificial sequence

<400> 27

ctctatagaa tggagtatat aaactatggt ta 32

<210> 28

<211> 34

<212> DNA

<213> Artificial sequence

<400> 28

ccaaagaaaa tactaacatt atcacaatat tggc 34

<210> 29

<211> 32

<212> DNA

<213> Artificial sequence

<400> 29

gagtatagcc agattatggc agttttattg tc 32

<210> 30

<211> 32

<212> DNA

<213> Artificial sequence

<400> 30

ctccagcact tgcgctggaa acaacagaca ac 32

<210> 31

<211> 32

<212> DNA

<213> Artificial sequence

<400> 31

gttagtcctg ttttagattt atttggtgat gt 32

<210> 32

<211> 30

<212> DNA

<213> Artificial sequence

<400> 32

gagcagtcaa taagatgaga cgatagttag 30

<210> 33

<211> 25

<212> DNA

<213> Artificial sequence

<400> 33

gcaacaaacg gcgtgaaagt agttg 25

<210> 34

<211> 30

<212> DNA

<213> Artificial sequence

<400> 34

caagatgaat atcactacca ataacaaaac 30

<210> 35

<211> 30

<212> DNA

<213> Artificial sequence

<400> 35

aatttgtatt ttattcatgc ctatatctgg 30

<210> 36

<211> 29

<212> DNA

<213> Artificial sequence

<400> 36

ttagcggaga taatttaaaa tgatgacta 29

<210> 37

<211> 31

<212> DNA

<213> Artificial sequence

<400> 37

ggacatgttc aggtgatttc ccaatatagt g 31

<210> 38

<211> 32

<212> DNA

<213> Artificial sequence

<400> 38

gattatgagt gtaatttatt ccaacttctc cc 32

<210> 39

<211> 32

<212> DNA

<213> Artificial sequence

<400> 39

atacctacac aacttctgat tatgcctttg tg 32

<210> 40

<211> 35

<212> DNA

<213> Artificial sequence

<400> 40

gctcgataaa cataatcaat atttgaaaaa gtatg 35

<210> 41

<211> 29

<212> DNA

<213> Artificial sequence

<400> 41

cttggcgcag gtgtcagaat tccctctac 29

<210> 42

<211> 31

<212> DNA

<213> Artificial sequence

<400> 42

gccaaaatac tgacaaagct agaatatagc c 31

<210> 43

<211> 32

<212> DNA

<213> Artificial sequence

<400> 43

cttaatagct ctcattattc tttttttaag cc 32

<210> 44

<211> 30

<212> DNA

<213> Artificial sequence

<400> 44

ttatctgtaa accatatcag catctgaaac 30

<210> 45

<211> 31

<212> DNA

<213> Artificial sequence

<400> 45

ctgttacttg ttctggactc tcgataattg g 31

<210> 46

<211> 31

<212> DNA

<213> Artificial sequence

<400> 46

gcccactcct gttaaaatcc tacccgcatt g 31

<210> 47

<211> 27

<212> DNA

<213> Artificial sequence

<400> 47

gaaggcaatc aatgtgattg tgtcgcg 27

<210> 48

<211> 31

<212> DNA

<213> Artificial sequence

<400> 48

cttcaaaatg aagattatag tacccttcta c 31

<210> 49

<211> 30

<212> DNA

<213> Artificial sequence

<400> 49

ggtgtagatt taccattagt gtcggcagac 30

<210> 50

<211> 31

<212> DNA

<213> Artificial sequence

<400> 50

gaatttcttc tttaagattc ggatatttct c 31

<210> 51

<211> 30

<212> DNA

<213> Artificial sequence

<400> 51

cacggctgag atgttggata atatggaaac 30

<210> 52

<211> 30

<212> DNA

<213> Artificial sequence

<400> 52

tgccctgatt gtggaagtct aatgaagaaa 30

<210> 53

<211> 30

<212> DNA

<213> Artificial sequence

<400> 53

aaaggcgaaa gaacacttgg aacaaacagg 30

<210> 54

<211> 30

<212> DNA

<213> Artificial sequence

<400> 54

cctcactcct accagaaact tgccacatcc 30

Claims

1. A specific primer pair for detecting the serotype 10A of pneumococcus is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1-2.

2. Use of a specific primer pair according to claim 1 in the preparation of a kit for detecting pneumococcal serotype 10A.

3. A kit comprising the specific primer set according to claim 1.

4. The kit of claim 3, wherein the operating program comprises the steps of:

(1) extracting the genome DNA of a sample to be detected;

(2) performing a PCR reaction on the sample DNA with the specific primer pair of claim 1; and (3) detecting the PCR product through electrophoresis, wherein if the size of the fragment of the target product is 607bp, the sample to be detected contains the pneumococcal 10A serotype.

5. The kit of claim 4, wherein the PCR reaction is carried out under the following conditions: pre-denaturation at 94 ℃ for 5 min; 94 ℃ for 45s, 55 ℃ for 45s, 72 ℃ for 90s, 30 cycles; extension at 72 ℃ for 10 min.

6. A method of detecting pneumococcal 10A serotype in a vaccine, comprising the steps of:

(1) extracting the genome DNA of a sample to be detected;

7. A kit for detecting 23 valent pneumococcal serotypes, wherein the kit comprises the specific primer pair of claim 1, and the 23 valent pneumococcal serotypes are 1, 2,3, 4, 5, 6B, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15B, 17F, 18C, 19A, 19F, 20, 22F, 23F and 33F, respectively.

8. The kit of claim 7, comprising 6 sets of specific primer combinations, each set comprising A, B, C, D, E, F sets,

9. A specific primer combination for detecting 23-valent pneumococcal serotypes is characterized by comprising 24 pairs of specific primer pairs, wherein the nucleotide sequences of the specific primer pairs are respectively shown as SEQ ID NO 1-48.

10. Use of the specific primer pair of claim 1 or the specific primer combination of claim 9 in quality control of pneumococcal vaccine production.